Kidney transplantation is the optimal therapy for end-stage renal disease, but there is a severe shortage of donor kidneys so that more than 100 000 Americans wait on the United Network for Organ Sharing kidney transplant waiting list.1 Xenotransplantation using pig kidneys could eliminate the donor shortage, but antibody-mediated rejection (AMR) has prevented movement toward clinical application. Genome editing and somatic cell nuclear transfer make it possible to modify pigs so that their organs are less vigorously attacked by the human immune system. Recent progress in (1) genetic engineering of donor pigs, and (2) survival in preclinical renal xenograft models makes it reasonable to consider limited clinical trials with genetically modified pig kidney xenografts.2-4
Wild-type (WT) pig kidneys are hyperacutely rejected by nonhuman primates (NHPs), largely on the basis of the circulating antibodies to the gal-α(1,3)-gal epitope (αGal).5 The creation of galactosyltransferase (GGTA)1 KO pigs that did not express αGal was a major step forward for xenotransplantation.6,7 The GGTA1 KO pig kidneys transplanted into NHPs using clinically acceptable immunosuppression survived from 6 to 16 days. The AMR was still the cause of graft failure, and as a result, the field stagnated.8 If NHP recipients are screened for low levels of xenoreactive antibodies pretransplant, then GGTA1 KO pig kidneys can survive for extended periods (5 and >9 months) using strong immunosuppression. If weaker immunosuppression is used, then T cell–mediated rejection is encountered in a manner similar to that seen in renal allotransplantation.3 Recent developments in genome editing have paved the way for the creation of pigs whose cells have reduced levels of human xenoreactive antibody binding to a level that is similar to what is acceptable for clinical renal allotransplantation.2,9,10
The first multiple xenoantigen KO pig was the GGTA1 gene, and the cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH) gene KO [double knockout (DKO)] pig.10 This pig was devoid of αGal, and N-glycolylneuraminic acid (Neu5Gc), 2 significant xenoantigens in humans. The αGal and Neu5Gc are produced in pigs by genes in pigs, GGTA1 and CMAH that are unitary pseudogenes in humans. Humans produce antibodies to αGal and Neu5Gc as a result of losing the genes responsible for producing them.11,12 The flow cytometric crossmatch using human serum and peripheral blood mononuclear cells (PBMCs) from DKO pigs showed that there was less antibody binding to the DKO pig than to chimpanzee PBMCs.9 This result is significant because chimpanzee kidneys transplanted into humans are not hyperacutely rejected.13 Byrne et al14,15 identified the pig enzyme β-1,4-N-acetyl-galactosaminyl transferase 2 (B4GALNT2) transferase as producing the SDa glycan that was a xenoantigen in the NHP. Using Cas9, the triple xenoantigen GGTA1/CMAH/B4GALNT2 KO (TKO) pigs were created. The human antibody binding to the PBMCs from the TKO pigs was similar to what is encountered in successful allotransplantation.2
The work in this report provides a detailed analysis of human xenoreactive antibody binding to DKO RMEC. Additionally, the impact of deleting B4GALNT2 on human antibody binding to RMEC is examined.
MATERIALS AND METHODS
Primary RMEC Isolation
Porcine kidneys from WT, GGTA1 KO, and DKO KO pigs were flushed with 0.025% of collagenase type IV from Clostridium histolyticum (Sigma, St. Louis, MO) at 37°C as previously described for pig livers.16-18 Primary renal cell were isolated and cultured with Roswell Park Memorial Institute medium supplemented with 100 μg/mL endothelial cell-specific growth factor, penicillin, streptomycin, and amphotericin B. In addition, 10% fetal bovine serum was added for WT and GGTA1 KO cell culture, whereas to avoid fetal bovine serum-induced false-positive Neu5Gc expression (data not shown), 10% of DKO pig serum was added for DKO cell culture. On day 3 postisolation, cell sorting for both CD31(+) RMEC was performed using the FACSVantage SE at the Indiana University Flow Cytometry Resource Facility. These cells were used within 3 to 5 passages.
Flow Cytometry
The cells were harvested and stained as described previously.18 The following antibodies were used: antipig CD31 (AbD seroTec. Raleigh, NC), Alexa Fluor 647 Griffonia simplicfolia IB4 (IB4 lectin; Invitrogen, Grand Island, NY), fluorescein-labeled Dolichos biflorus agglutinin (DBA) (Vector Labs, Burlingame, CA), donkey antichicken DyLight 649 antibody (Jackson ImmunoResearch Laboratories Inc), antipig swine leucocyte antigen (SLA) class II DR and DQ and SLA class I, von Willebrand (AbD seroTec). A chicken anti-Neu5Gc antibody kit (Biolegend, San Diego, CA) was used based on the kit instruction. Flow cytometric data were collected using Accuri C6 flow cytometer and CFlow software (Accuri, Ann Arbor, MI).
Flow Cytometric Crossmatch Assay
To assess the level of xenoantigens remaining on DKO RMEC, crossmatch assay was performed using human AB pool serum in 1:4 serial dilution: 25%, 6.25%, and 1.56% (Lonza Bioscience, Rockland, ME), healthy volunteers, and DyLight 488-conjugated goat antihuman IgM or DyLight 488 Donkey antihuman IgG (Jackson ImmunoResearch Laboratories Inc) as described previously.19
Generation of Immortalized RMEC
Porcine immortalized cell lines were generated as described previously.18 Briefly, primary RMEC from DKO pigs were isolated. After a 3-day culture, the RMEC were infected for 24 hours with lentiviral supernatant, containing lentiviral vector in which a complementary DNA expresses the large and small T antigen of SV40 (Applied Biological Materials Inc, Richmond, BC, Canada). Single-cell clones were isolated and amplified up to 10 passages. Immortalized RMEC (iRMEC) were used for characterization within passages 15 to 40.
Histological Analysis
Confocal microscope on pig cells was performed as described previously.16 Briefly, the pig RMEC were fixed with 4% paraformaldehyde, permeabilized with triton X-100, blocked with 1% bovine serum albumin in phosphate buffered saline, and then labeled with antibodies toward CD31 (R&D System, Minneapolis, MN), SLA DR, SLA DQ, and SV40 TAg (Applied Biological Materials Inc). Slides were imaged using laser settings adjusted for the isotype controls on an Olympus FV1000 confocal microscope.
Generation of iRMEC Deficient in B4GALNT2 Using Clustered Regularly Interspaced Short Palindromic Repeat-Associated 9 System
Oligonucleotides used to construct the sgRNA expression vector targeting pig B4GALNT2 genes were designed and cloned into a linearized vector pX330/BbsI as described previously.20 The oligo sequences are followings: forward: 5′ CACCGTGTATCGAGGAACACGCTT 3′ and reverse: 5′ AAACAAGCGTGTTCCTCGATACAC3′. Briefly, iRMEC with GGTA1/CMAH deficiency were plated in 6-well plate. When the cells became 90% confluent, 2 μg of DNA (β4GALNT2 clustered regularly interspaced short palindromic repeat-associated 9) and Lipofectamine 2000CD complexes were prepared and added directly to the cells in culture according to the manufacturer's instructions (Life Technologies). The transfected cells were expanded and stained with DBA-FITC (Vector Laboratories). DBA-negative cells were selected by flow sorting using the FACSVantage SE.
Statistics
GraphPad Prism 5 (GraphPad Software, La Jolla, CA,) was used for data analysis. Two-tailed Student t test was performed. Significant differences were considered at P less than 0.05.
RESULTS
Features of DKO RMEC
Like human RMEC,21 purified DKO RMEC exhibited endothelial morphologic features and coexpressed CD31 and SLA DR using flow cytometry (Figure 1A). In addition, von Willebrand factor and SLA class I were also identified on these cells. DKO RMEC were deficient in both ɑGal and Neu5Gc compared with WT and GGTA1 KO RMEC (Figure 1B).
;)
FIGURE 1: Human xenoreactive antibody binding was reduced in DKO RMEC. A, Purified RMEC in culture displayed endothelial morphologic features under light microscopy (left panel). Expression of CD31, SLA class II DR, von Willebrand factor, and SLA class I in RMEC were analyzed using flow cytometry (right panel). B, The αGal and Neu5Gc expression in RMEC from WT, GGTA1 KO, and DKO pigs were examined using flow cytometry. Fluorescent-conjugated IB4-lectin was used to assess αGal, and anti-Nue5Gc antibody was used for Neu5Gc epitopes; Unstained cells are shown as controls for IB4-lectin, and an isotype control for Neu5Gc. Representative histograms are shown. C, A four-fold serial dilution of human AB pool sera was used to label the RMEC. Human antibodies were detected with fluorescently conjugated antihuman IgG or IgM antibodies. The cells were treated with secondary antibody only as a control. Histograms are representative of 3 individual experiments. D, Human IgG/IgM binding was assessed after normalization with the MFI of the cells incubated with only secondary antibody. The results from individual experiments (using 25% serum) are expressed as mean ± SD, n = 3 and *P < 0.05 (right panel).
Reduced Human Antibody Binding to DKO RMEC
To assess the level of xenoantigens on DKO RMEC, cells were incubated with human AB pooled serum in serial dilution. Human IgG and IgM binding to RMEC increased in a dose-dependent manner (Figure 1C). The results from individual experiments (using 25% serum) revealed that the mean fluorescent intensity (MFI) from human IgG/IgM binding to DKO RMEC was significantly reduced compared with those from WT or GGTA1 KO RMEC (Figure 1D).
Deletion of B4GALNT2 Further Reduces Human Xenoreactive Antibody Binding to TKO iRMEC Line
Porcine B4GALNT2 has been shown to produce carbohydrate xenoantigens.14,22 Unlike human aortic endothelial cells, GGTA1/CMAH DKO RMEC significantly displayed B4GALNT2-derived carbohydrates by flow cytometry analysis and confocal image (Figure 2). Immortalized DKO RMEC (iRMEC) were generated using Lenti-SV40T Lentivirus. Confocal microscopy confirmed SV40 TAg expression on iRMEC (Figure 3A). The B4GalNT2 gene in DKO iRMEC was disrupted using gRNA and the Cas9 endonuclease. The mutant alleles consist of a 12 base deletion (Figure 3B). The cell line was deficient in the αGal, Neu5Gc, and B4GalNT2 carbohydrates using flow cytometry analysis (Figure 3C). Flow cytometry results showed that human IgG binding to TKO iRMEC was significantly reduced by 23% of MFI compared with DKO iRMEC, and human IgM binding was reduced by 72% of MFI (Figure 3D), suggesting that human xenoreactive antibodies might recognize B4GALNT2 antigen on porcine RMEC.
FIGURE 2: Expression of porcine B4GALNT2 in GGTA1/CMAH KO RMEC. A, DKO RMEC and human aortic EC were stained with fluorescein-labeled DBA. Unstained cells are shown as negative controls. Expression of B4GALNT2 in DKO RMEC was analyzed using flow cytometry. Representative histogram is shown (left panel). The bar graph is shown as normalized MFI ± SD, n = 3 and *P < 0.05 (right panel). B, Confocal microscopy images also confirmed that DKO RMEC were positive for RMEC marker CD31 and DBA. Representative results are shown. EC, endothelial cells.
FIGURE 3: Reduced human xenoreactive antibody binding on iRMEC deficient in B4GALNT2. A, SV 40 TAg expression of DKO iRMEC was confirmed using confocal microscopy. B, DNA sequence analysis revealed mutations in B4GALNT2 iRMEC (TKO iRMEC) by electropherograms. Wild type sequence of iRMEC is shown for comparison to the modified alleles. C, TKO iRMEC was analyzed for DBA, αGal, and Neu5Gc expression using flow cytometry. D, Flow cytometry analysis was performed for a comparison of human IgG and IgM binding toward TKO iRMEC and DKO iRMEC using 25% human serum. The bar graph is shown as normalized MFI ± SD, n = 32 and *P < 0.05.
DISCUSSION
Renal xenotransplantation has not progressed toward the clinic because of our inability to control rejection driven by xenoreactive antibodies. Recently, 2 groups have shown increased graft and recipient in a life-supporting preclinical pig-to-primate model (as long as 9 months).3,4 If recipients have lower pretransplant levels of xenoreactive antibodies, then it is possible to prolong survival with strong immunosuppression. The crossmatch of PBMCs from DKO pigs with human serum showed a marked reduction in human antibody binding.2 Our results extend these findings, showing that the reduced antibody binding to the new donor pigs will extend to the RMEC, the interface between a pig kidney xenograft and the human immune system in a clinical xenograft. The deletion of B4GALNT2 in the immortalized DKO RMEC cell line also suggests that the newly created TKO pigs will experience less antibody-mediated injury than the DKO pig kidneys in the clinical setting. There are still some patients with significant antibody binding to the triple KO pig; several reports have shown that some humans have antibodies that react with SLA.23-25 Class I MHC knockout pigs devoid of SLA 1, 2, and 3 have been produced and are healthy, so it will be possible to avoid these antigens for patients with HLA antibodies that react with class I SLA.26
In summary, recently developed xenoantigen KO pigs have reduced human antibody binding in the RMEC, reducing AMR as a barrier to clinical xenotransplantation. The new triple xenoantigen pigs, with deletion of the B4GALNT2 that produces the SDa antigen, will reduce human antibody binding further in RMEC. The future prospects for clinical xenotransplantation are improving rapidly with advances in genome editing.
ACKNOWLEDGMENTS
The authors thank the Methodist Research Institute and Laboratory of Animal Research Center staff for assistance and care of the animals.
REFERENCES
1. Friedewald JJ, Samana CJ, Kasiske BL, et al. The kidney allocation system.
Surg Clin North Am. 2013; 93: 1395–1406.
2. Estrada JL, Martens G, Li P, et al. Evaluation of human and non-human primate antibody binding to pig cells lacking GGTA1/CMAH/beta4GalNT2 genes.
Xenotransplantation. 2015; 22: 194–202.
3. Higginbotham L, Mathews D, Breeden CA, et al. Pre-transplant antibody screening and anti-CD154 costimulation blockade promote long-term xenograft survival in a pig-to-primate kidney transplant model.
Xenotransplantation. 2015; 22: 221–230.
4. Iwase H, Liu H, Wijkstrom M, et al. Pig kidney graft survival in a baboon for 136 days: longest life-supporting organ graft survival to date.
Xenotransplantation. 2015; 22: 302–309.
5. Daniels LJ, Platt JL. Hyperacute xenograft rejection as an immunologic barrier to xenotransplantation.
Kidney Int Suppl. 1997; 58: S28–S35.
6. Phelps CJ, Koike C, Vaught TD, et al. Production of alpha 1,3-galactosyltransferase-deficient pigs.
Science. 2003; 299: 411–414.
7. Dai Y, Vaught TD, Boone J, et al. Targeted disruption of the alpha1,3-galactosyltransferase gene in cloned pigs.
Nat Biotechnol. 2002; 20: 251–255.
8. Chen G, Qian H, Starzl T, et al. Acute rejection is associated with antibodies to non-Gal antigens in baboons using Gal-knockout pig kidneys.
Nat Med. 2005; 11: 1295–1298.
9. Burlak C, Paris LL, Lutz AJ, et al. Reduced binding of human antibodies to cells from GGTA1/CMAH KO pigs.
Am J Transplant. 2014; 14: 1895–1900.
10. Lutz AJ, Li P, Estrada JL, et al. Double knockout pigs deficient in N-glycolylneuraminic acid and galactose alpha-1,3-galactose reduce the humoral barrier to xenotransplantation.
Xenotransplantation. 2013; 20: 27–35.
11. Galili U. Discovery of the natural anti-Gal antibody and its past and future relevance to medicine.
Xenotransplantation. 2013; 20: 138–147.
12. Salama A, Evanno G, Harb J, et al. Potential deleterious role of anti-Neu5Gc antibodies in xenotransplantation.
Xenotransplantation. 2015; 22: 85–94.
13. Reemtsma K, McCracken BH, Schlegel JU, et al. Renal heterotransplantation in man.
Ann Surg. 1964; 160: 384–410.
14. Byrne GW, Du Z, Stalboerger P, et al. Cloning and expression of porcine beta1,4N-acetylgalactosaminyl transferase encoding a new xenoreactive antigen.
Xenotransplantation. 2014; 21: 543–554.
15. Byrne GW, Stalboerger PG, Du Z, et al. Identification of new carbohydrate and membrane protein antigens in cardiac xenotransplantation.
Transplantation. 2011; 91: 287–292.
16. Burlak C, Paris LL, Chihara RK, et al. The fate of human platelets perfused through the pig liver: implications for xenotransplantation.
Xenotransplantation. 2010; 17: 350–361.
17. Paris LL, Chihara RK, Reyes LM, et al. ASGR1 expressed by porcine enriched liver sinusoidal endothelial cells mediates human platelet phagocytosis in vitro.
Xenotransplantation. 2011; 18: 245–251.
18. Wang ZY, Paris LL, Chihara RK, et al. Immortalized porcine liver sinusoidal endothelial cells: an in vitro model of xenotransplantation-induced thrombocytopenia.
Xenotransplantation. 2012; 19: 249–255.
19. Zhu A, Hurst R. Anti-N-glycolylneuraminic acid antibodies identified in healthy human serum.
Xenotransplantation. 2002; 9: 376–381.
20. Zhu A, Zhang M, Wu J, et al. Covalent immobilization of chitosan/heparin complex with a photosensitive hetero-bifunctional crosslinking reagent on PLA surface.
Biomaterials. 2002; 23: 4657–4665.
21. Muczynski KA, Ekle DM, Coder DM, et al. Normal human kidney HLA-DR-expressing renal microvascular endothelial cells: characterization, isolation, and regulation of MHC class II expression.
J Am Soc Nephrol. 2003; 14: 1336–1348.
22. Burlak C, Twining LM, Rees MA. Terminal sialic acid residues on human glycophorin A are recognized by porcine Kupffer cells.
Transplantation. 2005; 80: 344–352.
23. Diaz Varela I, Sanchez Mozo P, Centeno Cortes A, et al. Cross-reactivity between swine leukocyte antigen and human anti-HLA-specific antibodies in sensitized patients awaiting renal transplantation.
J Am Soc Nephrol. 2003; 14: 2677–2683.
24. Mulder A, Kardol MJ, Arn JS, et al. Human monoclonal HLA antibodies reveal interspecies crossreactive swine MHC class I epitopes relevant for xenotransplantation.
Mol Immunol. 2010; 47: 809–815.
25. Oostingh GJ, Davies HF, Tang KC, et al. Sensitisation to swine leukocyte antigens in patients with broadly reactive HLA specific antibodies.
Am J Transplant. 2002; 2: 267–273.
26. Reyes LM, Estrada JL, Wang ZY, et al. Creating class I MHC-null pigs using guide RNA and the Cas9 endonuclease.
J Immunol. 2014; 193: 5751–5757.
