Deficiency of different genes implicated in the ontogeny of the immune system result in more or less profound immune defects in different cellular compartments of the immune system. For example, nude mice have a defect on T cells but not B cells or NK cells. Prkdc- or Rag1- or Rag2-deficient mice have a defect on T and B cells. Il2rg-deficient mice accumulate also an NK and NKT deficiency.1-3 The combination of more than one immunodeficient gene (Prkdc, Rag1, or Rag2 associated to Il2rg) increases the immunosuppression of these mice.3
The use of immunodeficient mice has been extremely useful for the application of immunogenic molecules, devices, cells, or tissues in the absence of immune responses that would reject them shortly.2 Profoundly, immunodeficient mice with more than one mutated gene used to implant cells or tissues from human origin has allowed to analyze the long-term effects of different treatments in vivo.2,3 As examples, the use of human tumors transplanted into immunodeficient mice allowed to analyze the effect of chemotherapeutic agents.2,4 Analogously, injection of human PBMCs into immunodeficient mice generates a graft versus host disease-like syndrome, and when the mice were previously transplanted with an allogeneic human skin, an allorejection occurs allowing in both models the use of different immunosuppressive treatments.5
Despite the immunodeficient mice are being extremely useful, they show some limitations in part not only due to their small size but also to biological differences with rats that limit the disease models that faithfully reproduce human diseases. As examples for the size limitations, implantation of tumors or treatments in precise locations in the central nervous system is difficult in mice. Microsurgery of human vessels into mice has been described6 but is technically challenging. Due to experimental regulations, drawing of blood is limited to 120 μL/wk, restraining the studies that can be performed. As an alternative, rats are 10 times bigger than mice, allowing much easier surgical procedures and drawing of larger volumes of blood (1.2 mL/wk). In recent years, transgenic technologies in rats have evolved using gene-targeted nucleases, allowing the rapid and efficient generation of new gene-edited rat models.7,8 Certain disease models in rats, such as ankylosing spondylitis9 and Duchenne disease10 reproduce human diseases better than mice, and these would greatly benefit from immunodeficient rats to test immunogenic treatments, such as human stem cell-derived cells or antibodies generated in other species.
We previously generated Rag1-deficient rat line using meganucleases with greatly reduced B and T cells but normal NK cells.11 In the present article, we describe the generation of Il2rg-deficient rats using transcription activator like effector nucleases (TALENs), and we show that they have a drastic but not complete reduction in B, T, and NK cells. We then obtained rats deficient for both Rag1 and Il2rg (Rats Rag1 and Il2rg or RRG) by crossing both mutated lines. Immunophenotyping of RRG animals showed a virtually complete disappearance of B, T, and NK cells as well as of all immunoglobulin isotypes in serum. RRG animals, but not Rag1- or Il2rg-deficient rats, accepted allogeneic rat and human skin indefinitively. Furthermore, RRG but not Il2rg-deficient rats allowed human tumor growth in vivo. RRG animals accepted human hepatocytes and showed liver humanization. In conclusion, we describe for the first time Il2rg-deficient and both Rag1- and Il2rg-deficient rats that are profoundly immunosuppressed and that accept both human tumors and skin transplants as well as human hepatocytes. RRG animals will constitute a useful alternative model to mice for in vivo studies in the absence of adaptive immune responses.
MATERIALS AND METHODS
Animals
Sprague-Dawley (SD/Crl) rats were the only strain used and were sourced from the Charles River (L'Arbresle, France). All the animal care and procedures performed in this study were approved by the Animal Experimentation Ethics Committee of the Pays de la Loire region, France, in accordance with the guidelines from the French National Research Council for the Care and Use of Laboratory Animals (permit numbers: Apafis 692, Apafis 3360, and Apafis 3359). All efforts were made to minimize suffering. The rats were housed in a controlled environment (temperature 21 ± 1 °C, 12-hour light/dark cycle). Rag1-deficient rats have been previously described.11Rag1- and Il2rg-deficient rats were crossed to generate RRG animals and maintained under specific pathogen-free conditions. Since the first generation of Il2rg-deficient rats, 8 generation of crossings were performed and thus both Rag1 and Il2rg gene modifications are stable and transferred to the offspring.
Production of TALENs
TALE nucleases were designed using the Δ152/+63 N- and C-terminal truncation points described in Miller et al.12 and contained the enhanced ELD/KKR FokI heterodimer mutations described in Doyon et al.13 Tandem arrays of TALE repeats were assembled by PCR from smaller fragments containing shorter tandem arrays of TALE repeats.14 Each TALE repeat includes the RVD segment: A (NI), T (NG), G (NN) or (NK), and C (HD). Assembled TALE nucleases DNAs were cloned into the pVAX vector for mRNA production and in a plasmid with the CAG promoter for in vitro cell transfection.
TALE nucleases were designed to target the following sites on the exon 2 of the Il2rg gene (Gene ID: 140924), rat genome Assembly (Rnor_6.0): left TALEN: 5′-TGCACTTGGAAT-3′, right TALEN: 3′-TGGTTGGAGTGA-5′.
Generation and Genotyping of Il2rg-deficient Animals
Fertilized 1-cell stage embryos were collected for subsequent microinjection using a previously published procedure.15 Briefly, a mixture of TALEN mRNA was microinjected both into the male pronucleus and into the cytoplasm of fertilized 1-cell stage embryos. Microinjected zygotes were maintained under 5% CO2 at 37°C for 2 hours. Surviving embryos were implanted on the same day in the oviduct of pseudopregnant females (0.5 dpc) and allowed to develop to full term.
For genotyping rats, DNA from tail biopsy from 8- to 10-day-old rats were digested in 500 μL of tissue digestion buffer (Tris-HCl 0.1 mol/L pH 8.3, ethylenediaminetetraacetic acid 5 mmol/L, sodium dodecyl sulfate 0.2%, NaCl 0.2 mol/L, PK 100 μg/mL) in a 1.5-mL tube at 56°C overnight and genotyped by PCR using the primers described below. PCR amplicons were analyzed by capillary electrophoresis as described16 followed by sequencing in Il2rg-mutated founders.
Il2rg-rev, TGATGGGCCAAACATAGGTAGG; Il2rg-fw, CTCCAAGGTCCTCATGTCCAGT; Rag1-592F21, TGACTCCATCCACCCCACTGA; Rag1-1005R22, CTACAGAACAGGTGCTTACAGG.
Western Blot Analysis
Western blot analysis of spleen lysates was performed with a rabbit monoclonal antibody against rat Il2rg (Santa Cruz). Antibody reactivity was developed using a mouse antirabbit IgG-horseradish peroxidase (HRP)-coupled antibody (Santa Cruz). Protein loading was confirmed using a mouse antirat β-actin antibody (Santa Cruz) and revealed with a mouse IgG-HRP-coupled antibody (Santa Cruz).
Cytofluorimetry and Antibodies
Single-cell suspensions from the spleen, thymus, bone marrow, and lymph nodes were prepared as described previously.11 Cell suspensions were analyzed using fluorescein isothiocyanate (FITC)-conjugated mouse antirat CD3 (clone G4.18) and FITC-conjugated mouse antirat TCRαβ. Allophycocyanin (APC)-conjugated mouse antirat IgD (clone MARD-3) was obtained from AbD Serotec (Oxford, UK). FITC-conjugated mouse antirat IgM μ chain was bought from Jackson ImmunoResearch Laboratories (West Grove, PA). The APC-conjugated mouse antirat CD161 (clone 3.2.3), phycoerythrin-conjugated mouse antirat CD45R (rat B220; clone His 24), phycoerythrin-conjugated mouse antirat CD4 (clone OX35), and APC-conjugated mouse antirat CD8 (clone OX8) were from AbD (Serotec), and FITC-conjugated mouse antirat CD172a (clone OX41). The incubation period was 30 minutes at 4°C, and the analysis was performed with a FACSVerse system (BD Biosciences, Franklin Lakes, NJ) and FlowJo software (Tree Star, Ashland, OR).
Serum Immunoglobulin Enzyme Linked ImmunoSorbent Assay
Serum immunoglobulin isotype concentrations were determined by quantitative enzyme linked immunosorbent assays (ELISAs) as described previously.17 Serum was collected from Rag1-, Il2rg-deficient, and RRG animals at 8 weeks of age. Wells of Maxisorp 96 well flat bottom (Nunc) plates were coated (O/N, 4°C) with 5 μg/mL of goat antirat IgM (Jackson ImmunoResearch), goat antirat IgG (Jackson ImmunoResearch), mouse antirat IgA (AbD Serotec), or mouse antirat IgE (AbD Serotec) in 50 μL of PBS and were then blocked with 5% bovine serum albumin in phosphate buffered saline. Fifty μL of diluted sera were loaded in duplicates wells and incubated for 2 hours at 37°C. Purified rat monoclonal antibodies of IgM (Jackson immunoResearch), IgG (Jackson immunoResearch), IgA (AbDSerotec), and IgE isotypes (AbDSerotec) were added at different concentrations and used to generate standard curves. Immunoglobulines were revealed using goat antirat IgM HRP for IgM (Jackson ImmunoResearch), goat antirat IgG HRP for IgG (Jackson immunoResearch), or mouse anti rat kappa + lambda HRP for IgA and IgE (AbD Serotec) for an additional 90 minutes at 37°C. The reaction was visualized by the addition of chromogenic substrate (TMB, BD Biosciences). Absorbance at 450 nm was measured with reduction at 630 nm using an ELISA plate reader. Serum Ig concentrations were determined by extrapolating absorbance values of sera dilutions in the linear range of the dilution curves to those of isotype standard curves and multiplied by the dilution factor.
Grafting of Rat and Human Skin
Square skin grafts (1 cm2) were prepared from the tail of Lewis.1A rats (RT1a MHC haplotype) and transplanted on the flank of wild type (WT), Rag1-deficient, Il2rg-deficient, and RRG animals all of SD origin (all RT1u MHC haplotype). Grafts were fixed to the graft bed with 10 to 12 interrupted sutures and were covered with protective tape. Human skin from abdominoplasty was grafted into the different rat lines with the same procedure as that for rat skin. For both types of skin, the first inspection was carried out 7 days later, and graft survival was monitored every other day. Rejection was defined as 1, normal; 2, dry skin and < 25% necrosis inside the graft; 3, dry skin and 25–75% necrosis; 4, dry skin and > 75% necrosis; 5, 100% necrosis.
Grafting of Human Tumor Cells
The human ovarian cancer cell line A2780 was purchased from Sigma Aldrich (St Louis, MO). Cells were cultured in RPMI 1640 medium (GIBCO, Fort Worth, TX) with 10% heat-inactivated FBS (Hyclone, Logan, UT). Subcutaneous injections of 4 × 105 A2780 cells embedded in Matrigel (BD Biosciences) were performed on 6-week-old rats. Tumors were measured (length [a] and width [b]) in millimeters using calipers, and tumor volumes (V) were calculated using the formula V=ab2/2, where a is the longer one of the 2 measurements.
Liver Humanization
Retrorsine (Sigma Aldrich), an alkaloid that inhibits hepatocyte proliferation,18 was added to distilled water at 10 mg/mL and titrated to pH 2.5 with 1 N HCl to achieve complete dissolution. Subsequently, the solution was neutralized (pH 7) using 1N NaOH and NaCl was added to a final concentration of 6 mg/mL retrorsine and 0.15 mol/L NaCl. Eight-week-old rats received 2 doses of Retrorsine at 30 mg/kg 15 days apart by intraperitoneal injection. Four weeks after the second injection, a two thirds partial hepatectomy was performed. Immediately after, 2×106 freshly thawed human primary hepatocytes (Biopredic International, St Gregoire, France) were injected into the portal vein.
For measurement of human albumin in rat plasma, samples were collected periodically by retro-orbital bleeding, and human albumin levels were determined by ELISA (Bethyl Laboratories). The antibodies used in this assay were human specific and were not cross-reactive with rat albumin.
Statistical Analysis
Results are presented as means ± SD. Statistical analysis between samples was performed by a Mann-Whitney test and for graft survival by a Kaplan-Meier test, using GraphPad Prism 4 software (GraphPad Software, San Diego, CA). Differences associated with probability values of aP < 0.05, bP < 0.005, cP < 0.0002 and d < 0.0001 were considered statistically significant.
RESULTS
Generation of Il2rg-deficient and RRG Animals
We targeted the Il2rg locus using TALENs that recognized sequences in the 2nd exon (Figure 1A). Several pairs of TALENs were generated, the analysis of indels after transfection into rat cells and PCR/T7EI digestion allowed selection of a pair of TALENs with the highest activity (data not shown).
;)
FIGURE 1: Generation of Il2rg-deficient rats using TALENs. TALENs recognizing rat Il2rg sequences were generated and used for microinjection into rat zygotes. A, Il2rg DNA sequences recognized by the pair of TALENs used in the generation of Il2rg-deficient rats. B, Il2rg-mutated sequence (80 bp deletion) of the rat line used in this study. Intron 2 sequence only depicted for the first nucleotides. Premature stop codon in exon 3 underlined and in bold. C, Western blot analyses of 2 males of the Il2rg-deficient rat line used in this study and a WT animal as control using an anti-Il2rγ antibody and anti-β actin as loading control.
The mRNA for these TALENs were simultaneously microinjected into two hundred twenty-eight 1-cell rat embryos as previously described.15 One hundred fifty-seven of these embryos were transferred into foster mothers, and 32 newborns were genotyped using the same PCR/T7EI digestion used for in vitro testing of the TALENs, allowing the identification of 12 mutated founders (5.3% of microinjected embryos and 37.5% of newborn rats). The mutations of these founders were defined by sequencing of the amplicons, allowing detection of founders with indels that generate frame shifts of the coding sequences with generation of premature stop codons (data not shown). Four of these founders were mated to wild-type (WT) animals to generate rat lines. All founders transmitted the mutation to the offspring, and spleen cells from mutated males (Il2rg gene is in chromosome X) from the different lines showed decreased T, B and NK cells (data not shown). One rat line was further analyzed (line 1.3) which carried an 80-bp deletion with generated premature stop codon in the third exon (Figure 1B). The absence of Il2rg was confirmed by Western blot (Figure 1C). Thus, TALENs were efficient for the generation of Il2rg-deficient rats.
Immunophenotype in Rag1-deficient, Il2rg-deficient, and RRG Animals
One line of Il2rg-deficient animals was mated with Rag1-deficient rats to obtain RRG animals that are homozygous for mutations in both alleles of Rag1 and since Il2rg is situated in the X chromosome males mutated for Il2rg are deficient for Il2rg.
Macroscopic examination of thymus, spleen, and lymph nodes showed decrease size in both Rag1- or Il2rg-deficient rats and more in RRG animals (data not shown).
Immunophenotype of Rag1-, Il2rg-deficient, and RRG animals showed that although TCR+ CD4+ and CD8+ were drastically reduced in Rag1 or Il2rg-deficient rats, a significant proportion and absolute numbers were still present, whereas RRG animals showed virtually no detectable T cells (Figure 2A and Table 1). NK cells (CD161bright TCR+) were reduced in Rag1-deficient animals, even more in Il2rg-deficient rats and further reduced in RRG animals (Figure 2A and Table 1). Monocytes and macrophages detected using an anti-CD172a antibody, and evidenced also by CD161low staining, were present in comparable numbers in the spleen of WT and Il2rg-deficient, whereas there are drastically reduced in Rag1 and RRG animals (Table 1 and see Figure S1, SDC,https://links.lww.com/TP/B569) as well as in lymph nodes and bone marrow (data not shown). Spleen B cells were also profoundly decreased in both Rag1- and Il2rg-deficient rats but still detectable, whereas RRG animals showed undetectable levels (Figure 2B and Table 1).
FIGURE 2: Phenotype of lymphocyte populations. Spleen cells from adult males were analyzed for lymphocyte populations. A, T (TCR+) CD4+ and CD8+ cells as well as NK cells (CD161bright TCR−) were analyzed using MAbs and cytofluorimetry. B, B cells were analyzed and different differentiation stages defined using anti-IgM and anti-IgD MAbs. Representative experiment from n = 3 to 7 for each rat line.
TABLE 1: Absolute numbers of immune cells in different lymphoid compartments of Rag1 KO, Il2rg KO, and RRG rats
In connection with the B-cell phenotype, all serum immunoglobulin levels were reduced in both Rag1 or Il2rg-deficient rats whereas were undetectable in RRG animals, as observed in Igm knockout rats17 (Figure 3).
FIGURE 3: Serum immunoglobulin isotypes. Serum was drawn from adult rats and the amount of different immunoglobulin isotypes quantified by ELISA.
IgM-mutated rats
17 were used as control for the absence of all immunoglobulin isotypes.
In conclusion, although Il2rg-deficient rats were more immunosuppressed than Rag1-deficient rats because they had reduced levels of NK cells, both had still detectable T and B cells, whereas RRG animals showed almost undetectable levels of all lymphoid populations as well as of immunoglobulins.
Allogeneic and Human Xenogeneic Skin Graft Survival in Rag1-deficient, Il2rg-deficient, and RRG Animals
To test the function of adaptive immune responses in vivo, we analyzed survival of allogeneic skin grafts in the different rat strains. Although WT, Rag1- and Il2rg-deficient rats rejected allogeneic skin (Figure 4A), all RRG animals permanently accepted these grafts (Figure 4A). Although this experiment proves that in vivo adaptive immune response of RRG animals are completely abrogated versus the single Rag1- or Il2rg-deficient rats, we sought to analyze the survival of human skin grafts, which is not only a stronger stimuli versus allogeneic skin but if accepted would also be a useful model of humanization of RRG animals, as it is the case for immunodeficient mice.5 Human skin was consistently rejected by all WT animals and accepted by all RRG animals (Figure 4B).
FIGURE 4: Skin graft survival. Skin from allogeneic or human origin were grafted into different rat lines and rejection scored by visual inspection. A, Major histocompatibility complex (MHC) mismatch skin from Lewis.1A rats (RT1a MHC haplotype) was grafted into different the rat lines (WT, Rag1-deficient, Il2rg-deficient and RRG) all of SD origin (predominantly RT1u MHC haplotype). B, (upper) Human skin was grafted into the different rat lines (WT, Il2rg-deficient and RRG). Graft score for A and B: 1: normal; 2: dry skin and < 25% necrosis inside the graft; 3: dry skin and 25–75% necrosis; 4: dry skin and > 75% necrosis; 5: 100% necrosis. B, (below) Human skin transplanted into WT rats showed grade 5 rejection at day 14 after transplantation (left), human skin transplanted into RRG animals show normal grade 1 at day 14 (middle) and 34 (right) after transplantation.
These results show that RRG animals are more immunodeficient than Rag1- or Il2rg-deficient rats and also that not only adaptive but also at least some innate immune responses against strong human xenogeneic stimuli, such as NK cells,19 are also abolished, allowing the use of RRG animals for humanization studies using other tissues or cells.
Human Tumor Growth in Il2rg-deficient and RRG Animals
Immunodeficient mice are widely used as recipients of human tumors for a variety of studies.2 The availability of immunodeficient rats would be useful to perform studies that are difficult in mice, such as implantation of tumor cells in orthotropic locations. To test the survival of human tumor cells, we transplanted ovarian human tumor cells (A2780) into WT, Il2rg, or RRG animals. Tumor cells were rejected and never showed growth in WT, grew slowly or transiently in some Il2rg-deficient animals and grew in all RRG animals (Figure 5). These results demonstrate that RRG animals could be useful recipients of human tumor cells for studies in vivo.
FIGURE 5: Human tumor graft growth. Human A2780 cells were embedded in Matrigel and implanted subcutaneously into WT (n = 6), IL2rg-deficient (n = 3) and RRG (n = 7) animals. Tumor growth was quantified and expressed as mm3. Each curve represents a single animal.
Liver Humanization of RRG Animals
Acceptance of human hepatocytes and liver humanization in rats would be a useful model to test a variety of therapeutic strategies for which immune responses are an obstacle, such as gene and cell therapy, as well as immune interventions with antibodies. Human hepatocytes were injected into the portal vein of rats that have been previously treated with retrorsine and partial hepatectomy to favor human hepatocyte grafting and proliferation. In 3 of 4 RRG animals, high levels of human albumin in sera (37 to 90 μg/mL) were observed between 8 and 12 weeks after transplantation, whereas human albumin was not detected in control rats (Figure 6). This demonstrated successful engraftment and repopulation by human hepatocytes in RRG animals.
FIGURE 6: Liver humanization. Human primary hepatocytes were infused in retrorsine-treated adult animals. A, Follow-up of human albumin production in the sera of individual RRG and WT animals is indicated at the indicated time points.
DISCUSSION
Despite immunodeficient mice having been and continuing to be excellent models for many applications,3 there are experimental models that have been historically developed in rats, such as in the cardiovascular domain,20 and certain diseases reproduce better the pathophysiology of humans in rats rather than in mice.9,10,21 Furthermore, the bigger size of rats is an important advantage in situations in which size matters, such as whole member transplantation,22 retinal diseases, as well as for sampling tissues and blood more frequently and in larger volumes is needed.21 In all these situations, the availability of immunodeficient rats could be a useful model that would allow to test both the role of immune responses and to avoid immune responses against immunogenic treatments, such as proteins, cells or tissues from other species, including human origin. In this regard and as an example, the possibility of grafting human tumors at orthotropic locations, such as in precise locations of the central nervous system, bones, or the prostate, would be an advantage as compared with immunodeficient mice.
We11 and others23 have described the immunophenotype of Rag1-deficient rats. Mashimo’s group described for the first time the immunophenotype of Prkdc simple and Prkdc and Il2rg double-deficient rats but not of Il2rg simple deficient rats.24
Nude (Foxn1 mutation) and Prkdc-deficient rats show a leaky immune phenotype with partial B and T immune responses and an intact NK compartment. Prkdc-deficient rats showed growth retardation and high radiation sensitivity,24 as Prkdc mutated mice also show,2 limiting irradiation doses needed for some experimental protocols. Thus, Rag1-mutated rats in combination with Il2rg mutations combine a profound immune-deficient phenotype without the sensitivity to irradiations observed in Prkdc- and Il2rg-mutated rats already described. Rag2- and Il2rg-deficient rats are available from Hera biolabs but their phenotype has not been published. Thus, the present article is the first description of the immunophenotype of Il2rg-deficient rats as well for double Rag1- and Il2rg-deficient rats without the limitations of the previous models.
RRG animals not only accepted allogeneic but also human skin, whereas single Rag1- and Il2rg-mutated rats did not. RRG animals are the first immunodeficient rats to be reported as accepting transplantation of human skin. Short-term immune humanization using PBMCs and human skin transplantation or other cells or tissues could allow to analyze new tolerogenic or immunosuppressive regimes to inhibit human immune responses as it has been done in mice.5,25 Immune humanization using PBMCs or hematopoietic humanization with cord blood CD34+ cells (using CD34+ cells simultaneously used successfully to humanize NSG mice) failed in adult sublethaly irradiated RRG animals treated or not with liposomes containing clodronate to eliminate macrophages (data not shown). Hematopoietic humanization has not been obtained yet in rats because humanization of Prkdc and Il2rg double-deficient rats using human CD34+ cells failed and immune system humanization using PBMCs was not reported.24 Species incompatibility between Sirpa of recipient macrophages and human CD47 in human hematopoietic cells has been shown to reduce hematopoietic humanization in mice due to phagocytosis.2,26 NOD mice displaying a spontaneous mutation in Sirpa allowing interaction with human CD47 or transgenic expression of human SIRPa in recipient mouse macrophages increased humanization.2,26 We have generated transgenic rats with human SIRPa expression by rat macrophages and binding human CD474 and the future crossing with RRG animals could allow to obtain hematopoietic humanization.
Transplantation of rat hepatic stem cell lines into allogeneic rats that were Il2rg and fumarylacetoacetate hydrolase (Fah) double-deficient rats with liver failure has been described.27 The liver repopulation by these liver stem cells was low, and it is possible that allogeneic immune responses are at least in part responsible for this because Il2rg single mutants still have remnant immune responses. RRG animals backcrossed or not into Fah-deficient recipients could be useful for this kind of stem cell-based therapy using allogeneic cells.
As far as liver humanization studies in rat is concerned, double mutant Pkrdc and Il2rg rats accepted human hepatocytes but these cells were isolated from human-hepatocyte chimeric mice,24 and thus are these hepatocytes that were preselected in vivo by a previous passage through a humanization process. In another study, nude rats heavily irradiated and transplanted with Scid mouse bone marrow followed by transplantation of human hepatocytes harvested from the liver of humanized mice showed low engraftment (human albumin <100 ng/mL).28Rag1-deficient rats have been used as recipients for liver humanization with immature hepatocytes but successful engraftment required FK506 treatment as well as neonatal thymectomy and continuous treatment with antiasialo GM1 antibodies to deplete T and NK cells, respectively.29 Thus, RRG animals allow for the first time efficient liver humanization using primary mature hepatocytes and with no further immune treatment. This model could be useful for in vivo drug and toxicological assays by human hepatocytes. Additionally, iPS-derived hepatocyte precursors could be grafted in RRG animals as it has been done in immunodeficient mice.30,31 This would allow to generate larger numbers of in vivo fully differentiated human hepatocytes from healthy or disease patients that will be useful in in vitro experiments and research. Liver humanization could be increased by crossing RRG rats with genetic defects (such as Fah-deficient ones), allowing preferential growth of transplanted hepatocytes.
In conclusion, RRG animals could be useful models for stem-cell based medicine and transplantation as well as for toxicology and oncology.
ACKNOWLEDGMENTS
The authors acknowledge C. Collet and D. Atticus (Centre de Recherche en Transplantation et Immunologie UMR1064, INSERM, Université de Nantes, Nantes, France) for the realization of hAlbumin ELISA.
REFERENCES
1. DiSanto JP, Müller W, Guy-Grand D, et al. Lymphoid development in mice with a targeted deletion of the interleukin 2 receptor gamma chain.
Proc Natl Acad Sci U S A. 1995;92:377–381.
2. Shultz LD, Brehm MA, Garcia-Martinez JV, et al. Humanized mice for immune system investigation: progress, promise and challenges.
Nat Rev Immunol. 2012;12:786–798.
3. Walsh NC, Kenney LL, Jangalwe S, et al. Humanized mouse models of clinical disease.
Annu Rev Pathol. 2017;12:187–215.
4. Jung CJ, Menoret S, Brusselle L, et al. Comparative analysis of piggyBac, CRISPR/Cas9 and TALEN Mediated BAC transgenesis in the zygote for the generation of humanized SIRPA rats.
Sci Rep. 2016;6:31455.
5. Sagoo P, Ali N, Garg G, et al. Human regulatory T cells with alloantigen specificity are more potent inhibitors of alloimmune skin graft damage than polyclonal regulatory T cells.
Sci Transl Med. 2011;3:83ra42.
6. Tellides G, Tereb DA, Kirkiles-Smith NC, et al. Interferon-gamma elicits arteriosclerosis in the absence of leukocytes.
Nature. 2000;403:207–211.
7. Tesson L, Cozzi J, Menoret S, et al. Transgenic modifications of the rat genome.
Transgenic Res. 2005;14:531–546.
8. Tesson L, Usal C, Menoret S, et al. Knockout rats generated by embryo microinjection of TALENs.
Nat Biotechnol. 2011;29:695–696.
9. Breban M, Falgarone G, Blanchard H, et al. Animal models of the spondyloarthropathies.
Curr Rheumatol Rep. 2000;2:282–287.
10. Larcher T, Lafoux A, Tesson L, et al. Characterization of dystrophin deficient rats: a new model for Duchenne muscular dystrophy.
PLoS One. 2014;9:e110371.
11. Menoret S, Fontaniere S, Jantz D, et al. Generation of Rag1-knockout immunodeficient rats and mice using engineered meganucleases.
FASEB J. 2013;27:703–711.
12. Miller JC, Tan S, Qiao G, et al. A TALE nuclease architecture for efficient genome editing.
Nat Biotechnol. 2011;29:143–148.
13. Doyon Y, Choi VM, Xia DF, et al. Transient cold shock enhances zinc-finger nuclease-mediated gene disruption.
Nat Methods. 2010;7:459–460.
14. Zhang F, Cong L, Lodato S, et al. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription.
Nat Biotechnol. 2011;29:149–153.
15. Remy S, Tesson L, Menoret S, et al. Efficient gene targeting by homology-directed repair in rat zygotes using TALE nucleases.
Genome Res. 2014;24:1371–1383.
16. Chenouard V, Brusselle L, Heslan JM, et al. A rapid and cost-effective method for genotyping genome-edited animals: a heteroduplex mobility assay using microfluidic capillary electrophoresis.
J Genet Genomics. 2016;43:341–348.
17. Menoret S, Iscache AL, Tesson L, et al. Characterization of immunoglobulin heavy chain knockout rats.
Eur J Immunol. 2010;40:2932–2941.
18. Laconi E, Oren R, Mukhopadhyay DK, et al. Long-term, near-total liver replacement by transplantation of isolated hepatocytes in rats treated with retrorsine.
Am J Pathol. 1998;153:319–329.
19. Griesemer A, Yamada K, Sykes M. Xenotransplantation: immunological hurdles and progress toward tolerance.
Immunol Rev. 2014;258:241–258.
20. Langley SR, Bottolo L, Kunes J, et al. Systems-level approaches reveal conservation of trans-regulated genes in the rat and genetic determinants of blood pressure in humans.
Cardiovasc Res. 2013;97:653–665.
21. Aitman T, Dhillon P, Geurts AM. A RATional choice for translational research?
Dis Model Mech. 2016;9:1069–1072.
22. Ajiki T, Kimura A, Sato Y, et al. Composite tissue transplantation in rats: fusion of donor muscle to the recipient site.
Transplant Proc. 2005;37:208–209.
23. Zschemisch NH, Glage S, Wedekind D, et al. Zinc-finger nuclease mediated disruption of Rag1 in the LEW/Ztm rat.
BMC Immunol. 2012;13:60.
24. Mashimo T, Takizawa A, Kobayashi J, et al. Generation and characterization of severe combined immunodeficiency rats.
Cell Rep. 2012;2:685–694.
25. Bézie S, Meistermann D, Boucault L, et al. Ex vivo expanded human non-cytotoxic CD8+CD45RClow/- Tregs efficiently delay skin graft rejection and GVHD in humanized mice.
Front Immunol. 2018;8:2014.
26. Strowig T, Rongvaux A, Rathinam C, et al. Transgenic expression of human signal regulatory protein alpha in Rag2-/-gamma(c)-/- mice improves engraftment of human hematopoietic cells in humanized mice.
Proc Natl Acad Sci U S A. 2011;108:13218–13223.
27. Kuijk EW, Rasmussen S, Blokzijl F, et al. Generation and characterization of rat liver stem cell lines and their engraftment in a rat model of liver failure.
Sci Rep. 2016;6:22154.
28. Igarashi Y, Tateno C, Tanaka Y, et al. Engraftment of human hepatocytes in the livers of rats bearing bone marrow reconstructed with immunodeficient mouse bone marrow cells.
Xenotransplantation. 2008;15:235–245.
29. Tsuchida T, Zheng YW, Zhang RR, et al. The development of humanized liver with Rag1 knockout rats.
Transplant Proc. 2014;46:1191–1193.
30. Chen YF, Tseng CY, Wang HW, et al. Rapid generation of mature hepatocyte-like cells from human induced pluripotent stem cells by an efficient three-step protocol.
Hepatology. 2012;55:1193–1203.
31. Liu H, Kim Y, Sharkis S, et al. In vivo liver regeneration potential of human induced pluripotent stem cells from diverse origins.
Sci Transl Med. 2011;3:82ra39.
