Lymph Node Fibroblastic Reticular Cells Attenuate Immune Responses Through Induction of Tolerogenic Macrophages at Early Stage of Transplantation : Transplantation

Journal Logo

Original Basic Science

Lymph Node Fibroblastic Reticular Cells Attenuate Immune Responses Through Induction of Tolerogenic Macrophages at Early Stage of Transplantation

Liu, Beichen PhD1,2; Liu, Huihui PhD1; Liu, Siwei PhD1; Qin, Chenchen PhD1; He, Xiaoya PhD1; Song, Zhengyang PhD1; Dong, Yujun MD, PhD1; Ren, Hanyun MD, PhD1

Author Information
Transplantation 107(1):p 140-155, January 2023. | DOI: 10.1097/TP.0000000000004245
  • Free
  • SDC
  • Infographic

Abstract

INTRODUCTION

Secondary lymphoid organs (SLOs), which include the spleen, lymph nodes (LNs), and mucosal-associated lymphoid tissue, are essential components of the immune system.1 Stromal cells are a type of nonhematopoietic cell in SLOs characterized by the common expression of GP38 in the absence of hematopoietic, epithelial, and endothelial markers. These cells facilitate the formation of scaffold structures and support the distinct microenvironments required for efficient immune cell communications.2 Fibroblastic reticular cells (FRCs), which are a type of stromal cell, have recently been found to be responsible for framework compositions and controlling innate and adaptive immune responses in SLOs.2,3

FRCs are found in the paracortical region‚ and their functions in adaptive immune responses have been studied thoroughly. FRCs secrete CCL19 and CCL21 to lead the migration of CCR7+ T cells and dendritic cells to SLOs, which greatly improves antigen-presenting efficiency.4 FRCs also secret IL-7 to promote T-cell survival.5 Moreover, FRCs engage in peripheral immune tolerance by deleting the vast majority of self-reactive T cells.6 During homeostasis, FRCs avoid excessive T-cell activation partly by producing a high level of prostaglandin E2, which is attributed to high expression of COX-2.7 Under inflammatory conditions, FRCs sense several types of inflammatory cytokines and consequently upregulate the levels of inducible nitric oxide synthase to restrict T-cell proliferation.8 FRCs also inhibit T-cell expansion by decreasing the immunogenicity of DCs, thereby slowing down antigen presentation.9 Because of the tolerogenic properties of FRCs, ex vivo–expanded allogeneic FRCs are administered for high-mortality murine sepsis and LN fibrosis.10,11 Administration of FRCs to recipients in graft-versus-host disease (GVHD) mice could also ameliorate LN pathology and prolong mouse survival.12

Macrophages are vital immunoregulating cells that participate in innate immunity. However, their roles in SLOs, especially in LNs, and their relationship with FRCs remain unclear. Studies have indicated 2 tissue origins of macrophages. One is from the yolk sac during early embryonic development. The other is derivation from circulating monocytes generated in bone marrow.13 Recently, Valencia et al have found that FRCs secrete several growth factors that may expand the myeloid lineage that includes macrophages.14 Under inflammation and transplantation conditions, circulating hematopoietic stem cells (HSCs) increase and may reach LNs to maintain homeostasis and repair tissue damage.15 This allows FRCs and HSCs to coexist in the microenvironment of the SLOs. Therefore, FRCs may lay the foundation for macrophage differentiation.

Acute GVHD (aGVHD) is a systematic inflammatory disease characterized by various clinical manifestations with immune activation and cytokine storm. However, the initial immunological events in SLOs especially in LNs after transplantation have not been fully elucidated. Although Chung et al have demonstrated that Notch signaling in FRCs has been linked to GVHD pathogenesis,16 Michonneau et al have proved that immune tolerance also occurs in SLOs compared with immune activation in aGVHD target organs at an early stage of allogeneic HSC transplantation (allo-HSCT). This is indicated by increased PD-L1 and PD-L2 expression on macrophages and DCs in the microenvironment of the SLOs,17 which suggests that SLOs possess distinct immunoregulatory mechanisms from GVHD target organs. It is possible that lymphoid stromal cells influence the initiation and regulation of this immune response. In this study, we observed that macrophages with tolerogenic phenotype are generated in LNs under allo-HSCT conditions. Ex vivo–cultured FRCs can induce myeloid progenitor cells to immunosuppressive macrophages that negatively regulate T-cell immunity. This study has revealed a novel mechanism of immune regulation through generation of FRC-induced tolerogenic macrophages in LNs at an early stage of allo-HSCT.

MATERIALS AND METHODS

Mice

Male BALB/c (H2d) and female C57BL/6J mice (H2b) at 6 to 8 wk of age were purchased from SPF Biotechnology (Beijing, China). Mice were housed and bred in temperature-controlled and pathogen-free cages. Mice were euthanized by CO2 inhalation. All animal-based experimental procedures were performed in accordance with protocols approved by the Institutional Animal Care and Ethics Committee of Peking University First Hospital.

Immunofluorescence

Inguinal LNs of intact mice and day 7 post-total body irradiation (TBI) and day 7 post-allo-HSCT male BALB/c mice were fixed overnight in 4% paraformaldehyde. For the TBI model, BALB/c mice only received 7.5 Gy 60Co TBI, and for the allo-HSCT model, BALB/c mice were injected with 5 × 106 bone marrow cells (BMCs) and splenocytes (SPCs) of C57BL/6J mice intravenously after irradiation. Fixed tissues were embedded in 4% agarose in PBS and sectioned. After treatment with 3% H2O2 to eliminate endogenous peroxidase activity, tissues were incubated in 3% BSA for 30 min to block nonspecific binding. Sections were incubated overnight at 4 °C with the primary antibodies and detected by the following secondary antibodies (Table 1). Sections were counterstained with 0.5 µg/mL DAPI (4',6-diamidino-2-phenylindole). Immunohistochemically stained sections were digitally scanned at ×8.5 and ×200 magnifications using an Ortho-Fluorescence Microscope (Nikon). Images were visualized using CaseViewer software (3DHISTECH Ltd).

TABLE 1. - List of antibodies used in immunofluorescence
Name Producer Code Dilution
Primary antibody
 Anti-Ki-67 Servicebio GB111141 1:3000
 Anti-GP38 eBioscience 145381-81 1:200
 Anti-F4/80 Proteintech 28463-1-AP 1:200
Secondary antibody
 Cy3-conjugated Goat Anti- rabbit IgG (H+L) Servicebio GB23103 1:300
 HRP-conjugated Goat Anti- rat IgG (H+L) Servicebio GB23301 1:500
 AF647-conjugated Rabbit Anti- hamster IgG (H+L) Jackson 307-605-003 1:300
 4',6-diamidino-2-phenylindole Servicebio G1012

FRCs Separation and Culture

FRCs were obtained by a previously described method with some modifications.18 In brief, mesenteric and inguinal LNs were pooled from 10 to 15 mice and cut into small pieces. Fragments were digested in 5 mL Roswell Park Memorial Institute medium (Gibco) with collagenase iv (1 mg/mL; Sigma-Aldrich), DNAse I (40 mg/mL; Roche), and 2% fetal bovine serum (Gibco) for 30 min at 37 °C with shaking. The suspension was gently pipetted until no visible fragments remained. The reaction was stopped and then filtered through a 40-μm nylon mesh to remove debris and cell clumps. Cells were cultured in αMEM (Gibco) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin (complete αMEM medium). Cultures were washed after 48 h and allowed to expand 2 passages before use.

Macrophage Generation

BMCs were harvested from female C57BL/6J mice. LMs were generated by culturing BMCs with L929 cell-conditioned medium for 7 d as described previously.19 For FRC-induced macrophage (FM) generation, 5 × 106 BMCs were seeded on a monolayer of 1 × 105 FRCs that were precultured for 7 d. FMs were positively selected with a CD11b magnetic-activated cell sorting system (Miltenyi Biotec). Purified cells were typically >90% CD11b+ F4/80+ as verified by flow cytometry.

Coculture Assay

Transwell inserts (0.4-μm pore size, Corning) were placed in 24-well plates‚ and 2 × 104 FRCs were seeded in the upper chamber. A total of 2 × 106 BMCs and various concentrations of the anti-CD115 (AFS98) antibody were placed in the lower chamber. BMCs without any treatment were used as the control. The cells were incubated at 37 °C for 7 d. Cell numbers were determined by a Cellometer Auto 2000 (Nexcelom)‚ and the immunophenotype was analyzed by flow cytometry.

Flow Cytometry

The following fluorochrome-conjugated antibodies were used for flow cytometry: CD45, GP38, CD31, CD90, CD44, CD29, CD11b, F4/80, IA/IE, PD-L1, PD-L2, CD11c, CD14, CD86, CD206, Arg-1, CD115, CD73, CD39, IL-4Ra, CD3, CD4, CD8, CD25, CD127, IFN-γ, IL-4, IL-17, CD69, CD16/32, Zombie violet, and the respective isotype controls were purchased from Biolegend. 7AAD was obtained from BD. Single-cell suspensions were incubated with the anti-CD16/32 antibody to block Fc-dependent interactions. For surface staining, cells were stained with antibodies diluted in PBS containing 0.1% BSA. For cytokine detection, T cells were stimulated with a Biolegend Cell Stimulation Cocktail (plus protein transport inhibitors) for 5 h before cytokine staining. Cells were fixed, permeabilized using a BD IntraSure Kit, and subsequently stained with cytokine antibodies. Flow cytometry was performed with a FACS Canto II (BD). Data were analyzed by FlowJo software.

mRNA Isolation and RT-qPCR

RNA was isolated by Trizol Reagent (Life Technologies, Grand Island, NY). cDNA was synthesized by Superscript III First-Strand Synthesis (Invitrogen). The gene-specific primers are listed in Table 2. Relative gene expression was determined using SYBR Green Master Mix (Thermo Fisher). Real-time quantitative PCR (RT-qPCR) was run on an Applied Biosystem ViiA7 Q-PCR machine. The ΔΔCT method was applied to analyze relative gene expression that was normalized to GAPDH as the reference gene.

TABLE 2. - List of primers for RT-qPCR
Gene Forward primer (5′–3′) Reverse primer (5′–3′)
Gapdh AACTTTGGCATTGTGGAAGG ACACATTGGGGGTAGGAACA
Cox-2 CTCCGTAGAAGAACCTTTTCCA CCTTCTCCAACCTCTCCTACT
Ccl-19 TCACTTGCACTTGGCTCCTGAA AGCCTGAGAGACTGTGTGCG
Ccl-21 TTCACGGTCCAACTCACAGG CAGCTCCGCCAGGTAAGAAA
Il-7 CTTGCTTTTTCCAGCCACGT AGGCATGGCTACCACACATG
Galectin-1 ACTTCAATCCTCGCTTCAA GGCCACGCACTTAATCTT
Gm-csf GCCATCAAAGAAGCCCTGAA GCGGGTCTGCACACATGTTA
M-csf TCAACAGAGCAACCAAACCA ACCCAGTTAGTGCCCAGTGA
G-csf TGGCAGCAGATGGAAAACCTAG AGGTACGAAATGGCCAGGACA
Scf ACGTCTGAGTGCTGAAAACCC CACCATCCAGGCTGAAATCTAC
Flt3l GAGGACGTCAACACCGAGAT AGGTGGGAGATGTTGGTCTG
Il-6 ATCCAGTTGCCTTCTTGGGACTGA TAAGCCTCCGACTTGTGAAGTGGT
Il-1β AGTTGACGGACCCCAAAAGAT GTTGATGTGCTGCTGCGAGA
Vegfa CACGACAGAAGGAGAGCAGAAG CTCAATCGGACGGCAGTAGC
Fn1 TGGTGGCCACTAAATACGAA GGAGGGCTAACATTCTCCAG
Col5a2 TGGGTTTACAAGGACAGCAA CCAGGTTCACCATCTTCTCC
Collegen1a1 AGAAGGCCAGTCTGGAGAAA GAGCCCTTGAGACCTCTGAC
aSMA CTCCCTGGAGAAGAGCTACG TGACTCCATCCCAATGAAAG

Measurements of Cytokines and Chemokines by ELISAs

A total of 5 × 104/well FRCs were cultured in 24-well plates. The same number of BMCs was seeded under the same conditions as a negative control. Each well was filled with 500 μl complete αMEM. The serum of C57BL/6J mice was used as another negative control. After 72 h, the supernatant was collected‚ and the concentrations were measured by ELISAs (Servicebio).

RNA-seq Library Preparation

RNA was extracted from pellets of peripheral blood macrophages (PBMs), LMs, and FMs. Total RNA of each sample was quantified and qualified by an Agilent 2100 Bioanalyzer (Agilent Technologies) and NanoDrop (Thermo Fisher). Next-generation sequencing library preparations were constructed according to the manufacturer’s protocol (NEBNext Ultra RNA Library Prep kit for Illumina).20 The sequences were processed and analyzed by GENEWIZ.

Mixed Lymphocyte Reaction

Responder cells from spleens of C57BL/6J mice were purified by using a MojoSort mouse CD3 T-cell Isolation Kit (Biolegend). To assess proliferation, responder T cells were labeled with the carboxyfluorescein diacetate succinimidyl ester as described.21 For the stimulator cells, SPCs from BALB/c mice were treated with mitomycin C. Then, equal amounts of responder and stimulator cells (1 × 106 cells/well) were seeded together in each well of 96-well plates. FMs were added at 3.3 × 104 to 1 × 106/well (1:30–1:1 responder cells/FMs). Nw-hydroxy-nor-arginine and L-NG-monomethyl-arginine-citrate were diluted to a final concentration of 500 μM to inhibit arginase and NOS activity. For IL-4, IL-10, PD-L1, CD39, and CD73 inhibition, a purified neutralizing antibody was added at 10 μg/ml as the final concentration. Cells were incubated for 7 d. Proliferation was determined by flow cytometry.

Murine aGVHD Model

All male BALB/c recipient mice received 7.5 Gy 60Co TBI to finish the myeloablative regimen. BMCs and SPCs from C57BL/6J mice were iv injected with cell mixtures of 5 × 106 BMCs and 5 × 106 SPCs. BMCs infused were not T cell–depleted. To evaluate the effect on aGVHD, 1 × 107 CD11b positively selected FMs or LMs from C57BL/6J mice were injected through the tail vein. aGVHD scores were determined by assessment of weight, activity, fur ruffling, skin, and posture.22

Histopathology

Organs were fixed in 10% formalin and embedded in paraffin. Sections of 4–6 μm thick were mounted on microscopy slides and continuously stained with hematoxylin and eosin or antibodies against murine CD4 or CD8. Histopathological changes were photomicrographed using a previously published grading scale.23

Serum Cytokine Analysis

Peripheral blood from each group was obtained on day 7 posttransplantation. Serum was collected and stored at −80 °C until analysis. Production of IFN-γ, TNFα, IL-17, and IL-6 cytokines was measured with a BD Cytometric Bead Array in accordance with the manufacturer’s instructions.

Statistics

Statistical analysis was performed using GraphPad Prism 6. All data are presented as means ± SD of at least 3 independent experiments. Student t test was used for 2-group comparison and analysis of variance for multiple comparisons. Survival data were compared using the log-rank (Mantel-Cox) test. P < 0.05 was considered statistically significant.

RESULTS

Macrophages Proliferate Locally in LNs After Early Transplantation

To confirm macrophage accumulation in LNs at an early stage of allo-HSCT in mice, we analyzed LNs of day 7 posttransplanted mice and their control intact and day 7 post-TBI mice. FRCs and macrophages were stained for GP38 and F4/80, respectively. Compared with the TBI group, allo-HSCT groups showed a greater LN volume (Figure 1A), which suggested cell proliferation in recipient mice was almost eliminated by lethal irradiation. We noticed that the number of Ki-67+ newly generated macrophages within LNs in the allo-HSCT group was much greater than that in the intact and TBI group. Phenotypic analysis showed that the macrophages in LNs in allo-HSCT mice had a tolerogenic phenotype with high expression of immunosuppressive molecules PD-L1, CD73‚ and CD39 and lower expression of MHC-II (Figure 1B).

F1
FIGURE 1.:
Tolerogenic phenotypes of macrophages were generated in LNs at an early stage of allo-HSCT. A, Scan of inguinal LNs harvested from intact mice, mice that only received 7.5 Gy 60Co irradiation (post day 7)‚ and allo-HSCT recipient mice (post day 7). Blue: 4',6-diamidino-2-phenylindole. Green: Ki-67. Red: F4/80. Pink: GP38. From left to right, scale bars represent 100 μm and 5 μm. Macrophages are indicated by white arrowheads in images with a 5-μm scale bar. n = 4 for each group. B, Flow cytometry analysis of CD11b+F4/80+ macrophages in 3 groups. The number of CD11b+F4/80+ macrophages in LNs was calculated by flow cytometry. The macrophages in the allo-HSCT group were further examined for the expression of IA/IE, PD-L1, CD73, and CD39. Because of too few cell numbers in the intact and TBI group, macrophages in these groups were not available for phenotypic analysis. Solid lines, mAbs as indicated; dashed lines, isotype; dotted lines, positive control. The results are representative of 3 different experiments (n = 4 for intact and allo-HSCT group, n = 2 for TBI group). Bars represent means ± SD. *P < 0.05; **P < 0.01; ***P < 0.001. allo-HSCT, allogeneic hematopoietic stem cell transplantation; LN, lymph node.

Characterization of Ex Vivo–cultured Mouse FRCs

The culture system of FRCs is established based on the method of Bar-Ephraim et al.18 The results showed that the cells were bona fide FRCs at passage 2 (P2) and exhibited a spindle to stellate shape that represents the typical morphology of fibroblastic cells (Figure 2A).24 The cells were positive for GP38 and negative for hematopoietic marker CD45 and endothelial marker CD31 (Figure 2B). They also expressed molecules common to mesenchymal cells, such as CD90, CD44, and CD29. (Figure 2C).

F2
FIGURE 2.:
Ex vivo–cultured stromal cells show phenotypic characteristics of FRCs. A, Images of ex vivo–cultured FRCs (harvested at passage 2) were obtained at ×40 magnification. B, Typical GP38+CD31- phenotype of FRCs induced by ex vivo–cultured stromal cells. Representative dot plots of stained FRCs. C, Expression of mesenchymal markers by ex vivo–cultured FRCs. Gates were set on the basis of the isotype control. D, PCR analysis of cultured FRCs compared with PBMs and BMCs (n = 4) for genes associated with the extracellular matrix, cytokines, and chemokines. Data are relative expression to GAPDH. The results are representative of 3 different experiments. Bars represent means ± SD. *P < 0.05; **P < 0.01; ***P < 0.001. BMC, bone marrow cell; FRC, fibroblastic reticular cell; ND, not determined; NS, not significant; PBM, peripheral blood macrophage.

To further characterize ex vivo FRCs, we performed PCR analyses of Cox-2, Ccl21, Ccl19, Il-6, and Il-7, all of which are molecular markers of FRCs (Figure 2D).25 Previous studies have shown that COX-2 mediates T-cell suppression by enhancing the T-cell activation threshold during homeostasis,7 which was also observed in our study. The ex vivo–cultured FRCs expressed lower levels of Ccl19 and Ccl21 transcripts than the two control groups. This was probably due to the long-term ex vivo culture without inflammatory stimulators‚ as demonstrated by Stefanie et al.8IL-6 was the dominant cytokine secreted by ex vivo-cultured FRCs compared with control BMCs. In addition to chemokines and cytokines, FRCs produced an extracellular matrix‚ which is correlated with high expression of fibronectin 1 (Fn1), collagen type V (Col5a2), collagen type I (Col1a1), and alpha-smooth muscle actin (α-SMA).26 Taken together, these results confirmed the phenotypic characteristics of genuine FRCs at protein and mRNA levels.

FRCs Induce BMCs Into M2 Macrophage Subtype

To test our hypothesis that FRCs may proliferate BMCs into macrophages, we first cocultured FRCs with BMCs ex vivo for 7 d. For comparison, L929 cell-conditioned medium-induced conventional macrophages (LMs) were used as control.27-30 Morphologically, these FRC-induced cells appeared to be macrophages with a smaller size, less cytoplasm, and lower lysosomal content than LMs (Figure 3A). These cells exhibited a CD11b+F4/80+ macrophage phenotype (Figure 3B) with high expression of CD14 and CD115 but low levels of DC lineage marker CD11c.31 Thus, we postulated that FMs may belong to the macrophage subset. Our results showed that both FMs and LMs expressed M2 marker (CD206) but not M1 marker (CD86 and IA/IE) (Figure 3C). To further characterize FMs, we investigated the expression of key molecules for immune suppression‚ including PD-L1 and PD-L2 and ectonucleotidases CD39 and CD73.32-34 The results showed that FMs also expressed high levels of PD-L1, CD73, and CD39, which was consistent with the in vivo data (Figure 1B). Taken together, these results suggested that FMs tended to be M2 macrophages and possess potential immunosuppressive capacity.

F3
FIGURE 3.:
Morphological and phenotypic characteristics of FMs. BMCs were cultured on a monolayer of FRCs for 7 d and then sorted by CD11b magnetic-activated cell sorting (FMs) or cultured in complete medium with 10% L929 culture supernatant for 7 d (LMs). A, Images were obtained at ×400 magnification under an Olympus LX73 inverted microscope. B, Expression of CD11b+F4/80+ on FMs and LMs was examined by flow cytometry. C, Expression of specific markers on the left was determined after gating on F4/80+CD11b+ macrophages. Gates were set on the basis of the isotype control. Data are representative of at least 3 independent experiments. *P < 0.05; **P < 0.01; ***P < 0.001. BMC, bone marrow cell; FRC, fibroblastic reticular cell; FM, FRC-induced macrophage; LM, L929 cell-conditioned medium-induced conventional macrophage.

Macrophage Colony-stimulating Factor Is a Crucial Cytokine for FM Induction

To identify crucial regulators of FMs induction, we examined the expression of several factors that are known to promote monocyte/macrophage differentiation using RT-qPCR. The assay showed that macrophage colony-stimulating factor (M-CSF), VEGFA, SCF, and Galectin-1 were elevated, whereas IL-1β was downregulated in FRCs compared with control groups (Figure S1, SDC, https://links.lww.com/TP/C476). Similar results were observed at the protein level revealed by ELISAs except for SCF (Figure 4). Among these, M-CSF was the most highly expressed in FRCs. Therefore, we inferred that M-CSF may be the reason for FM generation‚ and other factors may orchestrate FM polarization and functions. Next, we used monoclonal antibody AFS-98 to block binding of M-CSF to its receptor, thereby inhibiting M-CSF–dependent colony formation. In this coculture system, BMCs and FRCs were cocultured for 7 d with cell-cell contact or separated by transwell inserts (FRCT, no cell contact) in the presence of increasing AFS98 concentrations.

F4
Figure 4.:
Myeloid-related growth factors expressed by FRCs. FRCs (5 × 104) and BMCs of B6 mice were cultured in 500 μl complete αMEM for 72 h. Then, the culture supernatant of these cells and the same volume of B6 mouse serum were collected. Expressions of M-CSF, VEGFA, Galectin-1, and SCF in serum and culture supernatants were measured by ELISAs. Results are representative of 3 different experiments. Bars represent means ± SD. *P < 0.05; **P < 0.01; ***P < 0.001. BMC, bone marrow cell; FRC, fibroblastic reticular cell; M-CSF, macrophage colony-stimulating factor.

As shown in Figure 5, without AFS98, the proportion of macrophages reached approximately 85% in both FRCs and transwell groups, compared with the BMCs group that only contained 43% to 47%, which indicated direct cell-cell contact was unnecessary for FM generation. With AFS98 at 2 μg/ml, the proportion of macrophages was decreased dramatically to the baseline level as observed in the BMCs alone group, which indicated that M-CSF secreted by FRCs was essential for FM generation.

F5
FIGURE 5.:
M-CSF secreted by FRCs supports FM development. BMCs were either cocultured with FRCs or segregated by transwell inserts for 7 d. In transwell inserts, 2 × 104 FRCs were seeded in the top well (insert) of the transwell (Cell Culture Insert, 0.4-μm pore size; Falcon, Corning, NY)‚ and 2 × 106 BMCs were seeded in the bottom well. AFS98 at various concentrations was added as indicated. After 7 d of cultivation, cells in the bottom well were digested‚ and CD11b+F4/80+ macrophages were determined by flow cytometry. Results are representative of 3 different experiments. Bars represent means ± SD. *P < 0.05; **P < 0.01; ***P < 0.001. BMC, bone marrow cell; FM, FRC-induced macrophage; FRC, fibroblastic reticular cell; M-CSF, macrophage colony-stimulating factor; LM, L929 cell-conditioned medium-induced conventional macrophage.

FMs Show a Different Gene Expression Profile Related to Increased Expression of Anti-inflammatory Genes

We performed RNA-seq analysis of macrophages isolated from C57BL/6J mouse PBMs, FMs, and LMs generated from BMCs to further compare their gene expression profiles. The data have been uploaded to the NCBI Sequence Read Archive database (SRA accession: PRJNA748520). FMs and LMs had similar gene expression profiles that were distinct from PBMs in terms of differentially expressed gene numbers and pattern (Figure 6A and B).

F6
FIGURE 6.:
FMs have a distinct gene expression profile that differs from conventional M2 and peripheral macrophages. A, Differentially expressed genes from RNA-seq data of 9 samples, 3 each of FM, LM, and PBM populations (fold change >2, q-value ≤ 0.05). B, Each column of the heatmap is a unique sample. Heatmap displaying differentially regulated genes between PBMs, LMs, and FMs. Red, high. Blue, low relative gene expression. C, Kyoto Encyclopedia of Genes and Genomes analysis between LMs and FMs. D, Gene set enrichment analysis between LMs and FMs. LM, L929 cell-conditioned medium-induced conventional macrophage; PBM, peripheral blood macrophage.

Although similar profiles were observed, we focused on the differentially expressed genes between FMs and LMs. We then performed Kyoto Encyclopedia of Genes and Genomes pathway analysis and gene set enrichment analysis of the differentially expressed genes. Kyoto Encyclopedia of Genes and Genomes pathway analysis showed that the 3 most enriched pathways in human diseases were pathways in cancer, HTLV-I infection, and transcriptional misregulation in cancer, which were all associated with immune suppression (Figure 6C). Gene set enrichment analysis also revealed that genes associated with MHC-I protein complex, antigen processing, and immune responses were negatively corrected with FMs (Figure 6D). Together, we assumed that FMs may have an increased capacity for anti-inflammation.

FMs Inhibit T-cell Activation, Proliferation, and Proinflammatory Cytokine Secretion in a Mixed Lymphocyte Reaction

Immunomodulatory properties of FMs were assessed using mixed lymphocyte reaction (MLR; see Material and Methods for MLR details). The results showed that FMs significantly reduced the T-cell number at T cell:FM ratios of 1:1 to 10:1 (Figure S2a, SDC, https://links.lww.com/TP/C476). The ratio of 15:1 was used for further experiments to evaluate the immunosuppressive function of FMs (Figure S2b, SDC, https://links.lww.com/TP/C476). FMs impaired T-cell activation as indicated by reduced CD25 expression. To elucidate the inhibition mechanism, a series of antagonists were added to the culture system. As shown in Figure 7, a PD-L1 neutralizing antibody could partially reverse the compromised T-cell activation. The inhibition of T-cell proliferation could be relieved by an anti-IL-4 antibody. However, no single antagonist restored both T-cell activation and proliferation, which implied FMs inhibit T-cell immunity by multiple mechanisms. We next examined whether FMs could affect T-cell differentiation. We found that FMs significantly reduced Th1/Tc1 population based on an equivalent percentage of IFN-γ–producing cells. Taken together, these results demonstrated the immunosuppressive function of FMs in vitro.

F7
FIGURE 7.:
FMs significantly decrease the number of T cells. Allogeneic MLR was performed by mixing B6 purified T cells with mitomycin C-treated allogeneic Balb/c splenocytes (1:1 ratio) and FMs at various ratios for 7 d. Purified B6 T cells were labeled with CFSE. For cytokine analysis, cells were treated with a T-cell stimulation cocktail for 5 h. MLR/FM (1:15 ratio) cocultures were untreated or treated with IL-4 (10 μg/ml), IL-10 (10 μg/ml), PD-L1 (10 μg/ml), CD73 (10 μg/ml), and CD39 (10 μg/ml) neutralizing antibodies, arginase inhibitor, nor-NOHA (500 μM), and nitric oxide inhibitor L-NMMA (500 μM). Cell proliferation, activation, and differentiation were assessed by flow cytometry. Results are representative of 3 different experiments. Bars represent means ± SD. *P < 0.05; **P < 0.01; ***P < 0.001. CFSE, carboxyfluorescein diacetate succinimidyl ester; FM, fibroblastic reticular cell–induced macrophage; L-NMMA, L-NG-monomethyl-arginine-citrate; MLR, mixed lymphocyte reaction; nor-NOHA, Nw-hydroxy-norarginine.

FMs Efficiently Alleviate aGVHD

To examine the immunosuppressive function in vivo, FMs were intravenously injected into an aGVHD MHC-mismatched mouse model. We used a previously published scoring system to evaluate the severity and mortality of aGVHD.22 As shown in Figure 8A, the survival time of mice in the FMs group was significantly longer than that in the aGVHD and LMs groups. Compared with mice in the other groups, the mice that received FMs had significantly lower aGVHD scores and less weight loss (Figure 8B and C).

F8
FIGURE 8.:
FM injection alleviates aGVHD. aGVHD was induced in male BALB/c mice by injection of bone marrow and splenic cells from female C57BL/6J donors. Each lethally irradiated recipient received 5 × 106 BMCs and SPCs and 1 × 107 CD11b positively selected FMs or LMs on the transplantation day (n = 5). Mice that only received BMCs were used as the negative control (n = 4). A, Survival curve of each group. B, Body weight changes of mice. C, Systemic scores of aGVHD. Results are representative of 3 different experiments. Bars represent means ± SD. *P < 0.05; **P < 0.01; ***P < 0.001. aGVHD, acute graft-vs-host disease; BMC, bone marrow cell; FM, fibroblastic reticular cell–induced macrophage; LM, L929 cell-conditioned medium-induced conventional macrophage; SPC, splenocyte.

We next assessed tissue damage of aGVHD target organs by HE staining on day 21 posttransplantation. It showed that the FMs group had a relatively normal appearance for the central and portal areas in livers and the alveolar structure with few inflammatory cell infiltrations in the lungs compared with aGVHD mice. Besides, limited damage and preserved goblet cells were observed in the intestines in the FMs group (Figure 9). The injury and inflammation that existed in aGVHD target organs were usually driven by T lymphocytes infiltration.35 Immunohistochemistry confirmed less infiltration of CD4+ and CD8+ T cells in the FMs group (Figure S3, SDC, https://links.lww.com/TP/C476). We also examined the levels of multiple inflammatory cytokines in peripheral blood at day 7. As shown in Figure 10, the serum level of IFN-γ in the FMs group was significantly lower than that in control groups. Taken together, these data revealed that FMs could reduce tissue damage by decreasing lymphocyte infiltration into aGVHD target organs and downregulating the secretion of Th1 cytokine IFN-γ.

F9
FIGURE 9.:
FMs significantly alleviate histopathological injuries and T-cell infiltration in aGVHD target organs. Samples for liver, lung, and intestine sections were collected at day 21 after transplantation. Target organs were stained with H&E. The severity of pathological changes was scored using a previously established grading scale. Results are representative of 3 different experiments (n=4 for BMCs and aGVHD group‚ n=3 for FMs and LMs group). Bars represent means ± SD. *P < 0.05; **P < 0.01; ***P < 0.001. aGVHD, acute graft-vs-host disease; BMC, bone marrow cell; FM, fibroblastic reticular cell–induced macrophage; LM, L929 cell-conditioned medium-induced conventional macrophage.
F10
FIGURE 10.:
Expression of inflammatory cytokines in serum. Cytometric bead array to assay the concentrations of IFN-γ, TNF-α, IL-17a, and IL-6 in serum of mice on day 7 after transplantation. Results are representative of 3 different experiments (n = 4 for BMCs group, n = 11 for aGVHD group, n = 6 for LMs and FMs group). Bars represent means ± SD. *P < 0.05; **P < 0.01; ***P < 0.001. aGVHD, acute graft-vs-host disease; BMC, bone marrow cell; FM, fibroblastic reticular cell–induced macrophage; LM, L929 cell-conditioned medium-induced conventional macrophage.

FMs Suppress T-cell Responses in the Spleen

To understand the mechanism by which the transfusion of FMs alleviated aGVHD, we analyzed the number, activation, proliferation, and differentiation of donor T cells in recipient spleens. We noticed that FMs significantly reduced the number of CD3/CD4 cells but did not affect cell proliferation as indicated by carboxyfluorescein diacetate succinimidyl ester dilution (Figure S4, SDC, https://links.lww.com/TP/C476). We observed that FM groups had the lowest percentage of H2b+CD3+CD69+ T cells‚ which indicated that T-cell activation was inhibited. Additionally, FMs significantly suppressed the Th1/Tc1 but not the Th17/Tc17 subtype in vivo compared with that in the aGVHD group (Figure 11). Consistent with our previous results, these data demonstrated that FMs alleviated aGVHD partly by reducing T-cell proliferation, activation, and differentiation toward Th1/Tc1 cells.

F11
FIGURE 11.:
FMs inhibit donor T-cell activation and differentiation. Donor T cells were isolated from a recipient spleen after 7 d of transplantation. Expression of early T-cell activation marker CD69 and differentiation markers IFN-γ and IL-17 on donor CD4+ or CD8+ T cells was analyzed by flow cytometry. Results are representative of 3 different experiments (n = 4 for BMCs and FMs group, n = 3 for LMs group). Bars represent means ± SD. *P < 0.05; **P < 0.01; ***P < 0.001. aGVHD, acute graft-vs-host disease; BMC, bone marrow cell; FM, fibroblastic reticular cell–induced macrophage; LM, L929 cell-conditioned medium-induced conventional macrophage.

DISCUSSION

SLOs are essential to initiate the adaptive immune response. FRCs are mesodermal origin stromal cells located in the cortical and medullar regions of lymphoid organs, which are essential for structural and functional properties of LNs.36 For example, FRCs produce cytokines that are important for T-cell priming, which include CCL19 and CCL21, and homeostatic cytokines such as IL-7.37,38

FRCs have been shown to exhibit powerful immunosuppressive function in multiple ways. FRCs directly inhibit immune responses via expression of self-antigens and suppressive factors, such as inducible nitric oxide synthase and COX-2, or indirectly restrict T-cell expansion by lowering the immunogenicity of DCs.9,39,40 Moreover, FRCs could regulate macrophages to control humoral immunity.41 For example, FRCs limit the development of antibody-forming cells through monocyte accumulation and the reactive oxygen species system.42

Prior studies have mainly explored the important role of FRCs in adaptive immunity with limited effort on exploring their role in innate immunity. Macrophages as part of the innate immune system have been found in SLOs under steady-state and inflammatory conditions.43,44 These cells form an important barrier against spreading microbes and are responsible for clearance of apoptotic cells.45 Macrophages also participate in tissue inflammation and repair. Despite several studies reporting that macrophages accelerate aGVHD, they can be therapeutic depending on the number, properties, and utilization pattern.46,47 However, it is still unclear how macrophages in SLOs especially in LNs are generated. Recently, Valencia et al have found that FRCs in LNs secrete several factors related to macrophage expansion.14 Under transplantation conditions, circulating HSCs/progenitor cells increase and may reach LNs,15 which facilitate cell contact between FRCs and HSCs in the microenvironment of the SLOs. However, the immunological significance of this phenomenon for allo-HSCT has not been elucidated.

In our study, we found a significantly higher number of macrophages in allo-HSCT LNs than that in intact and TBI controls. Immunofluorescence verified that the vast majority of Ki-67+ nuclei were localized to F4/80+ macrophages in the paracortical area, which suggested that the macrophages were generated in situ. These newly generated macrophages may be immune tolerant because they express higher levels of immunosuppressive molecules. Therefore, we hypothesized that FRCs may participate in immune homeostasis partially through induction of immunoregulatory macrophages. To verify this hypothesis, we performed coculture experiments‚ which showed that FRCs also induced BMCs into tolerogenic macrophages as similar to macrophages induced in allo-HSCT LNs in vivo. Subsequent RT-qPCR and ELISAs analyses of FRCs showed elevated expression of M-CSF, an important growth factor for myeloid lineage development.48,49 Blockade of M-CSF receptor decreased the number of differentiated FMs to the base level, which confirmed M-CSF as the main factor for FM induction. These results demonstrated that the induction of tolerogenic macrophages may play an important role in maintaining immunosuppressive status in LNs even at an early stage of allo-HSCT. In fact, it proved that administration of M-CSF before transplantation effectively promotes macrophage proliferation in recipients and reduces the risk of mortality of aGVHD by diminishing T-cell activation.50,51

Further studies showed that FMs had tolerogenic characteristics for T lymphocytes. In vitro MLR showed that FMs suppressed T-cell activation, proliferation, and IFN-γ secretion. Using the aGVHD mouse model, we found that intravenous injection of these macrophages was also associated with immunosuppressive functions manifested by longer survival and a lower aGVHD score. The reduction of IFN-γ in serum together with less lymphocyte infiltration in aGVHD target organs further confirmed inhibitory effects of FMs on T cells.

In summary, this study proved that LN FRCs are capable of inducing regulatory macrophages, which may provide new insight into how FRCs influence adaptive immune responses by manipulating tolerogenic macrophages. These results may offer another explanation that‚ although the immune response is vigorous in aGVHD target organs, immune tolerance still predominates in LNs at an early stage of allo-HSCT.17 However, these results were obtained mainly from in vitro experiments and still need to be further confirmed in vivo. The complex immune microenvironment in LNs may change M-CSF expressed by FRCs over time, and multiple cell components might affect macrophage function to some extent. Therefore, gene knockout mice are needed to demonstrate this opinion in future work. Our present work may provide a new insight into immune regulation in SLOs both in steady state and in allo-HSCT conditions.

ACKNOWLEDGMENTS

The authors thank the members of the Department of Hematology of Peking University First Hospital for technical assistance and discussions.

REFERENCEs

1. Ruddle NH, Akirav EM. Secondary lymphoid organs: responding to genetic and environmental cues in ontogeny and the immune response. J Immunol. 2009;183:2205–2212.
2. Perez-Shibayama C, Gil-Cruz C, Ludewig B. Fibroblastic reticular cells at the nexus of innate and adaptive immune responses. Immunol Rev. 2019;289:31–41.
3. Burrell BE, Warren KJ, Nakayama Y, et al. Lymph node stromal fiber ER-TR7 modulates CD4+ T cell lymph node trafficking and transplant tolerance. Transplantation. 2015;99:1119–1125.
4. Grasso C, Pierie C, Mebius RE, et al. Lymph node stromal cells: subsets and functions in health and disease. Trends Immunol. 2021;42:920–936.
5. Knop L, Deiser K, Bank U, et al. IL-7 derived from lymph node fibroblastic reticular cells is dispensable for naive T cell homeostasis but crucial for central memory T cell survival. Eur J Immunol. 2020;50:846–857.
6. Cohen JN, Guidi CJ, Tewalt EF, et al. Lymph node-resident lymphatic endothelial cells mediate peripheral tolerance via Aire-independent direct antigen presentation. J Exp Med. 2010;207:681–688.
7. Yu M, Guo G, Zhang X, et al. Fibroblastic reticular cells of the lymphoid tissues modulate T cell activation threshold during homeostasis via hyperactive cyclooxygenase-2/prostaglandin E(2) axis. Sci Rep. 2017;7:3350–3350.
8. Siegert S, Huang HY, Yang CY, et al. Fibroblastic reticular cells from lymph nodes attenuate T cell expansion by producing nitric oxide. PLoS One. 2011;6:e27618.
9. Siegert S, Luther SA. Positive and negative regulation of T cell responses by fibroblastic reticular cells within paracortical regions of lymph nodes. Front Immunol. 2012;3:285.
10. Fletcher AL, Elman JS, Astarita J, et al. Lymph node fibroblastic reticular cell transplants show robust therapeutic efficacy in high-mortality murine sepsis. Sci Transl Med. 2014;6:249ra109.
11. Li X, Zhao J, Kasinath V, et al. Lymph node fibroblastic reticular cells deposit fibrosis-associated collagen following organ transplantation. J Clin Invest. 2020;130:4182–4194.
12. Li L, Wu J, Abdi R, et al. Lymph node fibroblastic reticular cells steer immune responses. Trends Immunol. 2021;42:723–734.
13. Gordon S, Plüddemann A. Tissue macrophages: heterogeneity and functions. BMC Biol. 2017;15:53.
14. Valencia J, Jiménez E, Martínez VG, et al. Characterization of human fibroblastic reticular cells as potential immunotherapeutic tools. Cytotherapy. 2017;19:640–653.
15. Pietras EM. Inflammation: a key regulator of hematopoietic stem cell fate in health and disease. Blood. 2017;130:1693–1698.
16. Chung J, Ebens CL, Perkey E, et al. Fibroblastic niches prime T cell alloimmunity through Delta-like Notch ligands. J Clin Invest. 2017;127:1574–1588.
17. Michonneau D, Sagoo P, Breart B, et al. The PD-1 axis enforces an anatomical segregation of CTL activity that creates tumor niches after allogeneic hematopoietic stem cell transplantation. Immunity. 2016;44:143–154.
18. Bar-Ephraim YE, Konijn T, Gönültas M, et al. A reproducible method for isolation and in vitro culture of functional human lymphoid stromal cells from tonsils. PLoS One. 2016;11:e0167555.
19. Ito T, Schaller M, Hogaboam CM, et al. TLR9 regulates the mycobacteria-elicited pulmonary granulomatous immune response in mice through DC-derived Notch ligand Delta-like 4. J Clin Invest. 2009;119:33–46.
20. Liang M, Zhang S, Dong L, et al. Label-free quantitative proteomics of lysine acetylome identifies substrates of Gcn5 in magnaporthe oryzae autophagy and epigenetic regulation. Msystems. 2018;3:e00270–e00218.
21. Kleinewietfeld M, Starke M, Di Mitri D, et al. CD49d provides access to “untouched” human Foxp3+ Treg free of contaminating effector cells. Blood. 2009;113:827–836.
22. Cooke KR, Kobzik L, Martin TR, et al. An experimental model of idiopathic pneumonia syndrome after bone marrow transplantation: I. The roles of minor H antigens and endotoxin. Blood. 1996;88:3230–3239.
23. Ruutu T, Gratwohl A, de Witte T, et al. Prophylaxis and treatment of GVHD: EBMT-ELN working group recommendations for a standardized practice. Bone Marrow Transplant. 2014;49:168–173.
24. Dalby MJ, Gadegaard N, Tare R, et al. The control of human mesenchymal cell differentiation using nanoscale symmetry and disorder. Nat Mater. 2007;6:997–1003.
25. Luther SA, Vogt TK, Siegert S. Guiding blind T cells and dendritic cells: a closer look at fibroblastic reticular cells found within lymph node T zones. Immunol Lett. 2011;138:9–11.
26. Katakai T, Hara T, Sugai M, et al. Lymph node fibroblastic reticular cells construct the stromal reticulum via contact with lymphocytes. J Exp Med. 2004;200:783–795.
27. Boltz-Nitulescu G, Wiltschke C, Holzinger C, et al. Differentiation of rat bone marrow cells into macrophages under the influence of mouse L929 cell supernatant. J Leukoc Biol. 1987;41:83–91.
28. Lima-Junior DS, Costa DL, Carregaro V, et al. Inflammasome-derived IL-1β production induces nitric oxide-mediated resistance to Leishmania. Nat Med. 2013;19:909–915.
29. Rios FJ, Touyz RM, Montezano AC. Isolation and differentiation of murine macrophages. Methods Mol Biol. 2017;1527:297–309.
30. Weischenfeldt J, Porse B. Bone marrow-derived macrophages (BMM): isolation and applications. CSH Protoc. 2008;2008:pdb.prot5080.
31. Castro FV, Tutt AL, White AL, et al. CD11c provides an effective immunotarget for the generation of both CD4 and CD8 T cell responses. Eur J Immunol. 2008;38:2263–2273.
32. Butte MJ, Keir ME, Phamduy TB, et al. Programmed death-1 ligand 1 interacts specifically with the B7-1 costimulatory molecule to inhibit T cell responses. Immunity. 2007;27:111–122.
33. Francisco LM, Salinas VH, Brown KE, et al. PD-L1 regulates the development, maintenance, and function of induced regulatory T cells. J Exp Med. 2009;206:3015–3029.
34. Cekic C, Akdemir I, Koyas A, et al. Molecular mechanisms for adenosine regulation of helper T cell activation. J Immunol. 2017;198(1 Supplement):52.22.
35. Beilhack A, Schulz S, Baker J, et al. In vivo analyses of early events in acute graft-versus-host disease reveal sequential infiltration of T-cell subsets. Blood. 2005;106:1113–1122.
36. Choi SY, Bae H, Jeong SH, et al. YAP/TAZ direct commitment and maturation of lymph node fibroblastic reticular cells. Nat Commun. 2020;11:519.
37. Fletcher AL, Acton SE, Knoblich K. Lymph node fibroblastic reticular cells in health and disease. Nat Rev Immunol. 2015;15:350–361.
38. Link A, Vogt TK, Favre S, et al. Fibroblastic reticular cells in lymph nodes regulate the homeostasis of naive T cells. Nat Immunol. 2007;8:1255–1265.
39. Fletcher AL, Lukacs-Kornek V, Reynoso ED, et al. Lymph node fibroblastic reticular cells directly present peripheral tissue antigen under steady-state and inflammatory conditions. J Exp Med. 2010;207:689–697.
40. Turley SJ, Fletcher AL, Elpek KG. The stromal and haematopoietic antigen-presenting cells that reside in secondary lymphoid organs. Nat Rev Immunol. 2010;10:813–825.
41. Suenaga F, Ueha S, Abe J, et al. Loss of lymph node fibroblastic reticular cells and high endothelial cells is associated with humoral immunodeficiency in mouse graft-versus-host disease. J Immunol. 2015;194:398–406.
42. Dasoveanu DC, Park HJ, Ly CL, et al. Lymph node stromal CCL2 limits antibody responses. Sci Immunol. 2020;5:eaaw0693.
43. den Haan JM, Kraal G. Innate immune functions of macrophage subpopulations in the spleen. J Innate Immun. 2012;4:437–445.
44. Gray EE, Cyster JG. Lymph node macrophages. J Innate Immun. 2012;4:424–436.
45. den Haan JM, Martinez-Pomares L. Macrophage heterogeneity in lymphoid tissues. Semin Immunopathol. 2013;35:541–552.
46. Panzer SE. Macrophages in transplantation: a matter of plasticity, polarization, and diversity. Transplantation. 2022;106:257–267.
47. Li J, Thomson AW, Rogers NM. Myeloid and mesenchymal stem cell therapies for solid organ transplant tolerance. Transplantation. 2021;105:e303–e321.
48. Li G, Kim YJ, Broxmeyer HE. Macrophage colony-stimulating factor drives cord blood monocyte differentiation into IL-10(high)IL-12absent dendritic cells with tolerogenic potential. J Immunol. 2005;174:4706–4717.
49. Barbaroux JB, Kwan WH, Allam JP, et al. Tumor necrosis factor-alpha- and IL-4-independent development of Langerhans cell-like dendritic cells from M-CSF-conditioned precursors. J Invest Dermatol. 2006;126:114–120.
50. Hashimoto D, Chow A, Greter M, et al. Pretransplant CSF-1 therapy expands recipient macrophages and ameliorates GVHD after allogeneic hematopoietic cell transplantation. J Exp Med. 2011;208:1069–1082.
51. Eggenhofer E, Hoogduijn MJ. Mesenchymal stem cell-educated macrophages. Transplant Res. 2012;1:12.

Supplemental Digital Content

Copyright © 2022 Wolters Kluwer Health, Inc. All rights reserved.