Activation of the Aryl Hydrocarbon Receptor Ameliorates Acute Rejection of Rat Liver Transplantation by Regulating Treg Proliferation and PD-1 Expression : Transplantation

Journal Logo

Original Basic Science

Activation of the Aryl Hydrocarbon Receptor Ameliorates Acute Rejection of Rat Liver Transplantation by Regulating Treg Proliferation and PD-1 Expression

Cao, Wanyue MD1; Lu, Jing MD1; Li, Lei MD1; Qiu, Chen MD2; Qin, Xuebin MD, PhD3,4; Wang, Tao MD1; Li, Shanbao MD1; Zhang, Jinyan MD, PhD1; Xu, Junming MD, PhD1

Author Information
doi: 10.1097/TP.0000000000004205

Abstract

INTRODUCTION

Liver transplantation (LT) is the optimal therapy for the treatment of end-stage liver disease.1 Although the clinical use of systemic immunosuppressants such as tacrolimus and sirolimus has enormously improved the survival rate of allografts, it has also caused serious complications such as infection and tumor recurrence.2 Therefore, an in-depth understanding of the specific mechanisms of immune response in LT is essential for further identification of a new target for suppressing the immune-mediated rejection for treating LT.

Aryl hydrocarbon receptor (AhR), a ligand-activated transcription factor, plays a crucial part in autoimmune diseases,3 inflammatory disease,4 and tumor immunity.5,6 AhR could transcribe into the nucleus and form heterodimerization with AhR nuclear translocator.7 The heterodimerization then interacts with genomic binding motifs to perform different functions.8 Recent evidence indicates that AhR could exert an immune regulatory effect on balancing differentiation of regulatory T cells (Treg) and T helper 17 cells in various immune diseases.3,8-11 AhR ligands are diverse, mainly divided into endogenous and exogenous, among which tryptophan (Trp) derivatives are an important class of endogenous ligands.12 Indoleamine-2,3-dioxygenase 1/2 or tryptophan-2,3-dioxygenase, as the first step in the catabolic pathway of Trp, catalyze Trp to kynurenine (Kyn).12,13 Kyn, which is the main endogenous ligand of AhR, suppresses the T-cell response by inducing the production of Treg and programmed death-1 (PD-1) in an AhR-dependent manner.14-16 The immune checkpoint molecule PD-1 in regulating cancer immunity is under intensive and widespread study. Liu highlighted that tumor-repopulating cells drive PD-1 upregulation in CD8+ T cells through a transcellular Kyn-AhR pathway to escape the tumor immune system.15 Above all, a deeper research of AhR and PD-1 in transplantation immunity might reveal new opportunities for immune tolerance.

N-(3,4-dimethoxycinnamonyl) anthranilic acid (3,4-DAA, “Tranilast”) is a synthetic anthranilic acid derivative that shares an anthranilic acid core with the Trp-Kyn pathway catabolites, 3-hydroxyanthranilic acid (3-HAA) and 3-hydroxykynureninic acid (3-HKA).17 3-HAA and 3-HKA, which are the Trp metabolites downstream of Kyn, can bind and activate AhR to regulate an immune response.18 We also documented that the treatment of 3,4-DAA together with the half suggested dosage of cyclosporin A inhibited acute rejection in an orthotopic LT model.19 However, whether 3,4-DAA mediates the activation of AhR, leading to immune suppression during LT, remains unclear. The 2-methyl-2H-pyrazole-3-carboxylic acid amide (CH223191) is a potent and specific antagonist of AhR.8 CH223191 could block nuclear translocation of AhR, which is used to duplicate the circumstance when AhR is knocked down.20 But the effect of CH223191 on transplantation immunity is rarely analyzed.

To investigate the role of AhR in LT, we used rat LT models and isolated CD4+ T cells treated with 3,4-DAA or CH223191 in vivo and in vitro, respectively. Both in vivo and in vitro experiments showed that AhR activation could reduce the immune rejection response of LT by regulating Treg proliferation and PD-1 expression.

MATERIALS AND METHODS

Animals

Dark Agouti and Lewis (DA-Lewis) rats, each weighing 210 to 240 g, were used as liver donors and recipients, respectively. All animals were housed under a specific pathogen-free facility in animal center of Shanghai General Hospital. All operations were performed in accordance with the guidelines of the Ethics Committee of Shanghai General Hospital, Affiliated Hospital of Shanghai Jiao Tong University School of Medicine (ethical code: 2019SQ147).

Drug Preparation and Safety Evaluation

We used freshly prepared drugs for in vivo experiments. For 3,4-DAA preparation, 10 mg 3,4-DAA was added to 1 mL 1.5% sodium carboxymethyl cellulose (CMC-Na) and incubated for 1 h at 70 °C to generate 10 mg/mL stock. If we needed higher stock solutions, we added another 10 mg drug to 10 mg/mL solution and repeated this step until the desired concentration was reached. Before intraperitoneal (IP) injection to the rats, ultrasonic vibration was required, 70 Hz, 15 s, repeated for 3 times. As for CH223191, first, the designed concentration of CH223191 was dissolved by 20 µL of 10% dimethyl sulfoxide (DMSO), then 1 mL corn oil was added, followed by ultrasonic vibration at 70 Hz and repeated for 3 times at 15 s before injection (IP). For in vitro studies, 3,4-DAA and CH223191 were dissolved in DMSO. All drugs were purchased from MedChemExpress, China.

Hemolysis test and subacute toxicity test were used to evaluate the toxicity of drugs.21 Hemolysis assay was used to test whether the drugs in the solution mediate any direct lytic effect on red blood cells (RBCs) by the determination of free hemoglobin in the supernatant to describe the breaking up of RBCs. Briefly, a fresh blood sample from wild Lewis rats was collected, centrifuged (1500 rpm, 10 min), and washed 3 times with saline. Both 3,4-DAA and CH223191 at varied concentrations were added, mixed by vortex, and incubated at 37 °C for 2 h. RBCs were mixed with normal saline as a negative control and exposed to deionized water as a total lysis control. Free hemoglobin in the supernatant was measured at 540 nm by the Bio-Rad 680 microplate analyzer.20 The hemolysis rate of RBCs is calculated by the following formula: hemolysis (%) = (A sample − A negative control) / (A total lysis control − A negative control) × 100%.21,22 All hemolysis experiments were performed in triplicates.

To test subacute toxic effect of these drug, we treated wild-type Lewis rats (IP) with 3,4-DAA at 200 mg/kg or CH223191 at 10 mg/kg daily for 21 consecutive days. The control group was given CMC-Na or corn oil. Serum was collected after anesthesia on day 21 for liver and kidney function analysis.

Transplant Rejection Study in Rat Model

To investigate the effects of 3,4-DAA or CH223191 on acute LT, the DA-Lewis LT rejection models were established by the classic modified “2-cuff technique,”23 and the recipient rats were divided into 4 groups (n = 30 per group): control (group A); 3,4-DAA at 200 mg/kg/d (group B); CH223191 at 10 mg/kg/d (group C); and 3,4-DAA at 200 mg/kg/d + CH223191 at 10 mg/kg/d (group D). All drugs were administered by IP injection from the operation day, and the control group was given CMC-Na. On days 1, 3, 7, and 14 after surgery, 3 recipient rats were randomly selected from each group and euthanized. Peripheral blood and liver tissue were collected. The remaining 5 rats in each group were observed for 1 mo to evaluate survival after LT.

Drug Dose Dependence Study in LT Model

The DA-Lewis LT rejection models were divided into groups to select the appropriate dose and explore the dose dependence of the drug. The recipients were treated with gradient dose of 3,4-DAA: group A, control group, CMC-Na (1 mL); group B, 3,4-DAA (100 mg/kg); group C, 3,4-DAA (200 mg/kg); group D, 3,4-DAA (300 mg/kg); and group E, 3,4-DAA (400 mg/kg). Similarly, CH22319 receptor rats were divided into 5 groups: group A, control group, corn oil (1 mL); group B, CH223191 (5 mg/kg); group C, CH223191 (10 mg/kg); group D, CH223191 (20 mg/kg); and group E, CH223191 (30 mg/kg). All drugs were administered by IP injection. Three recipient rats in each group were randomly selected to be euthanized 7 d after administration.

RNA Extractions and Real-time Polymerase Chain Reaction Analysis

Follow the instructions of the manufacturer, total RNA was isolated from cells and recipient tissues by using TRIzol reagent (Takara, Shiga, Japan). The extracted RNA was analyzed by Nano Drop 2000 (Thermo Fisher Scientific, Waltham, MA) to ensure the RNA quality and purity. RNA was reverse transcribed into cDNA using PrimeScript RT Master Mix (Perfect Real Time; Takara) after quantification. Quantitative real-time polymerase chain reaction (RT-PCR) was performed using SYBR Premix Ex Taq (Tli RNaseH Plus; Takara) in a Light Cycler Real-time PCR System (Roche). The specific primers used were as follows: GAPDH-F: TGATTCTACCCACGGCAAGTT; GAPDH-R: TGATGGGTTTCCCATTGATGA; AhR-F: GAACAAGAAAGGGAAAGACGGAG; AhR-R: CAATAGGTGTGAAGTCCAGTTTGTG; PD-1(PDCD1)-F: GCGTCTGTGGGTTCTGTGTCG; and PD-1(PDCD1)-R: CCAAGGGTGACTTTAGGTGCTG. GAPDH was used as an internal control, and relative gene expression (ie, ΔΔCT) was used to analyze the RT-PCR data.

Protein Extraction and Western Blot Analysis

Total protein was isolated using radioimmunoprecipitation assay lysis buffer (Beyotime Biotechnology, Shanghai, China) containing protease and phosphatase inhibitors (NCM Biotechnology, Jiangsu, China) for 30 min at 4 °C. Then, the denatured proteins were transferred onto polyvinylidene fluoride membranes (Millipore, Billerica, MA), which will be blocked in 5% milk–Tris-Buffered Saline and Tween 20 for 2 h at normal temperature, and then incubated with primary antibodies at 4 °C overnight. The primary antibodies included AhR antibody (1:1000; Thermo Fisher), GAPDH (1:5000; Proteintech), and PD-1 (1:1000; Thermo Fisher). Subsequently, the membranes were incubated with a horseradish peroxidase-conjugated anti-mouse or anti-rabbit secondary antibody (Cell Signaling Technology, Beverly, MA) for 1 h at room temperature. After washing 3 times, proteins were detected with the enhanced chemiluminescence reagent (Millipore, Billerica, MA).

Isolation, Culture, and Treatment of CD4+ T Cells

Spleens of Lewis rats were collected, ground, and filtered to obtain cell suspension, which was centrifuged at 1600 rpm at 4 °C for 5 min. The precipitation was washed with precooled phosphate-buffered saline. Double volume of lymphocyte separation solution obtained from Sigma-Aldrich was added and centrifuged at 2000 rpm for 25 min. CD4+ T cells were isolated by the large separation column column (Miltenyi Biotec, Bergisch Gladbach, Germany) in strict accordance with the method of antibiotic microbeads (Miltenyi, Auburn, CA) and finally saved in Roswell Park Memorial Institute 1640 media. Naive T cells were stimulated for 4 or 5 d with a plate-bound antibody to CD3 (5 U/mL) plus a soluble antibody against CD28 (2 U/mL) followed by incubation for 2 d in 5% CO2 at 37 °C. T cells were treated with DMSO (control); 3,4-DAA; CH223191; and 3,4-DAA + CH223191 with various concentrations for 24 h. The cells in each group were stained simultaneously with anti-CD4-fluorescein isothiocyanate (eBioscience, San Diego, CA), anti-CD8-fluorescein isothiocyanate (eBioscience) and anti-PD-1-Coralite 647 (Proteintech, China), or anti-Foxp3-PE (eBioscience) as well as corresponding isotype antibody (as negative staining). They were measured by flow cytometry (FACSCalibur, BD Biosciences, San Jose, CA).

Histopathological Examination and Blood Sample Testing

Liver tissue was collected from the recipient rats for histopathological examination.19 The rejection activity index (RAI) was determined by 3 pathologists using the Banff Schema (International Panel, 1997). Serum samples were obtained from the recipients to evaluate liver function on days 1, 3, 7, and 14 after LT. Alanine aminotransferase (ALT), aspartate aminotransferase (AST), γ-glutamyl transpeptidase, total bilirubin, blood urea nitrogen, and creatinine were analyzed with an automated chemical analyzer (Hitachi 7600-10; Hitachi High-Technologies). The ELISA kit of interferon (IFN-γ), interleukin (IL)-2, and IL-4 was obtained from MULTISCIENCE (Shanghai, China).

Immunofluorescence Assay

Paraffin sections were deparaffinized and rehydrated according to standard protocols. Citrate buffer was used for antigen retrieval and then incubated with anti-CD3 (1:200, Abcam, ab16669), anti-CD4 (1:200, Abcam, ab237722), anti-CD8 (1:200, Abcam, ab33786), and anti-Foxp3 (1:100, Abcam, ab215206). Fluorophore-conjugated secondary antibodies were incubated for 1 h at room temperature (1:200, Abcam). The slides were imaged with a fluorescence microscope, and an Aperio CS2 scanner (Leica, Barcelona, Spain) was used to scan slides and visualize images by a slide viewer software (Case Viewer 2.3, 3D Histech, Hungary).

Statistical Analysis

Statistical analyses were performed by GraphPad Prism V.7.00. Results are shown as representative images or as mean ± standard deviation of at least 3 independent experiments. The differences among multiple groups were assessed by analysis of variance test, and the survival analysis was performed by the log-rank test. A P value of <0.05 is considered statistically significant.

RESULTS

3,4-DAA Alleviates Acute Graft Rejection and Prolongs Survival Time, Whereas CH223191 Effectively Reverse These Effects

Previous studies have shown that 200 mg/kg of 3,4-DAA and 10 mg/kg of CH223191 could affect disease progression by regulating T-cell differentiation and proliferation in various immune environments.10,24-27 However, the effect of these 2 drugs in LT rejection has rarely been reported. We first investigated the in vitro toxicity of the 2 drugs by the hemolysis test and the in vivo side effects of the drugs by subacute toxicity test to ensure the safety.21 3,4-DAA and CH223191 at the serial of concentration (1, 50, 500, and 1000 µg/mL) did not mediate any hemolysis of RBCs (Figure S1A and B, SDC, https://links.lww.com/TP/C449). Twenty-one day injections (IP daily) of 2 drugs to the wild rats did not cause abnormalities, such as toxic reaction and death, or obvious signs of clinical toxicity. The treated rats had shiny hair, normal diet and excretion, no yellowing, no irritability, hyperactivity, or noise. Liver and kidney function parameters did not change significantly compared with the control group (Figure S1C–G, SDC, https://links.lww.com/TP/C449). We did not observe significant liver histological changes among the groups (Figure S2, SDC, https://links.lww.com/TP/C449).

To select the optimal dose, we treated the recipient rats with different concentrations of the drugs (100, 200, 300, and 400 mg/kg of 3,4-DAA and 5, 10, 20, and 30 mg/kg of CH223191). When the administered doses of 3,4-DAA and CH223191 were >200 mg/kg and 10 mg/kg, respectively, we found that the drug particles precipitated in the abdominal cavity with ascites, indicating that the drug with these concentrations could not be dissolved and absorbed completely (Figure S3A, SDC, https://links.lww.com/TP/C449). Notably, liver function parameters showed no significant difference between groups treated with 10 mg/kg of CH223191 versus high doses group (20 and 30 mg/kg/d), or 200 mg/kg/d of 3,4-DAA group versus high-dose group (300 and 400 mg/kg/d; Figure S3B and C, SDC, https://links.lww.com/TP/C449). Together, these results confirm that 200 mg/kg of 3,4-DAA and 10 mg/kg of CH223191 (IP) were safe and did not mediate any toxicity effect. Therefore, we used the dose regimen of these drugs to conduct the following LT rejection experiment.

To investigate the effects of 3,4-DAA or CH223191 on acute liver rejection, we compared the changes in liver tissue morphology and survival time after transplantation among the recipient rats treated with 3,4-DAA, CH223191, and 3,4-DAA + CH223191 (Figure 1). Rats treated with 3,4-DAA had a much longer survival time than rats treated with CH223191 (P < 0.05; log-rank = 4.439). Compared with the control group, the 3,4-DAA group had a longer survival time (P < 0.05; log-rank = 3.918), whereas the CH223191 group had a shorter survival time (P < 0.01; log-rank = 8.077). There was no difference in survival time between the control group and the 3,4-DAA + CH223191 group (P = 0.083). Histopathological changes in the liver in different groups were graded according to the Banff model.28 As shown in Figure 1B and C, until the third day, the CH223191 group began to show obvious lymphocyte infiltration, whereas the lymphocytes in the 3,4-DAA group increased slightly. Rejection was relentless in the CH223191 group on day 7, as evidenced by marked infiltration of inflammatory cells into most portal areas, bile duct damage, and venous endothelial inflammation. On the 14th day, histopathological changes in the liver showed swelling of vascular endothelial cells, massive infiltration of lymphocytes around the portal area and central vein, swelling and deformation of bile duct epithelial cells, and large patches of necrosis. The RAI score of each group at different time points after surgery is shown in Figure 1B. The survival time in the 3,4-DAA treatment group was significantly prolonged, and the morphology of the liver changed minimally after the administration was stopped. But by day 30, inflammatory infiltration had worsened, and bile duct epithelial cells became swollen and deformed (Figure S4, SDC, https://links.lww.com/TP/C449).

F1
FIGURE 1.:
The drug 3,4-DAA alleviates acute graft rejection and prolongs survival time, whereas CH223191 can effectively reverse it. A, Survival of each group (5 rats per group) is shown following transplantation. Group A, control; group B, 200 mg/kg/d of 3,4-DAA; group C, 10 mg/kg/d of CH223191; group D, 200 mg/kg/d of 3,4-DAA + 10 mg/kg/d of CH223191. B, RAI was graded on the basis of the Banff pattern. C, Morphological changes in grafts 1, 3, 7, and 14 d after liver transplantation. CH223191, 2-methyl-2H-pyrazole-3-carboxylic acid amide; 3,4-DAA, N-(3,4-dimethoxycinnamonyl) anthranilic acid; RAI, rejection activity index.

Additionally, 3,4-DAA treatment protected liver function, whereas CH223191 treatment significantly impaired it (Figure 2). Compared with the control group, ALT in the CH223191 group began to increase significantly from the third day (P < 0.001), whereas in the 3,4-DAA group, it decreased significantly on the 14th day (P < 0.001). As for AST, significant changes were observed in 3,4-DAA and CH223191 groups on postoperative day (POD) 7 (Figure 2B). The difference of γ-glutamyl transpeptidase between the CH223191 group and the control group was more prominent (Figure 2C). Consistently, these benefit effects observed in the 3,4-DAA–treated recipient rats were significantly reduced by adding CH223191 to 3,4-DAA treatment in the combination treatment group (Figures 1 and 2).

F2
FIGURE 2.:
The drug 3,4-DAA protects liver function from liver damage following transplantation. Levels of biomarkers of hepatocellular injury were measured for each of the 4 groups. Group A, control; group B, 200 mg/kg/d of 3,4-DAA; group C, 10 mg/kg/d of CH223191; group D, 200 mg/kg/d of 3,4-DAA + 10 mg/kg/d of CH223191. A, Serum ALT levels of each group at days 1, 3, 7, 14. B, Serum AST levels of each group at days 1, 3, 7, 14. C, Serum GGT levels of each group at days 1, 3, 7, 14. *P < 0.05, **P < 0.01, and ***P < 0.001. AhR, aryl hydrocarbon receptor; ALT, alanine aminotransferase; AST, aspartate aminotransferase; CH223191, 2-methyl-2H-pyrazole-3-carboxylic acid amide; 3,4-DAA, N-(3,4-dimethoxycinnamonyl) anthranilic acid; GGT, γ-glutamyl transpeptidase.

These results documented that 3,4-DAA could significantly alleviate the rejection reaction, prolong the survival time, and lighten liver dysfunction in the recipient rats, whereas CH223191 inhibited the activation of AhR, which aggravated the acute rejection reaction.

Effects of 2 Drugs on the Production of IFN-γ, IL-2 Critical for Transplant Rejection, and IL-4 Critical for Immune Tolerance

Serum cytokines secreted by T cells play an important role in regulating various immune responses, including LT.29 Th1 cell subsets secrete IL-2, IFN-γ, and tumor necrosis factor-α, which are involved in transplant rejection, whereas Th2 type cells mainly produce IL-4 and IL-10, which have been reported to be associated with immune tolerance.30-32 Therefore, we measured the levels of IFN-γ, IL-2, and IL-4 of LT recipients at different time points by ELISA. As shown in Figure 3A, serum levels of IFN-γ detected in the 3,4-DAA–treated group on POD 3, 7, and 14 were significantly lower (P < 0.05) than those in the control group, whereas their levels in the CH223191 group were signally higher than these in the control group on POD 14 (P < 0.01). Serum levels of IL-2 decreased from POD 3 to 14 in 3,4-DAA–treated recipients compared with the control group but increased in CH223191-treated recipient rats. Serum IL-4 level did not change significantly among groups on POD 7, but on POD 14, it was significantly higher in the 3,4-DAA group and lower in the CH223191 group compared with that in the control group. Notably, there were no significant differences during the research period between the recipient rats treated with both drugs and the control group (Figure 3), further confirming the counter effects of these 2 drugs on the induction of these cytokines. Together, the results demonstrated that 3,4-DAA treatment reduced the levels of IFN-γ and IL-2 (critical for transplant rejection) and increased the level of IL-4 (critical for immune tolerance), whereas CH223191 mediated the opposite effect on the production of these cytokines.

F3
FIGURE 3.:
Effect of 3,4-DAA and CH223191 on the production of IFN-γ, IL-2, and IL-4 following orthotopic liver transplantation. Group A, control; group B, 200 mg/kg/d of 3,4-DAA; group C, 10 mg/kg/d of CH223191; group D, 200 mg/kg/d of 3,4-DAA + 10 mg/kg/d of CH223191 (P value was calculated compared with group A, by the chi-square test). A, Serum IFN-γ levels of each group at days 1, 3, 7, 14. B, Serum IL-2 levels of each group at days 1, 3, 7, 14. C, Serum IL-4 levels of each group at days 1, 3, 7, 14. *P < 0.05, **P < 0.01, and ***P < 0.001. AhR, aryl hydrocarbon receptor; CH223191, 2-methyl-2H-pyrazole-3-carboxylic acid amide; 3,4-DAA, N-(3,4-dimethoxycinnamonyl) anthranilic acid; IFN, interferon; IL, interleukin.

3,4-DAA and CH223191 Alleviated and Accelerated Liver Rejection in a Dose-dependent Manner, Respectively

To better understand 3,4-DAA and CH223191-induced immune responses in our LT model, we further investigated the dose-dependent effect of these drugs in the LT rat model. Our results showed that there was a solubility issue if administering the rats with >200 mg/kg of 3,4-DAA and 10 mg/kg of CH223191 (Figure S3A, SDC, https://links.lww.com/TP/C449). Therefore, we conducted the dose-dependent studies effect of drugs with less than these doses, respectively (CMC-Na, 100 and 200 mg/kg of 3,4-DAA and corn oil, 5 and 10 mg/kg of CH223191). The results obtained both from liver histology and liver function showed that 2 doses for 3,4-DAA or CH223191 did not induce a significant change on POD 3 (not shown), whereas on POD 7, they alleviated or accelerated the graft rejection in a dose-dependent manner, respectively (Figure S5, SDC, https://links.lww.com/TP/C449). The 3,4-DAA group at 200 mg/kg dose have much better pathological changes and RAI score and reduced levels of ALT and AST than the 3,4-DAA group at 100 mg/kg dose or the control group. In contrast, the 10 mg/kg CH223191 treatment had an opposite and worse effect in LT. These results indicated that 3,4-DAA and CH223191 alleviated and accelerated liver rejection in a dose-dependent manner, respectively.

Activation of AhR Alleviated Rejection by Affecting the Content of Cells Infiltrating Graft

We further explored the mechanism underlying 3,4-DAA–induced graft tolerance and CH223191-aggravated rejection. The fresh peripheral blood mononuclear cells were detected directly by flow cytometry while the spleen was ground up and sorted out for CD4+, CD8+ T cells. We documented that 3,4-DAA induced the generation of Foxp3+ T cells and increased the production of PD-1 on T cells (Figure 4A–D; Figure S6A–D, SDC, https://links.lww.com/TP/C449). However, CH223191 treatment significantly decreased the pression level of PD-1 and reduced the proportion of Treg in spleen and peripheral blood mononuclear cells of recipient rats. Although the 2 drugs were administered to the recipient rats at the same time, no significant differences were found (Figure 4A–D; Figure S6A–D, SDC, https://links.lww.com/TP/C449). Additionally, the cells infiltrating the graft were analyzed by immunofluorescence staining. The proportion of CD3+ T cells in transplanted liver increased in the CH223191 group (P = 0.009) and decreased in the 3,4-DAA group (P = 0.0304). There was no significant difference between the recipient rats treated with both drugs and the control group (P = 0.4259; Figure 4E–G). The percentage of CD8+ T cells changed similarly to CD3+ T cells (compared with control: 3,4-DAA group [P = 0.03]; CH223191 group [P = 0.0262]; 3,4-DAA + CH223191 group [P = 0.9515]; Figure 4E–G). Although the proportion change of CD4+ T cells in the 3,4-DAA group was different from the control group, it was found to be significantly decreased compared with the CH223191 group (P = 0.045). However, the ratio of Foxp3+/CD4+ T cells was found to be significantly increased in the 3,4-DAA group (compared with the control group: P = 0.0119; compared with the CH223191 group: P = 0.0007; Figure 4H and I). The above-mentioned results further indicated that 3,4-DAA treatment increased the proportion of Treg in the transplanted liver, whereas it decreased CD8+ T cells, which are associated with alleviated rejection.

F4
FIGURE 4.:
Activation of AhR-alleviated rejection by affecting the content of cells infiltrating graft. A–D, The spleens of recipient rats in each group were collected 7 d after administration. After being crushed, CD4+ and CD8+ T cells were separated by magnetic beads. The content of CD4+CD25+Foxp3+, CD4+PD-1+ T cells, CD8+PD-1+ T cells, and CD8+Foxp3+ T cells were detected by flow cytometry. E–I, The proportion of CD3+, CD4+, CD8+, and Foxp3+ T cells in the graft was detected by immunofluorescence staining. *P < 0.05, **P < 0.01, and ***P < 0.001. AhR, aryl hydrocarbon receptor; CH223191, 2-methyl-2H-pyrazole-3-carboxylic acid amide; 3,4-DAA, N-(3,4-dimethoxycinnamonyl) anthranilic acid; DAPI, 4'6-diamidino-2-phenylindole; PD-1, programmed death-1.

As mentioned previously, 3,4-DAA shares an anthranilic acid core with 3-HAA and 3-HKA, and CH223191 is an antagonist of AhR.27,33 Therefore, we explored the expression level of AhR in the liver of recipient rats. The expression of AhR and PD-1 in recipient livers was increased and reduced in the 3,4-DAA group and CH223191 group, respectively (Figure S6E–J, SDC, https://links.lww.com/TP/C449). Additionally, we investigated the effects of low-dose drugs on AhR expression level and T cells. The results showed that with the increased doses of 3,4-DAA and CH223191, the expression levels of AhR, PD-1, and the proportion of CD4+CD25+Foxp3+ T cells in liver and spleen changed consistently, and the effect reached the peak at 200 mg/kg and 10 mg/kg (Figure S7, SDC, https://links.lww.com/TP/C449). These results are consistent with the above-mentioned results and further suggest that 3,4-DAA or CH223191 can influence the degree of transplant rejection by dose-dependent regulation of T-cell differentiation and PD-1 expression through AhR. The extent of Treg and the expression of PD-1 could be influenced by 3,4-DAA through AhR in vitro.

CD4+ T cells were isolated from wild-type Lewis spleen, verified, and then grouped and treated differently in vitro. As shown in Figure 5A, its sorting efficiency can reach up to 98%. Different concentrations of 3,4-DAA and CH223191 were treated for 24 h. The result indicted that CH223191 reduced the expression of PD-1, and the inhibition reached its peak at 20 µM. And when cultured with 3,4-DAA, PD-1 expression increased and peaked at 20 µM (Figure S8A–D, SDC, https://links.lww.com/TP/C449). The optimal stimulus doses were used in subsequent experiments.

F5
FIGURE 5.:
AhR activation induced changes in PD-1 and Treg in vitro. A, Validating the sorting efficiency of CD4+ T cells from spleen of Lewis rats. B–E, The induction of CD4+Foxp3+ Treg and CD4+PD-1+ T cells in those 4 groups was measured by flow cytometry. The 4 groups were group A, which was seen as the control, group B (3,4-DAA group), group C (CH223191 group), and group D (3,4-DAA + CH223191 group). F and G, The expression levels of AhR and PD-1 were detected in the 4 groups by Western blot and RT-PCR, respectively. AhR, aryl hydrocarbon receptor; CH223191, 2-methyl-2H-pyrazole-3-carboxylic acid amide; 3,4-DAA, N-(3,4-dimethoxycinnamonyl) anthranilic acid; DMSO, dimethyl sulfoxide; ns, not significant; PD-1, programmed death-1; RT-PCR, real-time polymerase chain reaction; Treg, regulatory T cells.

Then CD4+ T cells were divided into groups and treated differently. Compared with the control group, the percentage of Treg was found to be significantly increased in the 3,4-DAA group and decreased in the CH223191 group (P < 0.05). The shift trend of PD-1 was unanimous with Treg (Figure 5B–E). To explore the underlying mechanisms, we analyzed the changes in AhR expression in each group. The results show that the protein and RNA levels of AhR changed with different treatments, which was consistent with the changes in Treg and PD-1 expression levels (Figure 5F–H). For further verification, the endogenous AhR ligand 2-(1′H-indole-3′-carbonyl)-thiazole-4-carboxylic acid methyl ester was used to treat isolated CD4+ T cells. Compared with the DMSO group, 20 µM of 2-(1′H-indole-3′-carbonyl)-thiazole-4-carboxylic acid methyl ester significantly increased the expression of PD-1 and upregulated the expression level of AhR (Figure S8E–G, SDC, https://links.lww.com/TP/C449). These results further suggest that the activation of AhR may upregulate the expression of PD-1 and increase the proportion of Treg leading to immunosuppression.

DISCUSSION

In addition to our previous studies on 3,4-DAA,19 the inhibitory effect of 3,4-DAA (Tranilast) in allogenic reactions had been demonstrated in several studies,25,34,35 but the specific mechanism had never been discussed. The clinical efficacy and safety of Tranilast in allergic rhinitis, atopic dermatitis, and fibrotic diseases have been established for several years,33,36 and there has been no serious side effect of Tranilast taken at doses up to 600 mg/d for several months in human.36 Consistently, our results show the beneficial effect of 3,4-DAA in suppression of the immune rejection of rat LT without any obvious side effects. Different from 3,4-DAA, CH223191 is currently used only as a small molecule inhibitor targeting AhR, which had been proved to effectively inhibit the in vivo toxicity induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin.37 In this study, we investigated the toxicity profile of CH223191 in rats. We also demonstrated that the dose-dependent inhibition of CH223191 on AhR resulted in poor liver function indexes of recipients exacerbated the rejection of LT.

The rejection of allogeneic transplantation is mainly the allogeneic immune response mediated by T cells.38,39 In both rodent LT models and human LT recipients, the increased proportion of Treg in liver and peripheral blood plays an important role in inducing LT immune tolerance.38,40 CD4+CD25+ Treg were considered to be the main factor promoting allograft survival. Stathopoulou et al41 demonstrated that the PDL1 binding to PD-1 could regulate Foxp3 stability and impart regulatory function, thus affecting GvHD.42 It is also reported that AhR activation could prolong the survival time of mismatched heart allografts43 and promote allograft-specific tolerance through direct and indirect dendritic cell–mediated effects on Treg.44 Our data further indicated that the binding of different ligands to AhR significantly affected the content of Treg and the expression of PD-1, thereby affecting the degree of LT rejection.

CD8+ T cells as the main force to attack tumors, its priming, and effector depend on the stimulation and help of various immune cells.45 CD8+ T cells seem to be the main immune cell type affected by the PD-1 immunosuppressive checkpoint pathway.45 High expression of PD-1 leads to dysfunction and depletion of CD8 effector T cells,45 which causes cancer cells to easily escape antitumor immune response and promote transplant tolerance. Under the background of tumor microenvironment, Kyn has been found to induce PD-1 expression on CD8+ T cells to regulate immune surveillance.15,16 More importantly, Amobi-McCloud et al16 posted that there were multiple AhR binding sites on the PD-1 gene, which may directly contribute to the regulation of AhR on PD-1. Recent studies also showed that CD8+ Treg can also effectively prevent islet allograft rejection and mitigate the disease severity of GVHD.46,47 Our results further suggest that AhR activation can reduce the proportion of infiltrated CD8+ T cells in the transplanted liver and increase the expression of PD-1 on CD8+ T cells in the spleen and peripheral blood, promoting immune tolerance, whereas AhR inhibition by its antagonist worsens the rejection. However, Trisha et al showed that the expression of AhR on T cells inhibited peripherally induced regulatory donor T in the colon, aggravating acute GVHD, and receptor mice receiving AhR–/– T cell reduced the occurrence of acute GVHD.48 The efficacy of immune checkpoint inhibitors varies widely among transplant patients and even has the risk of rejection and allograft loss.49

The activation and differentiation of T cells depend on the selection of costimulatory molecules and the composition of cytokines in the environment.50 Th1 cells can drive the proliferation of activated CD4+ and CD8+ effector T cells and enhance the cytotoxicity of natural killer cells by secreting inflammatory cytokines IL-2 and IFN-γ.51,52 Th2 cells secreting IL-4 and IL-10 are involved in the induction of immune tolerance.29,51 Studies have shown that the content of cytokine can also significantly affect the expression of PD-1/PD-L153 and regulate the therapeutic effect of immunosuppressive drugs in the tumor microenvironment.54 Administration of 3,4-DAA may improve liver function and affect the contents of various cytokines in serum, such as tumor necrosis factor-α, IFN-γ, IL-2, IL-12, and IL-1β decrease and IL-10, IL-5, and IL-4 increase.17,19,24 However, the treatment of CH223191 can reverse the contents of proinflammatory and anti-inflammatory cytokines and aggravate the inflammatory response.10 These results were consistent with our findings obtained in the rat LT model.

In summary, this study thoroughly analyzed the role of AhR in the rat LT immune environment, providing a novel and promising insight into the understanding and induction of self-tolerance in LT.

REFERENCE

1. Olivo R, Guarrera JV, Pyrsopoulos NT. Liver transplantation for acute liver failure. Clin Liver Dis. 2018;22:409–417.
2. Di Maira T, Little EC, Berenguer M. Immunosuppression in liver transplant. Best Pract Res Clin Gastroenterol. 2020;46-47:101681.
3. Vuerich M, Harshe R, Frank LA, et al. Altered aryl-hydrocarbon-receptor signalling affects regulatory and effector cell immunity in autoimmune hepatitis. J Hepatol. 2021;74:48–57.
4. Ngui IQH, Perera AP, Eri R. Does NLRP3 inflammasome and aryl hydrocarbon receptor play an interlinked role in bowel inflammation and colitis-associated colorectal cancer? Molecules. 2020;25:E2427.
5. Labadie BW, Bao R, Luke JJ. Reimagining IDO pathway inhibition in cancer immunotherapy via downstream focus on the tryptophan-kynurenine-aryl hydrocarbon axis. Clin Cancer Res. 2019;25:1462–1471.
6. Xue P, Fu J, Zhou Y. The aryl hydrocarbon receptor and tumor immunity. Front Immunol. 2018;9:286.
7. Neavin DR, Liu D, Ray B, et al. The role of the aryl hydrocarbon receptor (AHR) in immune and inflammatory diseases. Int J Mol Sci. 2018;19:E3851.
8. de Araújo EF, Loures FV, Preite NW, et al. AhR ligands modulate the differentiation of innate lymphoid cells and T helper cell subsets that control the severity of a pulmonary fungal infection. Front Immunol. 2021;12:630938.
9. Ehrlich AK, Pennington JM, Bisson WH, et al. TCDD, FICZ, and other high affinity AhR lgands dose-dependently determine the fate of CD4+ T cell differentiation. Toxicol Sci. 2018;161:310–320.
10. Liu C, Li Y, Chen Y, et al. Baicalein restores the balance of Th17/Treg cells via aryl hydrocarbon receptor to attenuate colitis. Mediators Inflamm. 2020;2020:5918587.
11. de Araújo EF, Preite NW, Veldhoen M, et al. Pulmonary paracoccidioidomycosis in AhR deficient hosts is severe and associated with defective Treg and Th22 responses. Sci Rep. 2020;10:11312.
12. Sadik A, Somarribas Patterson LF, Öztürk S, et al. IL4I1 is a metabolic immune checkpoint that activates the AHR and promotes tumor progression. Cell. 2020;182:1252–1270.e34.
13. Opitz CA, Somarribas Patterson LF, Mohapatra SR, et al. The therapeutic potential of targeting tryptophan catabolism in cancer. Br J Cancer. 2020;122:30–44.
14. Campesato LF, Budhu S, Tchaicha J, et al. Blockade of the AHR restricts a Treg-macrophage suppressive axis induced by L-Kynurenine. Nat Commun. 2020;11:4011.
15. Liu Y, Liang X, Dong W, et al. Tumor-repopulating cells induce PD-1 expression in CD8+ T cells by transferring kynurenine and AhR activation. Cancer Cell. 2018;33:480–494.e7.
16. Amobi-McCloud A, Muthuswamy R, Battaglia S, et al. IDO1 expression in ovarian cancer induces PD-1 in T cells via aryl hydrocarbon receptor activation. Front Immunol. 2021;12:678999.
17. Wen Q, Zhou L, Chen H, et al. N-(3’, 4’-dimethoxycinnamonyl) anthranilic acid alleviated experimental colitis by inhibiting autoimmune response and inducing CD4+ CD25+ regulatory T cells production. J Gastroenterol Hepatol. 2013;28:1330–1338.
18. Gargaro M, Vacca C, Massari S, et al. Engagement of nuclear coactivator 7 by 3-hydroxyanthranilic acid enhances activation of aryl hydrocarbon receptor in immunoregulatory dendritic cells. Front Immunol. 2019;10:1973.
19. Yong-Gang X, Ming-Zhe W, Jin-Yan Z, et al. Combination of N-(3’4’-dimethoxycinnamoyl) anthranilic acid with cyclosporin A treatment preserves immunosuppressive effect and reduces the side effect of cyclosporin A in rat. Eur J Pharmacol. 2014;728:16–23.
20. Choi EY, Lee H, Dingle RW, et al. Development of novel CH223191-based antagonists of the aryl hydrocarbon receptor. Mol Pharmacol. 2012;81:3–11.
21. Zhou H, Lv S, Zhang D, et al. A polypeptide based podophyllotoxin conjugate for the treatment of multi drug resistant breast cancer with enhanced efficiency and minimal toxicity. Acta Biomater. 2018;73:388–399.
22. Xie J, Wang Z, Wang W. Semaphorin 4D induces an imbalance of Th17/Treg cells by activating the aryl hydrocarbon receptor in ankylosing spondylitis. Front Immunol. 2020;11:2151.
23. Kamada N, Calne RY. Orthotopic liver transplantation in the rat. Technique using cuff for portal vein anastomosis and biliary drainage. Transplantation. 1979;28:47–50.
24. Sun QF, Ding JG, Sheng JF, et al. Novel action of 3,4-DAA ameliorating acute liver allograft injury. Cell Biochem Funct. 2011;29:673–678.
25. Xu J, Wei J, Huang M, et al. Tryptophan metabolite analog, N-(3,4-dimethoxycinnamonyl) anthranilic acid, ameliorates acute graft-versus-host disease through regulating T cell proliferation and polarization. Int Immunopharmacol. 2013;17:601–607.
26. Fabre T, Molina MF, Soucy G, et al. Type 3 cytokines IL-17A and IL-22 drive TGF-β-dependent liver fibrosis. Sci Immunol. 2018;3:eaar7754.
27. Li YY, Wang XJ, Su YL, et al. Baicalein ameliorates ulcerative colitis by improving intestinal epithelial barrier via AhR/IL-22 pathway in ILC3s. Acta Pharmacol Sin. 2022;43:1495–1507.
28. Demetris AJ, Batts KP, Dhillon AP, et al. Banff schema for grading liver allograft rejection: an international consensus document. Hepatology. 1997;25:658–663.
29. Lu X, Cui J, Cui L, et al. The effects of human umbilical cord-derived mesenchymal stem cell transplantation on endometrial receptivity are associated with Th1/Th2 balance change and uNK cell expression of uterine in autoimmune premature ovarian failure mice. Stem Cell Res Ther. 2019;10:214.
30. Harrison DK, Waldrip ZJ, Burdine L, et al. DNA-PKcs inhibition extends allogeneic skin graft survival. Transplantation. 2021;105:540–549.
31. Shao C, Chen Y, Nakao T, et al. Local delivery of regulatory T cells promotes corneal allograft survival. Transplantation. 2019;103:182–190.
32. Besançon A, Demir Z, Goncalves T, et al. Differential impact of T-bet and IFNγ on pancreatic islet allograft rejection. Transplantation. 2018;102:1496–1504.
33. Koch SE, Nieman ML, Robbins N, et al. Tranilast blunts the hypertrophic and fibrotic response to increased afterload independent of cardiomyocyte transient receptor potential vanilloid 2 channels. J Cardiovasc Pharmacol. 2018;72:40–48.
34. Zaher SS, Coe D, Chai JG, et al. Suppression of the allogeneic response by the anti-allergy drug N-(3,4-dimethoxycinnamonyl) anthranilic acid results from T-cell cycle arrest. Immunology. 2013;138:157–164.
35. Mukai S, Ogawa Y, Saya H, et al. Therapeutic potential of tranilast for the treatment of chronic graft-versus-host disease in mice. PLoS One. 2018;13:e0203742.
36. Darakhshan S, Pour AB. Tranilast: a review of its therapeutic applications. Pharmacol Res. 2015;91:15–28.
37. Kim SH, Henry EC, Kim DK, et al. Novel compound 2-methyl-2H-pyrazole-3-carboxylic acid (2-methyl-4-o-tolylazo-phenyl)-amide (CH-223191) prevents 2,3,7,8-TCDD-induced toxicity by antagonizing the aryl hydrocarbon receptor. Mol Pharmacol. 2006;69:1871–1878.
38. Du X, Chang S, Guo W, et al. Progress in liver transplant tolerance and tolerance-inducing cellular therapies. Front Immunol. 2020;11:1326.
39. Anggelia MR, Cheng HY, Chuang WY, et al. Unraveling the crucial roles of FoxP3+ regulatory T cells in vascularized composite allograft tolerance induction and maintenance. Transplantation. 2021;105:1238–1249.
40. Terry LV, Oo YH. The next frontier of regulatory T cells: promising immunotherapy for autoimmune diseases and organ transplantations. Front Immunol. 2020;11:565518.
41. Stathopoulou C, Gangaplara A, Mallett G, et al. PD-1 inhibitory receptor downregulates asparaginyl endopeptidase and maintains Foxp3 transcription factor stability in induced regulatory T cells. Immunity. 2018;49:247–263.e7.
42. Cai J, Wang D, Zhang G, et al. The role Of PD-1/PD-L1 axis in Treg development and function: implications for cancer immunotherapy. Onco Targets Ther. 2019;12:8437–8445.
43. Cai LJ, Yu DW, Gao Y, et al. Activation of aryl hydrocarbon receptor prolongs survival of fully mismatched cardiac allografts. J Huazhong Univ Sci Technolog Med Sci. 2013;33:199–204.
44. Hauben E, Gregori S, Draghici E, et al. Activation of the aryl hydrocarbon receptor promotes allograft-specific tolerance through direct and dendritic cell-mediated effects on regulatory T cells. Blood. 2008;112:1214–1222.
45. Farhood B, Najafi M, Mortezaee K. CD8+ cytotoxic T lymphocytes in cancer immunotherapy: A review. J Cell Physiol. 2019;234:8509–8521.
46. Ligocki AJ, Niederkorn JY. Advances on non-CD4 + Foxp3+ T regulatory cells: CD8+, type 1, and double negative T regulatory cells in organ transplantation. Transplantation. 2015;99:1553–1559.
47. Bézie S, Anegon I, Guillonneau C. Advances on CD8+ Treg cells and their potential in transplantation. Transplantation. 2018;102:1467–1478.
48. Dant TA, Lin KL, Bruce DW, et al. T-cell expression of AhR inhibits the maintenance of pTreg cells in the gastrointestinal tract in acute GVHD. Blood. 2017;130:348–359.
49. Kumar V, Shinagare AB, Rennke HG, et al. The safety and efficacy of checkpoint inhibitors in transplant recipients: a case series and systematic review of literature. Oncologist. 2020;25:505–514.
50. Toomer KH, Malek TR. Cytokine signaling in the development and homeostasis of regulatory T cells. Cold Spring Harb Perspect Biol. 2018;10:a028597.
51. Zhang H, Wang Z, Zhang J, et al. Combined immunotherapy with belatacept and BTLA overexpression attenuates acute rejection following kidney transplantation. Front Immunol. 2021;12:618737.
52. Zhou JY, Alvarez CA, Cobb BA. Integration of IL-2 and IL-4 signals coordinates divergent regulatory T cell responses and drives therapeutic efficacy. Elife. 2021;10:e57417.
53. Wang Y, Xi Y, Han F, et al. Vascularized composite allograft rejection is delayed by infusion of IFN-γ-conditioned BMSCs through upregulating PD-L1. Cell Tissue Res. 2019;376:211–220.
54. Qian J, Wang C, Wang B, et al. The IFN-γ/PD-L1 axis between T cells and tumor microenvironment: hints for glioma anti-PD-1/PD-L1 therapy. J Neuroinflammation. 2018;15:290.

Supplemental Digital Content

Copyright © 2022 Wolters Kluwer Health, Inc. All rights reserved.