Secondary Logo

Journal Logo

The Role of miR-200b-3p in Modulating TGF-β1–induced Injury in Human Bronchial Epithelial Cells

Ladak, Shameem S. PhD1; Roebuck, Eliott MBBS1; Powell, Jason PhD1,2; Fisher, Andrew J. BMedSci, PhD1,3; Ward, Chris PhD1; Ali, Simi PhD1

doi: 10.1097/TP.0000000000002845
Original Basic Science–General
Open
SDC

Background. Dysregulation of microRNAs (miRNAs) has been implicated in airway diseases where transforming growth factor-β (TGF-β)–induced epithelial-mesenchymal transition (EMT) may contribute to pathophysiology. Our study investigated the role of miRNA-200b in TGF-β1–induced EMT in human bronchial epithelial cells.

Methods. NanoString nCounter miRNA assay was used to profile miRNA in control versus TGF-β1 (1, 4, and 24 h) stimulated BEAS-2B cells. Immortalized primary bronchial epithelial cell line (BEAS-2B cells), human primary bronchial epithelial cells (PBECs), and PBECs derived post-lung transplant were transfected with miR-200b-3p mimics and EMT marker expression was examined at RNA and protein level. miRNA target studies were performed and validated using computational tools and luciferase assay. In situ hybridization was done on normal lung tissue to localize miR-200b-3p in airway epithelium.

Results. miR-200b-3p was downregulated post-TGF-β1 treatment compared with control in BEAS-2B. miR-200b-3p mimic transfection before TGF-β1 stimulation maintained epithelial marker expression and downregulated mesenchymal cell markers at RNA and protein level in BEAS-2B cells and PBECs. Furthermore, miR-200b-3p mimics reversed established TGF-β1–induced EMT in BEAS-2B cells. miR-200b-3p targets, ZNF532, and ZEB2 were validated as direct targets using luciferase assay. miR-200b-3p mimics suppress TGF-β1–induced EMT via inhibition of ZNF532 and ZEB2. In situ hybridization showed that miR-200b-3p is expressed in the normal lung epithelium. Additionally, miR-200b-3p mimics inhibit EMT in the presence of TGF-β1 in PBECs derived from lung allograft.

Conclusions. We provide proof of concept that miR-200b-3p protects airway epithelial cells from EMT. Manipulating miR-200b-3p expression may represent a novel therapeutic modulator in airway pathophysiology.

1 Institute of Cellular Medicine, Medical School, Newcastle University, Newcastle upon Tyne, United Kingdom.

2 Department of Otolaryngology, Head and Neck Surgery, Freeman Hospital, Newcastle upon Tyne, United Kingdom.

3 Institute of Transplantation, Newcastle Upon Tyne Hospitals, Newcastle upon Tyne, United Kingdom.

Received 13 September 2018. Revision received 15 May 2019.

Accepted 18 May 2019.

C.W. and S.A. are joint senior authors.

The authors declare no conflicts of interest.

This work was supported by a Newcastle University Overseas Research Scholarship and grant from FP7-MCITN (POSAT, 606979). This work was also supported by the NIHR Blood and Transplant Research Unit in Organ Transplantation at the University of Cambridge in partnership with Newcastle University and the Newcastle NIHR Biomedical Research Centre in Ageing and Long-Term Conditions. This study was also funded by the Wellcome Trust Clinical Fellowship “Modulation of the upper airway host defences to prevent pneumonia in ventilated patients” (Grant Number 108768 awarded to J.P.).

Supplemental digital content (SDC) is available for this article. Direct URL citations appear in the printed text, and links to the digital files are provided in the HTML text of this article on the journal’s Web site (www.transplantjournal.com).

S.S.L. performed research, analyzed the data, and wrote the manuscript. E.R. helped with designing luciferase reporter plasmid with inserts. J.P. collected primary bronchial epithelial cells from healthy and lung transplant patients. A.F. provided access to donor lung tissue, technical advice, interpretation of data, and input into the manuscript writing. C.W. and S.A. are joint senior authors, designed and supervised the study and helped with the writing of the manuscript.

Correspondence: Simi Ali, Ph.D., Institute of Cellular Medicine, Medical School, Newcastle University, Newcastle upon Tyne, NE2 4HH, United Kingdom. (simi.ali@newcastle.ac.uk).

This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial-No Derivatives License 4.0 (CCBY-NC-ND), where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.

Back to Top | Article Outline

INTRODUCTION

Epithelial-mesenchymal transition (EMT) has been increasingly studied as a cardinal event that may contribute to pathophysiological alterations in the structure of the airways where airway epithelial cells play a key role in driving fibrotic tissue remodeling.1,2 EMT is observed in a wide spectrum of respiratory diseases, including lung allograft dysfunction post lung transplantation termed as bronchiolitis obliterans syndrome (BOS) and chronic obstructive pulmonary disease (COPD).3-5 The incidence of BOS is around 50% at 5 years posttransplant and lung allograft 5-year survival rates are <60%.5 The World Health Organization estimates that 64 million people currently have COPD6 and predicts that COPD will become the third leading cause of death worldwide by 2030.7 New therapeutic approaches are therefore required to better understand potential pathophysiological mechanisms including EMT.

Transforming growth factor-β1 (TGF-β1) is a potent inducer of EMT and the Smad and non-Smad signaling pathway components govern downstream activation. Once activated, the Smad complex translocates into the nucleus and transcribes genes involved in fibrosis. Recent studies have confirmed the involvement of TGF-β receptor biology in mediating Asthma,8 COPD,9 and BOS.10,11 Dysregulated microRNAs (miRNAs) have been implicated in airway diseases and play an important role in extracellular matrix deposition and fibrosis; however, their role in TGF-β1–driven EMT in airway pathophysiology posttransplantation is still not established. miRNAs are small non coding RNAs wherein the seed region (2–8 bases) of the miRNA predominately targets the 3′ untranslated region (3′UTR) of mRNA leading to degradation or inhibition of translation.12,13 Since a single miRNA has the potential of targeting more than one mRNA target, they have a suggested role in modulating multiple biological pathways, such as inflammation,14 amplifying the inflammatory microenvironment,15 and predisposing epithelial cells to undergo EMT that leads to ECM deposition and fibrosis.16-18

In this study, we have comprehensively investigated the role of miRNAs in TGF-β1–induced EMT. This was initially done using a human bronchial epithelial cell line and then validated in primary bronchial epithelial cells (PBECs), including cells from lung allograft. In particular, we have investigated and validated the expression of the candidate; miR-200b-3p in vitro using mimics and in normal donor lung tissue. Previous reports in the literature suggest that miR-200b plays an important role in regulating EMT in renal proximal cells preventing renal fibrosis, but there are no data in TGF-β1 driven human airway epithelial cell injury. Preliminary results of our study have been published in abstract form.19

Back to Top | Article Outline

MATERIALS AND METHODS

Ethical Approval for Primary Airway Epithelial Sampling and Donor Lung Tissue

All tissue culture work was carried out in accordance with the “Safe Working with Biological Hazards,” “Safe Working with Chemicals in the Laboratory,” and the University of Newcastle Upon Tyne Safety Policy. All the research work was approved by the Research and Development Department of the Newcastle upon Tyne Hospitals NHS Foundation Trust. All tissues were obtained through the Respiratory or Ear Nose and Throat departments of the Newcastle upon Tyne Hospitals NHS Foundation Trust.

The upper airway samples were collected from Ear Nose and Throat operating theater attendees undergoing routine investigation to exclude pathology. Ethical approvals came from 1 of 2 national Research Ethics Committee (REC) approvals. The first submission was approved by the South East Scotland 01 REC, reference number 14/SS/1015. A further submission was approved by the West Midlands REC, reference number 15/WM/0349.

The transplant brushings were collected from lung transplant recipients undergoing surveillance bronchoscopy, scheduled for clinical purposes. The transplant brushings were therefore an additional research sample included in a routine clinical procedure. The study was approved by the local RECs for Newcastle and North Tyneside 2 REC reference number: original Min Ref: 2001/179.

The unused donor lung sections were obtained from a study that included adult donor lungs deemed unsuitable for lung transplantation by all centers in the United Kingdom. Ethics approval was granted, and informed consent for research was obtained from donor families and lung transplant recipients (REC 11/NE/0342).

Back to Top | Article Outline

Cell Culture and Transfection

The BEAS-2B cell line was obtained from American Type Culture Collection (CRL-9609). PBECs, passage 2 were derived from healthy patients (n = 3) during routine endoscopy and cells posttransplant were acquired from transplant brushings (Table 1) obtained at surveillance bronchoscopy. Cells were maintained as recommended by American Type Culture Collection using in house protocols developed for primary cells. Cells were transfected at 60% confluency using 6 µL Lipofectamine RNAiMAX (Invitrogen) transfection reagent and 30 nM of miR-200b-3p (Dharmacon) and nonspecific/negative control miRNA (NSmiRNA, Qiagen) in Opti-MEM reduced serum media (ThermoFisher scientific) according to manufacturer’s protocol in 6-well plates. NSmiRNA is a validated negative control that shares no homology to any known mammalian gene. This negative control gives a clear picture of the true effects of miR-200b mimics on its target gene expression. Cells transfected with NSmiRNA should not induce or minimally induce changes in target gene expression when compared with the transfected subset.

TABLE 1

TABLE 1

Back to Top | Article Outline

Quantification of miRNA and mRNA

Total RNA was extracted using the mirVana PARIS kit (Ambion, TX). For miRNA studies, 100 ng of total RNA was reverse transcribed using TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems) and for mRNA studies; cDNA was synthesized from 1 μg total RNA using the Tetro cDNA synthesis kit (Bioline). Gene expression was determined by quantitative real-time polymerase chain reaction (qRT-PCR) using SensiFast Probe Hi-ROX kit (Bioline) and Taqman gene expression assay (ThermoFisher scientific) on StepOnePlus system (Applied Biosystems) using manufacturer’s protocol. Relative quantities were calculated using the 2−(ddCt) method.21 MiRNA expression was normalized to U6 (U6 Small Nuclear), and mRNA was normalized to HPRT1 (Hypoxanthine Phosphoribosyltransferase 1).

Back to Top | Article Outline

Nanostring nCounter miRNA Assay and Data Analysis

Total RNA isolated using miRVana PARIS kit (Ambion) was used for nCounter miRNA sample preparation. All sample preparation was done according to manufacturer’s protocol. Raw data acquired from the nCounter analyzer were normalized using nSolver software. These data were then exported and further analyzed and visualized using R studio software.

Back to Top | Article Outline

Immunofluorescence

Cells were grown on 8-well chamber slides and fixed with ice-cold methanol. Primary antibodies for E-Cadherin (BD biosciences; 1:50 dilution), cytokeratin-19 (Biolegend; 1:150 dilution), fibronectin (SantaCruz, 1:150 dilution), and α-SMA (SantaCruz1:150 dilution) were used with secondary antibody Alexa Fluor 488 goat anti-mouse or anti-rabbit (1:150 dilution). Images were visualized using Leica Axioimager and analyzed using Image J software. Total area of fluorescence and total number of cells per field view were calculated. Thereafter area of fluorescence per cell was plotted using Graphpad prism software

Back to Top | Article Outline

Computational Tools for Target Prediction

To identify miR-200b-3p targets, 4 different software algorithms were employed to find the conserved target site throughout the human transcriptome. Computational tools allowed identification of 7 common genes as potential targets of miR-200b by matching the complementarity between the seed region (2–8 bases) of the miRNA and 3′UTR of an mRNA using TargetScan, MiRanda, DIANA-Micro-T, and PicTar. Out of the 7 targets, the expression of 4 selective miRNA target genes was assessed due to their established role in EMT.22-24

Back to Top | Article Outline

Luciferase Reporter Plasmid Construction

3′UTR of ZEB2 and ZNF532 was cloned into pmiRGLO Dual-luciferase miRNA Target Expression Vector (Promega) according to the manufacturer’s protocol. Forward and reverse PCR primers were designed using the online tool Primer3 and converted to infusion primers. Primer sequences were synthesized (ThermoFisher Scientific) and 3′UTR of ZNF532 (Forward infusion primer: GCTCGCTAGCCTCGACCTTCCTTCACCTCGTCGTA; reverse infusion primer: CGACTCTAGACTCGAGGAACTGCCCCTGTTACTAAG) and ZEB2 (Forward infusion primer: GCTCGCTAGCCTCGAAGGCAGCAGTTCCTTAGTTT; reverse infusion primer: CGACTCTAGACTCGATGCCCAAATGATCAACGTCA) was amplified using PCR (flanking with Xho1 sites). The insert was cloned into the Xho1 site (downstream of firefly luciferase gene) in the pmiRGLO vector. The cloned vector system was transformed into DH5α competent cells and the integrity of the inserted gene was confirmed by sequencing.

Back to Top | Article Outline

Luciferase Reporter Assay of 3′UTR of ZEB2 and ZNF532

BEAS-2B cells were seeded (35 000 cells) in 96-well plates and transfected with 500 ng of pmiRGLO vector containing the 3′UTR of ZEB2 or ZNF532 or empty plasmid and cotransfected with 30 nM miR-200b mimics or NSmiRNA using Lipofectamine 2000 (Invitrogen). Luciferase activity (firefly and Renilla luciferase) was measured at 24 hours posttransfection using a Dual-luciferase reporter assay system (Promega).

Back to Top | Article Outline

In Situ Hybridization

A double digoxigenin-labeled (5′ and 3′) miRCURY LNA miRNA detection probe (Exiqon, Denmark) was used to detect the endogenous expression of miR-200b-3p. Deparaffinized lung sections were treated with 15 μg/mL Proteinase-K for 10 minutes at 37°C. The sections were hybridized at 50°C (30°C lower than the probe Tm) for 18 hours in hybridization mix containing 40 nM of miR-200b DIG-labeled probes or 40 nM of scrambled miRNA probes or positive control miRNA probes (miR-126). Sections were washed with decreasing standard saline citrate buffer concentration at hybridization temperature. For immunostaining, sections were incubated with 1:800 anti-DIG reagents (Roche) for 1 hour at room temperature followed by incubation with AP substrate (Roche) for 1.5 hours at 30°C. Nuclear Fast Red (Vector Laboratories) was applied and nuclei were counterstained. Sections were mounted using Eukitt (Sigma) and visualized under phase contrast microscope.

Back to Top | Article Outline

Statistical Analysis

For statistical analysis of data, Prism 6.0 (Graph Pad software, San Diego, CA) was used. Comparison between 2 groups was performed by unpaired Student ttest. Comparison between more than 2 groups was performed using 1-way analysis of variance or 2-way analysis of variance followed by Bonferroni test as a post hoc test considering the significance at P ≤ 0.05. In this study, * refers to P ≤ 0.05, ** refers to P ≤ 0.01, *** refers to P ≤ 0.001, and **** refers to P ≤ 0.0001. Densitometric analysis of Western blotting data was performed using Alpha Imager software of Alpha Imager gel documentation system (Alpha innotech).

Back to Top | Article Outline

RESULTS

TGF-β1–induced EMT in BEAS-2B Cells and PBECs

To evaluate the changes in EMT markers in BEAS-2B cells (Figure 1A) and PBECs following TGF-β1 stimulation (Figure 1B), changes at protein expression were examined using immunofluorescence and Western blotting (for BEAS-2B cells; Figure S1.1, SDC, http://links.lww.com/TP/B765). A significant reduction in epithelial cell marker E-Cadherin (P ≤ 0.001, P ≤ 0.001) and cytokeratin-19 (P ≤ 0.01, P ≤ 0.001) was observed at 72 hours following TGF-β1 treatment (5 ng/mL). There was a significant increase in the expression of mesenchymal markers fibronectin (both, P ≤ 0.001) and α-SMA (P ≤ 0.01, P ≤ 0.001) post-TGF-β1–induced treatment in BEAS-2B cells and PBECs, respectively, as compared with the untreated cells. These results suggest that bronchial epithelial cells demonstrate loss of epithelial cell markers and transition into a mesenchymal-like phenotype upon TGF-β1 treatment leading to deposition of matrix proteins.

FIGURE 1

FIGURE 1

Back to Top | Article Outline

miRNA Profiling Using NanoString nCounter miRNA Expression Assay in BEAS-2B Cells

To investigate the role of miRNAs in TGF-β1–induced EMT, miRNA profiling was performed using Nanostring technology (Figure 2A). Hierarchical clustering of 130 most differently expressed miRNAs (control versus various time points) was determined using R (version 3.1.3) and a heatmap was generated (using R; heatmap function). The differential expression of miR-200 family (miR-200a-3p, miR-200b-3p, miR-200c-3p, miR-141-3p, and miR-429) between the control and TGF-β1–treated samples was found interesting due to key role in regulating EMT25 (Figure S1.2, SDC, http://links.lww.com/TP/B765). miR-200b-3p and miR-200c-3p were downregulated at 1, 4, and 24 hours time points post TGF-β1 treatment, while miR-200a-3p and miR-429 expression reduced at 1 and 24 hours, respectively (data not shown). Since the role of miR-200b in suppressing TGF-β1–induced EMT has been studied previously,26 its role in human bronchial epithelial cells was investigated in our study. miR-200b-3p expression profile was further validated using qRT-PCR. Results (Figure 2B) suggested a significant decrease in miR-200b-3p at 4 (P ≤ 0.01) and 24 hours (P ≤ 0.001) in response to TGF-β1 treatment (n = 2). This downregulation in miR-200b-3p expression upon TGF-β1 treatment was also associated with loss in epithelial cell markers.

FIGURE 2

FIGURE 2

Back to Top | Article Outline

Ectopic Expression of miR-200b Followed by TGF-β1 Treatment Maintained Epithelial Cell-surface Markers

To examine the effect of miR-200b-3p in bronchial epithelial cells before TGF-β1 stimulation, BEAS-2B cells were transfected with 30nM miR-200b-3p/NSmiRNA for 24 hours followed by treatment with/without 5 ng/mL TGF-β1 for 48 hours. EMT marker expression was evaluated at mRNA and protein level. There was a significant restoration of E-Cadherin levels in miR-200b-3p–transfected and TGF-β1–treated BEAS-2B cells (P ≤ 0.01) when experiments were normalized to endogenous control HPRT1 and compared with NSmiRNA-transfected and TGF-β1–treated cells (n = 3). On the other hand, there was significant downregulation of fibronectin in miR-200b-3p–transfected and TGF-β1–treated BEAS-2B cells (P ≤ 0.01) compared with NSmiRNA-transfected and TGF-β1–treated cells (Figure 3A). Changes in protein expression were examined using immunofluorescence (Figure 3B), and Western blotting (Figure S1.3, SDC, http://links.lww.com/TP/B765; membrane incubated with fibronectin antibody was reused and incubated with α-SMA antibody and then finally GAPDH). Immunofluorescence images were quantified using Image J software and plotted using Prism 6 software (Figure S1.4, SDC, http://links.lww.com/TP/B765). In BEAS-2B cells, results were consistent with changes in mRNA expression. There was loss of E-Cadherin and cytokeratin-19 and an increase in α-SMA and fibronectin expression in NSmiRNA-transfected and TGF-β1–treated BEAS-2B cells. However, miR-200b-3p transfection restored E-Cadherin and cytokeratin levels and prevented the expression of α-SMA and fibronectin in TGF-β1–treated BEAS-2B cells.

FIGURE 3

FIGURE 3

Back to Top | Article Outline

miR-200b-3p Mimics Inhibit EMT in the Presence of TGF-β1 in PBECs From Human Lungs

To examine whether transfection with mimics would inhibit EMT in primary cells, PBECs were used. Results show a similar trend in significant fibronectin downregulation (P ≤ 0.0001) and E-Cadherin restoration (P ≤ 0.05) in PBECs as seen in BEAS-2B cells following transfection of miR-200b-3p mimics (Figure 3C).

Back to Top | Article Outline

Overexpression of miR-200b-3p Reverses Established EMT in TGF-β1–treated BEAS-2B Cells

The effect of overexpressing miR-200b-3p post TGF-β1 treatment is also crucial to understand the potential effect of modulating fibrosis through manipulation of miR-200b. Previous study has shown that 24-hour treatment with 5 ng/mL TGF-β1 significantly reduces E-Cadherin expression and increases α-SMA expression in BEAS-2B cells at RNA level. However, wound healing assay showed that TGF-β1–treated BEAS-2B cells achieved almost complete wound closure within 48 hours, indicating increased migration and invasion.27 Since EMT results in increased cell migration, in our study, BEAS-2B cells were stimulated with TGF-β1 for 48 hours before transfecting with miR-200b-3p mimics.

miR-200b-3p overexpression for 24 hours post TGF-β1 treatment (48 h) could restore E-Cadherin levels (Figure 4A) and downregulate fibronectin (Figure 4B) in (for both, P ≤ 0.0001) TGF-β1–treated and miR-200b–transfected BEAS-2B cells, when expression was normalized to endogenous control HPRT1 and compared with TGF-β1–treated NSmiRNA-transfected cells (n = 3). Therefore, miR-200b-3p mimics reversed EMT in cells that had already acquired a fibrotic phenotype.

FIGURE 4

FIGURE 4

Back to Top | Article Outline

miR-200b-3p Mimics Suppress Expression of Target Genes Involved in TGF-β1 Signaling

miR-200b-3p significantly reduced the expression of ZNF532 consistently in the presence of TGF-β1 when compared with NSmiRNA-transfected and TGF-β1–treated cells in BEAS-2B cells (P ≤ 0.0001) and PBECs (P ≤ 0.05).

While a significant reduction in ZEB2 was only observed in BEAS-2B cells (P ≤ 0.0001), PBECs showed a significant reduction in Ras Homolog Family Member A (P ≤ 0.05). The expression of ZEB2 was very low (only detectable in TGF-β1–treated cells) and so the data could not be plotted (Figure 5). Studies have shown that ZEB2 and ZNF532 are E-Box–binding proteins that are involved in repressing E-Cadherin transcription, hence revoke E-Cadherin–mediated intercellular adhesiveness.28,29 Our data indicate a major role of miR-200b-3p in defining epithelial cell markers by targeting ZEB2 and ZNF532.

FIGURE 5

FIGURE 5

Back to Top | Article Outline

miR-200b-3p Binds the 3′UTR of ZEB2 and ZNF532 Directly

We next studied the likelihood of a direct targeting mechanism of miR-200b-3p to ZEB2 and ZNF532 3′UTR. The luciferase reporter plasmids containing binding regions (ZEB2 and ZNF532 3′UTR regions) to miR-200b-3p were cotransfected with 30nM miR-200b-3p mimics. There was 62 % reduction in luciferase activity (P ≤ 0.01) in BEAS-2B cells cotransfected with the mimic and plasmid containing ZEB2 3′UTR when compared with cells cotransfected with NSmiRNA and plasmid with ZEB2 3′UTR region. miR-200b-3p mimics reduced luciferase activity by 54% in cells transfected with plasmid containing ZNF532 3′UTR when compared with cells cotransfected with NSmiRNA and plasmid containing ZNF532 3′UTR. Similar results were achieved when experiments were conducted using PBECs. This confirms the direct targeting of ZEB2 and ZNF532 mRNA by miR-200b-3p (Figure 6A and B, top panel).

FIGURE 6

FIGURE 6

Back to Top | Article Outline

Localization of miR-200b-3p in Bronchial Epithelium From Human Lung Tissue

We next examined the expression of miR-200b-3p in tissue derived from normal donor lung which were subsequently used for transplantation. A strong positive staining for miR-200b-3p was observed in the bronchial epithelium region of lung tissue while the negative control showed no staining (Figure 6, lower panel).

We attempted to examine the expression of miR-200b-3p in transbronchial biopsy (TBB) specimens obtained from lung allograft patients posttransplantation. However, no airways could be found in these sections. A previous study found airways in only 78% of TBB specimens.30 Furthermore, sampling error with TBB specimens is well known; to attain 95% confidence of diagnosing rejection, 18 biopsy samples are required.31 Therefore expression of miR-200b-3p in TBB specimens postlung transplantation could not be examined.

Back to Top | Article Outline

miR-200b-3p Mimics Inhibit EMT in the Presence of TGF-β1 in PBECs Derived Lung Allograft

Since examining the expression of miR-200b-3p in tissues from lung allograft was not reliable using TBB, a miR-200b mimic study was performed using PBECs derived from lung allograft. This study showed a similar trend of significant fibronectin downregulation (P ≤ 0.001) as seen in BEAS-2B cells and PBECs following transfection of miR-200b-3p mimics. However, no change in E-Cadherin expression was observed in cells acquired from lung transplant when expression is compared with NSmiRNA-transfected and TGF-β1–treated cells (Figure 7A).

FIGURE 7

FIGURE 7

Following this, mRNA target study was performed. There was significant reduction in SMURF2 expression (P ≤ 0.0001) in miR-200b–transfected and TGF-β1–treated cells when expression was compared with NSmiRNA-transfected and TGF-β1–treated cells. The expression of ZEB2 was only detectable in TGF-β1–treated cells, similar to that observed in PBECs. Although there was no significant reduction in ZNF532 in miR-200b transfected and TGF-β1–treated cells, the trend of expression was similar to that observed in BEAS-2B cells and PBECs (Figure 7B).

Back to Top | Article Outline

DISCUSSION

For the first time of which we are aware, our study provides proof of concept that miR-200b-3p both protects airway epithelial cells from EMT and that miR-200b-3p augmentation can reverse established TGF-β–driven EMT. Manipulation of miR-200b-3p has shown to reduce fibrotic marker expression induced by TGF-β1 during EMT, which is associated with the devastating pathophysiology of many chronic airway diseases including BOS and COPD.

To confirm the profibrotic effect of TGF-β1 in airway epithelial cells immunofluorescence staining was performed on BEAS-2B cells and PBECs. An increase in mesenchymal markers α-SMA and fibronectin and significant reduction in E-Cadherin and cytokeratin-19 clearly indicated TGF-β1–induced EMT. Postlung transplantation, epithelial cell damage and EMT are thought to occur because of initial graft injury due to alloimmune and nonalloimmune factors. In response to injury and inflammation, epithelial cell repair activates several downstream fibrotic markers leading to deposition of extracellular matrix that eventually obstructs the small airways leading to fibrosis.32-34 TGF-β1 signaling controls various cellular processes that trigger downstream activation of Smad proteins and regulates the transcription of various genes.35 Smad signaling allows TGF-β1–induced protein expression leading to upregulation of α-SMA, collagen, and vimentin and reduction in epithelial cell markers, E-Cadherin, and ZO-1.

TGF-β1–stimulated BEAS-2B cells were subjected to miRNA screening using Nanostring nCounter assay. This showed the differential expression of the miR-200 family between the control and TGF-β1–treated samples occurring during EMT. It is of interest that in limited previous literature the miR-200 family has also been described as regulating EMT in kidney studies and cancer progression.25,36,37 Loss of miRNA-200 coupled with increase of ZEB1 at the invasive front of colorectal cancer with degraded basement membrane indicated cancer progression.38 Another study suggested the involvement of miRNA-200b in diabetic retinopathy.39 We further demonstrated that miR-200b-3p prevented TGF-β1–induced EMT in BEAS-2B cells and PBECs. Our data indicated that miR-200b-3p is crucial in maintaining the epithelial characteristics by maintaining E-Cadherin expression while suppressing fibronectin expression in TGF-β1–treated cells at RNA and protein level. The expression of the miR-200 family has been extensively studied in epithelial tissues including lung and recent research has indicated its crucial role in early stage lung development and disease progression. Downregulation of miR-200b in human bronchial epithelial cells following exposure to nitrofen has shown to increase SMAD signaling in the lung epithelium. The use of miRNA-200b mimics in an ex vivo lung explant culture system reduces congenital diaphragmatic hernia and improves the lung development.40 Another study integrated the use of mimics and inhibitors and highlighted the importance of the miR-200 family in Alzheimer’s Disease Treatment.41 Furthermore, transient transfection of miRNA-200b and miRNA-200c mimics have been reported to reduce the expression of a key target ZEB1 that is highly expressed in stromal pancreatic ductal adenocarcinoma tissue. Kaplan-Meier survival analysis showed that high levels of miR-200 family members correlated with an improved overall survival in pancreatic ductal adenocarcinoma patients, indicating the potential use of miR-200 in therapeutics.42 This has not been described in the airway before but is supported in a previous study performed in kidney proximal tubular epithelial cells.26 Further experiments were conducted to evaluate the role of miR-200b-3p in reversing established EMT in BEAS-2B cells. miR-200b-3p transfection was able to restore the loss of the epithelial cell marker, E-Cadherin while significantly reducing the expression of fibronectin.

The role of miRNA overexpression has been extensively studied in EMT regulation. Treatment with miRNA candidates in a dose-dependent manner has shown to induce specific phenotypic changes; however, off-target effects still remain a concern. This overexpression influences gene targets that are not functional targets at endogenous miRNA levels.43 It is also to be noted that sub nanomolar concentrations of these miRNAs is sufficient to regulate EMT without significant off target effects. For instance, high concentration of miR-200c drives posttranscriptional degradation of several targets that are not involved in TGF-β-induced EMT. These off-targets were identified from data acquired post ectopic miR-200c transfection but not TGF-β-induced EMT. Furthermore, the data were also compared with the predicted list of miR-200 targets. Interestingly, the identified off target candidates had dose-dependent effects with miR-200c transfection. This effect was not seen when low levels of miR-200 mimics were used. Therefore, it may be crucial to use modest levels of miRNA mimics to minimize off-target effects.44,45

miRNA target studies allowed identification of 7 common targets using 4 different prediction tools. Each prediction tool uses a different rule of miRNA targeting and therefore produces a different list of predicted mRNA targets. As a result, the targets acquired might not be genuine and the definitive targets can be missed. Therefore, >1 tool was used and only the overlapping results were considered to draw conclusions regarding miRNA-mRNA interaction.46,47 Recent studies have reported that miR-200b downregulates zinc finger proteins ZEB1 and ZEB2 in TGF-β1–stimulated mesenchymal cells and cancer cells that acquired mesenchymal characteristics.48 Our study established that mature miRNA-200b-3p was able to directly target transcription factors ZEB2 and ZNF532 3′UTR region upon transfection in BEAS-2B cells with and without TGF-β1 stimulation, representing the first such data in airway epithelial cells. In PBECs, although the expression of ZEB2 was undetermined at RNA level, we performed the luciferase reporter assay and the results were consistent with data from BEAS-2B study.

In our study, we used in situ hybridization on paraffin-embedded donor lung tissue sections. A strong staining for miR-200b-3p in these sections was restricted to the healthy bronchial epithelium. A previous study showed that epithelium from normal control TBB section was highly positive for E-Cadherin; however, epithelium from stable transplant recipients showed a significant decrease in E-Cadherin expression accompanied by increased fibrotic marker expression.4 Therefore, we attempted to localize the expression of miR-200b-3p in TBB derived from lung transplant recipients. However, since no airways were found in these sections, miR-200b-3p mimic studies were conducted using PBECs derived from lung transplant recipients/lung allograft.

A significant decrease in fibronectin was noted in miR-200b-3p transfected and TGF-β1–treated PBECs from lung allografts. The expression profile of miRNAs in PBECs acquired posttransplant may differ to those normally expressed in PBECs due the fact that following transplant, cells show increased expression of IL-8, MMP9, MMP2, and IL-6 when compared with cells acquired from healthy individuals.49 Therefore, the expression profile of markers in these cells may differ to those normally expressed in PBECs acquired from normal epithelium. This could explain that although significant fibronectin downregulation was observed no significant change in E-Cadherin expression was seen in PBECs from lung allograft when transfected with miR-200b-3p mimic and treated with TGF-β1. miRNA target studies showed a similar trend of ZNF532 expression, although the change in expression was not significant and ZEB2 expression was undetermined using qRT-PCR.

Overall, our findings suggest miR-200b-3p may be a key homeostatic system in the epithelium, and our study indicates that miR-200b-3p may modify the development of EMT, that is known to be associated with fibrosis. It was noteworthy that our data indicated that miRNA manipulation was able to both protect against EMT and reverse established TGF-β1–driven EMT, in airway epithelial cells drawn from a number of sources. At a proof of concept level, we therefore conclude that our study indicates that manipulation of the miR-200 family may represent a much-needed therapeutic target in EMT associated with fibrosis. We feel that our work emphasizes a need for further studies in this novel area of translational research. In lung transplant studies, we have previously shown that there was a significant increase in the number of epithelial cells penetrating Matrigel following stimulation with TGF-β1, associated with cellular markers of EMT.50 We have also shown that basal epithelial cell expressions of both pSmad 2/3 and pSmad 7 were correlated with EMT in smoking-related COPD.51 Further logical studies suggested by our work might therefore include linking the expression of the miR-200 family with functional assessments of EMT and evidence from human clinical samples.

Back to Top | Article Outline

ACKNOWLEDGMENTS

Kile Green, Newcastle University, performed NanoString data analysis. Paraffin-embedded donor lung sections were procured from Kasim Jiwa, Freeman hospital. Laura Ferreras, Newcastle University provided help with bacterial growth and transformation.

Back to Top | Article Outline

REFERENCES

1. Bartis D, Mise N, Mahida RY, et al. Epithelial-mesenchymal transition in lung development and disease: does it exist and is it important?Thorax201469760–765
2. Lee YZ, Yap HM, Shaari K, et al. Blockade of eosinophil-induced bronchial epithelial-mesenchymal transition with a geranyl acetophenone in a coculture model.Front Pharmacol20178837
3. Câmara J, Jarai G. Epithelial-mesenchymal transition in primary human bronchial epithelial cells is smad-dependent and enhanced by fibronectin and TNF-alpha.Fibrogenesis Tissue Repair201032
4. Borthwick LA, Parker SM, Brougham KA, et al. Epithelial to mesenchymal transition (EMT) and airway remodelling after human lung transplantation.Thorax200964770–777
5. Jolly MK, Ward C, Eapen MS, et al. Epithelial-mesenchymal transition, a spectrum of states: role in lung development, homeostasis, and disease.Dev Dyn2018247346–358
6. May SM, Li JT. Burden of chronic obstructive pulmonary disease: healthcare costs and beyond.Allergy Asthma Proc2015364–10
7. Mahboub BH, Vats MG, Al Zaabi A, et al. Joint statement for the diagnosis, management, and prevention of chronic obstructive pulmonary disease for gulf cooperation council countries and middle east-north Africa region, 2017.Int J Chron Obstruct Pulmon Dis2017122869–2890
8. Hackett TL, Warner SM, Stefanowicz D, et al. Induction of epithelial-mesenchymal transition in primary airway epithelial cells from patients with asthma by transforming growth factor-beta1.Am J Respir Crit Care Med2009180122–133
9. Courtney J-M, Spafford P, Sohal SS, et al. TGFβ-induced epithelial to mesenchymal transition (EMT) as a model of COPD.Eur Respir J201648
10. DerHovanessian A, Weigt SS, Palchevskiy V, et al. The role of TGF-β in the association between primary graft dysfunction and bronchiolitis obliterans syndrome.Am J Transplant201616640–649
11. Rockey DC, Bell PD, Hill JA. Fibrosis–a common pathway to organ injury and failure.N Engl J Med20153721138–1149
12. Agarwal V, Bell GW, Nam J-W, et al. Predicting effective microRNA target sites in mammalian mRNAs.Elife20154e05005
13. Lin S, Gregory RI. Microrna biogenesis pathways in cancer.Nat Rev Cancer201515321–333
14. Lv YN, Ou-Yang AJ, Fu LS. Microrna-27a negatively modulates the inflammatory response in lipopolysaccharide-stimulated microglia by targeting TLR4 and IRAK4.Cell Mol Neurobiol201737195–210
15. McDonald MK, Ramanathan S, Touati A, et al. Regulation of proinflammatory genes by the circulating microRNA hsa-mir-939.Sci Rep2016630976
16. Suwara MI, Vanaudenaerde BM, Verleden SE, et al. Mechanistic differences between phenotypes of chronic lung allograft dysfunction after lung transplantation.Transpl Int201427857–867
17. Jonas S, Izaurralde E. Towards a molecular understanding of microrna-mediated gene silencing.Nat Rev Genet201516421–433
18. Xu W, Ji J, Xu Y, et al. Microrna-191, by promoting the EMT and increasing CSC-like properties, is involved in neoplastic and metastatic properties of transformed human bronchial epithelial cells.Mol Carcinog201554 Suppl 1E148–E161
19. Ladak S, Ward C, Ali S. S119 MicroRNA-200b represses TGF-β1 induced EMT in BEAS-2B and primary bronchial epithelial cells.Thorax201570A68
20. Stewart S, Fishbein MC, Snell GI, et al. Revision of the 1996 working formulation for the standardization of nomenclature in the diagnosis of lung rejection.J Heart Lung Transplant2007261229–1242
21. Sato M, Muragaki Y, Saika S, et al. Targeted disruption of TGF-beta1/smad3 signaling protects against renal tubulointerstitial fibrosis induced by unilateral ureteral obstruction.J Clin Invest20031121486–1494
22. Chandhoke AS, Karve K, Dadakhujaev S, et al. The ubiquitin ligase smurf2 suppresses tgfβ-induced epithelial-mesenchymal transition in a sumoylation-regulated manner.Cell Death Differ201623876–888
23. Tavares AL, Mercado-Pimentel ME, Runyan RB, et al. TGF beta-mediated rhoa expression is necessary for epithelial-mesenchymal transition in the embryonic chick heart.Dev Dyn20062351589–1598
24. Adam L, Zhong M, Choi W, et al. Mir-200 expression regulates epithelial-to-mesenchymal transition in bladder cancer cells and reverses resistance to epidermal growth factor receptor therapy.Clin Cancer Res2009155060–5072
25. Gregory PA, Bert AG, Paterson EL, et al. The mir-200 family and mir-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1.Nat Cell Biol200810593–601
26. Tang O, Chen XM, Shen S, et al. Mirna-200b represses transforming growth factor-β1-induced EMT and fibronectin expression in kidney proximal tubular cells.Am J Physiol Renal Physiol2013304F1266–F1273
27. Doerner AM, Zuraw BL. TGF-beta1 induced epithelial to mesenchymal transition (EMT) in human bronchial epithelial cells is enhanced by IL-1beta but not abrogated by corticosteroids.Respir Res200910100
28. Dinney CP, Floares AG, Adam L; inventors; The University of Texas System, assigneeEpithelial biomarkers for cancer prognosis.September 1, 2011US patent WO2011106709A2
29. Comijn J, Berx G, Vermassen P, et al. The two-handed E box binding zinc finger protein SIP1 downregulates E-cadherin and induces invasion.Mol Cell200171267–1278
30. Ward C, Snell GI, Orsida B, et al. Airway versus transbronchial biopsy and BAL in lung transplant recipients: different but complementary.Eur Respir J1997102876–2880
31. Scott JP, Fradet G, Smyth RL, et al. Prospective study of transbronchial biopsies in the management of heart-lung and single lung transplant patients.J Heart Lung Transplant1991105 Pt 1626–36discussion 636
32. Borthwick LA, McIlroy EI, Gorowiec MR, et al. Inflammation and epithelial to mesenchymal transition in lung transplant recipients: role in dysregulated epithelial wound repair.Am J Transplant201010498–509
33. Fiser SM, Tribble CG, Long SM, et al. Ischemia-reperfusion injury after lung transplantation increases risk of late bronchiolitis obliterans syndrome.Ann Thorac Surg2002731041–7discussion 1047
34. Kalluri R, Neilson EG. Epithelial-mesenchymal transition and its implications for fibrosis.J Clin Invest20031121776–1784
35. Xie L, Law BK, Chytil AM, et al. Activation of the erk pathway is required for TGF-beta1-induced EMT in vitro.Neoplasia20046603–610
36. Sun L, Yao Y, Liu B, et al. Mir-200b and mir-15b regulate chemotherapy-induced epithelial-mesenchymal transition in human tongue cancer cells by targeting BMI1.Oncogene201231432–445
37. Williams LV, Veliceasa D, Vinokour E, et al. Mir-200b inhibits prostate cancer EMT, growth and metastasis.Plos One20138e83991
38. Paterson EL, Kazenwadel J, Bert AG, et al. Down-regulation of the miRNA-200 family at the invasive front of colorectal cancers with degraded basement membrane indicates EMT is involved in cancer progression.Neoplasia201315180–191
39. McArthur K, Feng B, Wu Y, et al. Microrna-200b regulates vascular endothelial growth factor-mediated alterations in diabetic retinopathy.Diabetes2011601314–1323
40. Khoshgoo N, Kholdebarin R, Pereira-Terra P, et al. Prenatal microrna mir-200b therapy improves nitrofen-induced pulmonary hypoplasia associated with congenital diaphragmatic hernia.Ann Surg2019269979–987
41. Heidari E, Siavashani ES, Rasooli M, et al. Pin1 regulatory miRNAs as novel candidates for Alzheimer’s disease treatment.bioRxiv2018472985
42. Dhayat SA, Traeger MM, Rehkaemper J, et al. Clinical impact of epithelial-to-mesenchymal transition regulating MicroRNAs in pancreatic ductal adenocarcinoma.Cancers (Basel)201810328
43. Witwer KW, Halushka MK. Toward the promise of micrornas - enhancing reproducibility and rigor in microrna research.RNA Biol2016131103–1116
44. Cursons J, Pillman KA, Scheer KG, et al. Combinatorial targeting by micrornas co-ordinates post-transcriptional control of EMT.Cell Syst2018777–91.e7
45. Daga N, Eicher S, Kannan A, et al. Growth-restricting effects of sirna transfections: a largely deterministic combination of off-target binding and hybridization-independent competition.Nucleic Acids Res2018469309–9320
46. Shkumatava A, Stark A, Sive H, et al. Coherent but overlapping expression of micrornas and their targets during vertebrate development.Genes Dev200923466–481
47. Thomson DW, Bracken CP, Goodall GJ. Experimental strategies for microrna target identification.Nucleic Acids Res2011396845–6853
48. Kim T, Veronese A, Pichiorri F, et al. P53 regulates epithelial-mesenchymal transition through micrornas targeting ZEB1 and ZEB2.J Exp Med2011208875–883
49. Corris PA, Ryan VA, Small T, et al. A randomised controlled trial of azithromycin therapy in bronchiolitis obliterans syndrome (BOS) post lung transplantation.Thorax201570442–450
50. Ward C, Forrest IA, Murphy DM, et al. Phenotype of airway epithelial cells suggests epithelial to mesenchymal cell transition in clinically stable lung transplant recipients.Thorax200560865–871
51. Mahmood MQ, Reid D, Ward C, et al. Transforming growth factor (TGF) β1 and smad signalling pathways: A likely key to EMT-associated COPD pathogenesis.Respirology201722133–140

Supplemental Digital Content

Back to Top | Article Outline
Copyright © 2019 Wolters Kluwer Health, Inc. All rights reserved.