Journal Logo

Basic and Experimental Research

Optimal Time for Hypothermic Reconditioning of Liver Grafts by Venous Systemic Oxygen Persufflation in a Large Animal Model

Koetting, Martina1; Lüer, Bastian2; Efferz, Patrik2; Paul, Andreas1; Minor, Thomas2,3

Author Information
doi: 10.1097/TP.0b013e3181fed021
  • Free

Abstract

In face, of the increasing shortage of donor organs for clinical transplantation, the donor acceptance criteria for liver retrieval have been expanded toward inclusion of older donors and the use of “less than optimal” grafts.

Although the quality of cold-stored livers slowly declines beyond approximately 12 hr of ischemia and the risk of primary dys- or nonfunction steadily increases (1–3), up to 20% of all liver transplantations were performed after cold ischemia times of more than 12 hr (2, 4).

However, in most cases, it is not evident at the time of liver retrieval whether the graft is going to endure extended times of cold ischemia. Successful reperfusion of ischemic tissue pivotally depends on an adequate redox and intracellular signal homeostasis.

Previous studies have raised the concept to improve the outcome of marginally preserved organ grafts by post hoc reconditioning even after extended times of conventional cold storage (5, 6). Both techniques for temporary hypothermic oxygenation, oxygenated machine perfusion, or gaseous oxygen persufflation were later shown to be equally effective to improve ulterior recovery on reperfusion in small animals (7), supposedly because of a beneficial influence on the mitochondrial redox homeostasis during conditions of cold- induced metabolic retardation (8). Owing to its simplicity and ease of application, gaseous oxygen persufflation seems to be particularly convenient for treatment of the liver.

In the rat, 90 min of endischemic oxygen persufflation had been demonstrated to improve organ integrity on subsequent reperfusion of normal and fatty livers (7, 8). Because the method is mainly operative by diffusion processes across interstitial fluid/parenchymal tissue and actual distances between oxygen-filled pathways, increase in proportion to organ size (9), restoration of redox homeostasis, and cellular ion balance by venous systemic oxygen persufflation (VSOP) might be a phenomenon, subject to different time courses in small or large organs. It is thus difficult to delineate the optimal persufflation time in larger organs.

The present investigations were aimed to clarify in a controlled large animal experimental setting to which extent short-term gaseous oxygen persufflation actually works to improve liver quality after long-term preservation and to which extent the physical properties of a larger organ affect the temporal kinetics to achieve an optimal effect.

RESULTS

Energetic Recovery During Hypothermic Reconditioning

Metabolic efficiency of hypothermic reconditioning (HR) was monitored by restoration of tissue levels of ATP at the end of ischemic preservation and varying times of subsequent VSOP (Fig. 1). It is seen that already 1 hr of HR led to a significant rise in liver ATP, which was further improved by 2 hr of HR. No notable additional effect could be evidenced by extending the reconditioning time to 3 hr.

FIGURE 1.
FIGURE 1.:
Tissue concentrations of ATP in livers at the end of cold storage for 18 hr (untreated) and after additional periods of hypothermic reconditioning (HR) for 1, 2, or 3 hr of HR. Values are mean±standard error of the mean of n=6 experiments per group (*P<0.05 vs. untreated). For comparison: normal values obtained from healthy livers in vivo amount to 7.9±0.6 μmol/g dry weight ATP.

It is to note that the extend of ATP replenishment provided by 2 hr of HR in the pig livers corresponded well to the effect seen in human livers, where 1 to 2 hr of oxygen persufflation after a mean preservation time of 12 hr resulted in an increase of liver ATP concentrations from 1.06±0.32 to 3.27±0.47 (partly taken from Ref. 10).

Liver Viability in Relation to the Time of HR

Liver enzymes were measured in serum samples taken at different time points during reperfusion and taken as a general indicator of hepatocellular injury (Fig. 2). Serum activities of aspartate aminotransferase were found elevated in the untreated group, and a progressive rise in enzyme leakage was observed during ongoing reperfusion. HR did result in a notable net reduction of hepatic enzyme loss, which was significant already after 1 hr of HR and maximal after 2 hr.

FIGURE 2.
FIGURE 2.:
Impact of increasing periods of additional hypothermic reconditioning (HR) by vascular oxygen persufflation on parenchymal release of aspartate aminotransferase (AST) during 120 min of normothermic reperfusion after 18 hr of cold storage (untreated) or after 18 hr of cold storage+additional HR for 1, 2, or 3 hr. Values are mean±standard error of the mean of n=6 experiments per group (*P<0.05 vs. untreated). The normal range for alanine transferase release, obtained from perfusion of nonischemic livers with this model, is represented by the gray area, for comparison.

Similar results were also found with respect to the hepatic loss of lactate dehydrogenase, maximal values of which amounted to 1512±84, 908±109*, 825±70*, and 1017±101* U/L/g (untreated vs. HR1 vs. HR2 vs. HR3, respectively; *P< 0.05 vs. untreated).

Likewise, parenchymal function of the grafts was gradually influenced by HR. Cumulative production of bile juice, synthesis of cholinesterase, and mean hepatic oxygen consumption during 120 min of reperfusion were significantly increased by 2 to 3 hr of preceding oxygen persufflation, whereas this effect was less consistent after only 1 hr out of treatment (Fig. 3a–c).

FIGURE 3.
FIGURE 3.:
Functional recovery on normothermic reperfusion after 18 hr of cold storage (untreated) or after 18 hr of cold storage+additional hypothermic reconditioning (HR) for 1, 2, or 3 hr. (a) Bile production, (b) production of cholinesterase, and (c) oxygen consumption. Values are mean±standard error of the mean of n=6 experiments per group (*P<0.05 vs. untreated). The normal range for the respective parameters, obtained from perfusion of nonischemic livers with this model, is represented by the gray area, for comparison.

With respect to these parameters, it was seen that maximal protection of the graft is achieved by 2 hr of reconditioning. Extension of the persufflation time beyond 2 hr did not add to the therapeutic effect. Therefore, we choose 2 hr of HR as the standard protocol for further investigations.

HR Improves Vascular Perfusion After Cold Storage

Elevated vascular resistance was observed in the portal and the arterial system on reperfusion of untreated cold-stored livers (Fig. 4). After a short period of postischemic reactive arterial hyper-perfusion in both groups, an abnormal fall in arterial vascular perfusion was seen in untreated livers but was prevented by HR. Postischemic vascular resistance on flow-constant perfusion of the portal vein was also increased in untreated livers but significantly normalized by HR.

FIGURE 4.
FIGURE 4.:
Hepatic arterial (upper curve) and portal veinous (lower curve) vascular perfusion resistance after 18 hr of cold storage without (untreated) or with additional 2 hr of hypothermic reconditioning (HR). Values are mean±standard error of the mean of n=6 experiments per group (*P<0.05 vs. untreated). The normal range for the respective parameters, obtained from perfusion of nonischemic livers with this model, is represented by the gray area, for comparison.

HR Reduces Postischemic Inflammatory Response in Liver Grafts

Proinflammatory response to preservation injury was evaluated by the release of tumor necrosis factor (TNF)-α into the circulation and was thus found to be significantly alleviated by the reconditioning protocol (Table 1). Cellular surface activation and innate immune response Toll-like receptor (TLR)-4 could also be mitigated by oxygen persufflation, resulting in significantly reduced expression of TLR-4 in the liver tissue at 120-min postreperfusion and a trend for lower expression of von Willebrand factor (vWF) in reconditioned versus untreated grafts. The almost 50% reduction of vWF obtained by oxygen persufflation, however, did not reach statistical significance (P=0.13).

TABLE 1
TABLE 1:
Proinflammatory response and cellular activation on 120 min of reperfusion after 18 hr of cold preservation without (untreated) or with additional 2 hr of hypothermic reconditioning

Additional evidence for a beneficial effect of HR on vascular surface activation is seen in the fact that trapping of thrombocytes in the reperfused graft was significantly reduced in the HR-group when compared with untreated livers (compare with Table 1).

The impact of oxygen persufflation on free radical- induced tissue alterations was approximated by fluorimetric detection of lipid peroxidation (LPO) in deproteinized liver homogenates. Actually, it is seen that tissue LPO at the end of reperfusion was similar in untreated livers and in grafts subjected to HR (16.4±3.1 nmol/g vs. 10.2±3.8 nmol/g, respectively; P>0.05).

Influence of HR on Hepatocellular Tissue Integrity

In line with the data on hepatocellular enzyme loss, hematoxylin-eosin histopathology after reperfusion of untreated grafts revealed moderate liver injury, which was characterized by partial disruption of the general architecture, vacuolization, and disrupted cell and organelle membranes (score 1.83±0.13). HR resulted in less severe alterations and exhibited better preserved hepatic morphology. Score values for necrotic tissue injury were thus reduced by 2 hr of HR to 0.99±0.30 (P<0.05 vs. untreated).

DISCUSSION

The main objective of this study was to establish evidence for the effectiveness of vascular oxygen persufflation for short-term reconditioning of large size organ grafts after ischemic preservation.

Because of the biophysical mechanisms of gaseous oxygen persufflation (9), it is arbitrary to extrapolate the optimal duration of persufflation from rat livers to larger size organs. Because temporal kinetics of diffusion driven tissue conditioning might be influenced by the size of the organ, extrapolation from rat liver experiments are subject to underestimate the necessary application time in larger grafts. Therefore, an additional focus was spent on the influence of different persufflation times on early graft function on reperfusion. It was found that already 1 hr of oxygen persufflation resulted in a notable amelioration of consecutive liver recovery, but the effect was most consistent after 2 hr of oxygen persufflation. Most importantly, further extension of the reconditioning time did not result in any additional improvement. Thus, the optimal time protocol for gaseous liver reconditioning does not differ significantly from previous results in rats (8) and lies within the limits of clinical applicability in the pretransplant setting. Moreover, the metabolic effect of 2 hr of HR on tissue energetics seemed to be comparable in porcine and human livers, suggesting that the results of this study are likely to be relevant to the clinical situation.

Cold ischemia is accompanied by an extensive decline of cellular energy resources as seen by the depletion of ATP tissue concentrations (11, 12), which sensitizes hepatocytes to rewarming and reperfusion injury (12). Resynthesis of high-energy nucleotides by oxygenated perfusion before transplantation has hence been seen as major cause for improved resilience against rewarming injury (5, 12). The enhancement of endischemic ATP concentrations, which are actually increased also by VSOP (7, 10), might however be rather a readout for improved mitochondrial redox and signal homeostasis than the pivotal beneficial aspect of hypothermic oxygenation before reperfusion (7).

Recent evidences suggest proteolytic degradation of autophagy regulatory proteins to be responsible for impaired mitochondrial function and subsequent hepatocyte death on anoxia/reoxygenation. Autophagy normally occurs at low rates in cells to perform homeostatic functions such as lysosomal degradation of defective proteins, injured organelles, or depolarized mitochondria. Ischemic injury to isolated hepatocytes has been shown to depress hepatocellular autophagy and that this lack of autophagic clearance is causative for postischemic cell death (13). Interestingly, postischemic loss of autophagy can be prevented in rat livers by 90 min of oxygen persufflation (8). From this, an improved functioning of the cellular quality control systems and enhanced mitochondrial function can be expected (13). Through restoration of mitochondrial integrity and consecutively improved energy replenishment on warm reperfusion oxygen persufflation is conjectured to counteract tissue necrosis.

Another major factor compromising postpreservation recovery of liver grafts has been shown to be impaired vascular conductivity, leading to impaired vascular reflow and eventually deteriorating graft integrity as a result of insufficient oxygenation (14–16).

Impaired vascular perfusion was corroborated in this study by increased portal perfusion resistance and reduced arterial flow rates, both of which were significantly improved by preceding oxygen persufflation. Better and earlier resumption of normal cellular function because of improved provision and substrates and oxygen to postischemic tissue will have contributed to the overall enhanced parenchymal recovery after oxygen persufflation. Notably, the recovery of tissue levels of energy-rich phosphates after revascularization has generally been acknowledged as a primary predictor of organ viability after ischemic preservation (17, 18).

Hepatic ischemia-reperfusion induces platelet-endothelial cell interactions in arterioles, sinusoids, and venules already during early reperfusion. Cold preservation of sinusoidal lining cells results in increased platelet adhesion and platelet activation (19). Adherent platelets seem to participate in the development of sinusoidal perfusion failure in the postischemic liver (20), and the degree of platelet adhesion is an important determinant in assessing outcome of liver transplants in human (21).

It has already been shown that VSOP significantly enhances ultrastructural integrity of hepatic endothelium on reperfusion (22), putatively by providing energetic support before resumption of shear stress during reflow. In this study, it was furthermore disclosed that trapping of platelets in the liver graft during the experiments was significantly reduced after HR compared with the untreated group.

Down-regulation of cellular surface activation by HR was also translated by the mitigation of TLR-4 expression. Activation of TLR-4, one of a subset of pattern recognition receptors that recognize danger-associated molecular patterns, is known to trigger a cellular injury cascade in response to ischemia-reperfusion (23). This may lead to the activation of cellular responses that are known to regulate the innate immune response (24). and to the production of TNF-α by sinusoidal endothelial cells (25). The importance of TLR-4 signaling in the donor organ for ischemia and reperfusion injury sequel after liver transplantation has recently been demonstrated in a murine knockout model (26).

The concept of HR is not confined to the technique of gaseous oxygen persufflation. Oxygenated machine perfusion seems to promote comparable protection in rat livers (7), by mechanisms, presumably relating to improvement of mitochondrial redox state rather than depending on energetic support or nutritive stimulation (27). More recently, 1 hr of hypothermic oxygenated perfusion has even been shown to improve hepatic primary function after transplantation of pig livers, retrieved after cardiac death of the donor animal (28). In comparison with machine perfusion, already proven effective in a clinical pilot study (29), gaseous oxygen persufflation recommends itself as simple and less cost-intensive alternative

In conclusion, the results of this study discloses a useful method to regenerate cellular energy-dependent pathways under conditions of relatively low metabolic workload, being operative to suppress injurious cellular activation cascades on early reperfusion likely to augment postischemic recovery of long-preserved liver grafts. Two hours of “a posteriori” treatment provide the maximal effect and are recommended for further investigations.

MATERIALS AND METHODS

All experiments were performed in accordance with the federal law regarding the protection of animals.

Twenty four female German Landrace pigs, weighing between 25 and 30 kg were premedicated with ketamine (90 mg/kg), xylazine (10 mg/kg), and atropine (10 μg/kg) administered intramuscularly 10 min before induction of anesthesia. General anesthesia was induced by midazolam (0.5 mg/kg), pancuronium (0.2 mg/kg), and fentanyl (12.5 μg/kg) administered intravenously and maintained after intubation by mechanical ventilation with isoflurane in air/oxygen.

Under general anesthesia, the liver was dissected free and then perfused by gravity (60 cm H2O) through the portal vein with 3 L of histidine-tryptophan-ketoglutarate (HTK) preservation solution at 4°C. Livers were then excised, the hepatic artery was flushed on the backtable with additional 100 mL of HTK, and the graft was stored overnight in HTK for 18 hr.

After static cold storage at 4°C, the grafts were randomly used for the experiments without further treatment (untreated) or subsequently subjected to varying times of HR. This consisted of 1, 2, or 3 hr of VSOP as detailed previously (10, 30). During oxygen persufflation, the liver is left continuously placed immerged in cold preservation solution in a beaker; a catheter that is needed for oxygen influx, is fixed with a purse string suture in the suprahepatic vena cava. The caudal caval vein was closed with a bulldog clamp. Medical grade gaseous oxygen was filtered and insufflated by the caval catheter at a pressure limited to 18 mm Hg. Using a small (27 gauge) syringe needle, 2 to 3 small pinpricks were set into the dilated postsinusoidal venules at the margin of each liver lobe that allow the gas to leave the microvasculature.

Isolated Liver Perfusion Model

Immediately before reperfusion, all organs were exposed to no flow conditions at room temperature for 30 min to simulate the period of slow rewarming of the graft during surgical implantation in vivo (31).

Graft integrity was tested thereafter by isolated reperfusion in vitro through portal vein and hepatic artery in a recirculation system for 120 min. The perfusion medium consisted of heparinized autologous blood retrieved from the donor during the organ recovery operation, preserved overnight in commercial whole blood bags. The blood was diluted with freshly prepared Williams E solution to a hematocrit of 20% before the experiment.

Livers were placed in a moist temperature chamber and perfused at 38°C. Circulating blood was oxygenated in a temperature-controlled hollow fiber oxygenator with Carmedia plasma resistant bioactive surface (Minimax Plus; Medtronic Inc., Minneapolis, MN). Gas flow to the oxygenator (air, oxygen, and CO2) was differentially regulated to achieve physiological blood gas values (pO2 ∼150–200 mm Hg; pCO2 ∼30–50 mm Hg). Temperature was regulated by a circulating thermostat, connected to perfusion chamber and oxygenator.

Hepatic artery perfusion pressure was set at 80 mm Hg and automatically maintained by servo-controlled roller pump, connected to a pressure sensor placed in the inflow line immediately before the arterial cannula.

Perfusion of the portal vein was performed in a flow-constant manner (1 mL/g/min) driven by a centrifugal blood pump (Bio-Pump BP-50; Medtronic Inc.), whereas portal venous pressure was recorded using a water column connected to the inflow tract (32). Erythrocyte count and hemoglobine values remained unchanged during liver perfusion over the whole 120 min of investigation. Baseline values immanent to the experimental model were obtained from four livers that were reperfused immediately after procurement without ischemic preservation.

Hepatic oxygen consumption (mL/100 g/min) was calculated from arterial, portal, and hepatic venous oxygen saturations, total hemoglobine, and oxygen partial pressures using the following equation, taking into account the respective flow rates and liver mass:

with SaO2, SpO2 and ScO2 oxygen saturations (%) in hepatic artery, portal vein, and caval vein, respectively; Hb is total hemoglobin (g/dL); ApO2, PpO2 and CpO2 oxygen pressure (mm Hg) in hepatic artery, portal vein, and caval vein, respectively; Qa and Qp are arterial and portal blood flow (mL/min), respectively; and LW is liver weight (g).

Serum enzyme activities of aspartate aminotransferase, lactate dehydrogenase, and cholinesterase were assessed photometrically, using commercialized standard kits (Fa. Roche, Mannheim, FRG).

Serum concentrations of TNF-α were analyzed at the end of the experiments using a pig-reactive ELISA test kit on a fluorescence microplate reader (Tecan, Grailsheim, Germany), according to the instructions of the manufacturer (R&D Systems, Wiesbaden, Germany).

Oxygen free radical-induced tissue injury was approximated by the degree of LPO in the tissue at the end of reperfusion. LPO was evaluated by fluorimetry from deproteinized liver samples using the adduct formation with thiobarbituric acid as detailed elsewhere (33).

Vascular Resistance

Hepatic arterial and portal vascular perfusion resistance was calculated from independently measured flow and pressure values, normalized to liver mass and expressed in mm Hg/L/min/100 g.

Bile Production

The common bile duct of the livers was cannulated with polyethylene tubing. Bile was collected during the whole reperfusion period, and hepatic bile production was calculated as mL/kg/hr.

Tissue Extraction and Assay of High Energy Phosphates

Tissue specimen for assessment of energetic status after reperfusion was taken with precooled steel tongs, immersed in liquid nitrogen and stored at −80°C until later analysis. For analysis of endischemic tissue ATP after varying times of persufflation, additional experiments were performed without reperfusion. In these experiments, two samples per liver were taken from different parts of the liver, always avoiding proximity to the pin pricks.

High-energy phosphates were determined enzymatically in the neutralized supernatant after protein extraction with perchloric acid of freeze-dried tissue samples as described elsewhere (7). The results were corrected for the respective dry weight to wet weight ratio of the tissue samples and expressed as μmol/g dry weight.

Reverse-Transcriptase Polymerase Chain Reaction Analysis

Total RNA was isolated from snap-frozen samples using TRI reagent (Applied Biosystems, Darmstadt, Germany). Equal amounts of RNA were quantified by Nano Drop (Fisher Scientific, Schwerte, Germany) complementary DNA by incubation with High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). The polymerase chain reaction mix was prepared by using TaqMan GenEx Master Mix (Applied Biosystems). The amount of specific mRNA in the tissue was expressed in arbitrary units after normalization for the respective individual quantities of transcripts of glyceraldehyde phosphate dehydrogenase, which was analyzed as housekeeping gene. Primers for glyceraldehyde phosphate dehydrogenase (TaqMan Gene Expression Assay noSs03375435_u1) and TLR-4 (n°Ss03389780_m1) were purchased from Applied Biosystems.

Sequences of the polymerase chain reaction primers for vWF, customized by Applied Biosystems, were as follows: sense, ACTACGACCTGGAGTGTGTGA and antisense, CTGTTCTCATGCCGGACCAT.

Histology

Liver tissue was collected at the conclusion of the experiments, cut into small blocks (3-mm thickness), and fixed by immersion in 4% buffered formalin. The blocks were embedded in paraffin and cut into 2-μm sections using a microtome. Hematoxylin-eosin staining was used to judge morphological integrity of the parenchyma. Sections were examined at 200× magnification and the extent of necrosis graded semiquantitatively from 0 (no necrosis) to 3 (severe necrosis with disintegration of hepatic cords) as described elsewhere (34), in a blinded fashion by two independent investigators.

Statistics

All values were expressed as means±standard error of the mean of n=6 animals per group. After proving the assumption of normality and equal variance across groups, differences among groups were tested by analysis of variance followed by the Student-Newman-Keuls test or Student's t test where appropriate. Statistical significance was set at P less than 0.05.

REFERENCES

1.Pokorny H, Langer F, Herkner H, et al. Influence of cumulative number of marginal donor criteria on primary organ dysfunction in liver recipients. Clin Transplant 2005; 19: 532.
2.Moore DE, Feurer ID, Speroff T, et al. Impact of donor, technical, and recipient risk factors on survival and quality of life after liver transplantation. Arch Surg 2005; 140: 273.
3.Adam R, Bismuth H, Diamond T, et al. Effect of extended cold ischaemia with UW solution on graft function after liver transplantation. Lancet 1992; 340: 1373.
4.Burroughs AK, Sabin CA, Rolles K, et al. 3-month and 12-month mortality after first liver transplant in adults in Europe: Predictive models for outcome. Lancet 2006; 367: 225.
5.Fuller BJ, Busza AL, Proctor E. Possible resuscitation of liver function by hypothermic reperfusion in vitro after prolonged (24-hour) cold preservation—A 31P NMR study. Transplantation 1990; 50: 511.
6.Minor T, Saad S, Koetting M, et al. Endischemic oxygen persufflation to improve viability of marginally preserved donor livers. Transpl Int 1998; 11: S400.
7.Stegemann J, Minor T. Energy charge restoration, mitochondrial protection and reversal of preservation induced liver injury by hypothermic oxygenation prior to reperfusion. Cryobiology 2009; 58: 331.
8.Minor T, Stegemann J, Hirner A, et al. Impaired autophagic clearance after cold preservation of fatty livers correlates with tissue necrosis upon reperfusion and is reversed by hypothermic reconditioning. Liver Transpl 2009; 15: 798.
9.Minor T, Klauke H, Vollmar B, et al. Biophysical aspects of liver aeration by vascular persufflation with gaseous oxygen. Transplantation 1997; 63: 1843.
10.Treckmann J, Minor T, Saad S, et al. Retrograde oxygen persufflation preservation of human livers: A pilot study. Liver Transpl 2008; 14: 358.
11.Harvey PRC, Iu S, McKeown CMB, et al. Adenine nucleotide tissue concentrations and liver allograft viability after cold preservation and warm ischemia. Transplantation 1988; 45: 1016.
12.Vajdova K, Smrekova R, Mislanova C, et al. Cold-preservation- induced sensitivity of rat hepatocyte function to rewarming injury and its prevention by short-term reperfusion. Hepatology 2000; 32: 289.
13.Kim JS, NItta T, Mohuczy D, et al. Impaired autophagy: A mechanism of mitochondrial dysfunction in anoxic rat hepatocytes. Hepatology 2008; 47: 1725.
14.Puhl G, Schaser KD, Pust D, et al. Initial hepatic microcirculation correlates with early graft function in human orthotopic liver transplantation. Liver Transpl 2005; 11: 555.
15.McKeown CMB, Edwards V, Philips MJ, et al. Sinusoidal lining cell damage: The critical injury in cold preservation of liver allografts in the rat. Transplantation 1988; 46: 178.
16.Minor T, Tolba R, Neumann S, et al. Fibrinolysis in organ procurement for transplantation after cardiocirculatory compromise. Thromb Haemost 2003; 90: 361.
17.Starzl TE, Demetris AJ, VanThiel D. Liver transplantation. N Engl J Med 1989; 321: 1014.
18.Sumimoto K, Inagaki K, Yamada K, et al. Reliable indices for the determination of viability of grafted liver immediately after orthotopic transplantation. Bile flow rate and cellular adenosine triphosphate level. Transplantation 1988; 46: 506.
19.Upadhya GA, Strasberg SM. Platelet adherence to isolated rat hepatic sinusoidal endothelial cells after cold preservation. Transplantation 2002; 73: 1764.
20.Khandoga A, Biberthaler P, Messmer K, et al. Platelet-endothelial cell interactions during hepatic ischemia-reperfusion in vivo: A systematic analysis. Microvasc Res 2003; 65: 71.
21.Cywes R, Mullen JB, Stratis MA, et al. Prediction of the outcome of transplantation in man by platelet adherence in donor liver allografts. Evidence of the importance of prepreservation injury. Transplantation 1993; 56: 316.
22.Minor T, Akbar S, Tolba R, et al. Cold preservation of fatty liver grafts: Prevention of functional and ultrastructural impairments by venous oxygen persufflation. J Hepatol 2000; 32: 105.
23.Tsuchihashi S, Zhai Y, Fondevila C, et al. HO-1 upregulation suppresses type 1 IFN pathway in hepatic ischemia/reperfusion injury. Transplant Proc 2005; 37: 1677.
24.Daun JM, Fenton MJ. Interleukin-1/Toll receptor family members: Receptor structure and signal transduction pathways. J Interferon Cytokine Res 2000; 20: 843.
25.Wu J, Meng Z, Jiang M, et al. Toll-like receptor-induced innate immune responses in non-parenchymal liver cells are cell type-specific. Immunology 2010; 129: 363.
26.Shen XD, Ke B, Zhai Y, et al. Absence of toll-like receptor 4 (TLR4) signaling in the donor organ reduces ischemia and reperfusion injury in a murine liver transplantation model. Liver Transpl 2007; 13: 1435.
27.Manekeller S, Minor T. Possibility of conditioning predamaged grafts after cold storage: Influences of oxygen and nutritive stimulation. Transpl Int 2006; 19: 667.
28.de Rougemont O, Breitenstein S, Leskosek B, et al. One hour hypothermic oxygenated perfusion (HOPE) protects nonviable liver allografts donated after cardiac death. Ann Surg 2009; 250: 674.
29.Guarrera JV, Henry SD, Samstein B, et al. Hypothermic machine preservation in human liver transplantation: The first clinical series. Am J Transplant 2010; 10: 372.
30.Minor T, Saad S, Nagelschmidt M, et al. Successful transplantation of porcine livers after warm ischemic insult in situ and cold preservation including postconditioning with gaseous oxygen. Transplantation 1998; 65: 1262.
31.Minor T, Yamaguchi T, Isselhard W. Effects of taurine on liver preservation in UW solution with consecutive ischemic rewarming in the isolated perfused rat liver. Transpl Int 1995; 8: 174.
32.Minor T, Manekeller S. Assessment of hepatic integrity after ischemic preservation by isolated perfusion in vitro: the role of albumin. Cryobiology 2007; 54: 188.
33.Minor T, Koetting M. Gaseous oxygen for hypothermic preservation of predamaged liver grafts: Fuel to cellular homeostasis or radical tissue alteration? Cryobiology 2000; 40: 182.
34.Camargo CA Jr, Madden JF, Gao W, et al. Interleukin-6 protects liver against warm ischemia/reperfusion injury and promotes hepatocyte proliferation in the rodent. Hepatology 1997; 26: 1513.
Keywords:

Oxygen; Persufflation; Reconditioning

© 2011 Lippincott Williams & Wilkins, Inc.