Secondary Logo

Share this article on:

Immunosuppressive Effects of Mesenchymal Stem Cells: Involvement of HLA-G

Nasef, Aisha1; Mathieu, Noelle2; Chapel, Alain2; Frick, Johanna2; François, Sabine2; Mazurier, Christelle1; Boutarfa, Asma2; Bouchet, Sandrine1; Gorin, N-Claude1; Thierry, Dominique2; Fouillard, Loïc1,3

doi: 10.1097/01.tp.0000267918.07906.08
Original Articles: Immunobiology and Genomics

Introduction. Mesenchymal stem cells (MSCs) possess unique immunomodulatory properties. They are able to suppress allogenic T-cell response and modify maturation of antigen-presenting cells. Their role in the treatment of severe graft versus host disease has been reported. The underlying molecular mechanisms of immunosuppression are currently being investigated. Histocompatibility locus antigen (HLA)-G is a nonclassical major histocompatibility complex class I antigen with strong immune-inhibitory properties.

Methods. We studied the role of HLA-G on MSC-induced immunosuppression. The expression of HLA-G on human MSCs cultured alone and in mixed lymphocytes reaction (MSC/MLR) was analyzed.

Results. We found that HLA-G can be detected on MSCs by real-time reverse-phase polymerase chain reaction, immunofluorescence, flow cytometry (52.4±3.6%), and enzyme-linked immunosorbent assay in the supernatant (38.7±5.2 ng/mL). HLA-G protein expression is constitutive and the level is not modified upon stimulation by allogenic lymphocytes in MSC/MLR. The functional role of HLA-G protein expressed by MSCs was analyzed using the 87G anti-HLA-G blocking antibody in a MSC/MLR. We found that blocking HLA-G molecule significantly raised lymphocyte proliferation in MSC/MLR (35.5%, P=0.01).

Conclusion. Our findings provide evidences supporting involvement of HLA-G in the immunosuppressive properties of MSCs. These results emphasize the potential application of MSCs as a relevant therapeutic candidate in transplantation.

1 Inserm, U832, Université Pierre et Marie Curie-Paris6, Paris, France.

2 Laboratory of Cell Therapy and Radioprotection of Accidents DRPH/SRBE/LTCRA, Cedex, France.

Supported by grants from the “Comité de Radioprotection, EDF” and EEC IP FIRST No.: LSHC-CT-2004-503436.

A.N. and N.M. contributed equally to this work.

3 Address correspondence to: Loïc Fouillard, M.D., Ph.D., EA1638 Hematology and Cellular Therapy Department, Faculty of Medicine Saint Antoine, Université Paris VI, 27 rue de Chaligny, 75012 Paris, France.

E-mail: loic.fouillard@sat.aphp.fr

Received 12 February 2007. Revision requested 21 March 2007.

Accepted 11 April 2007.

Experimental evidence and preliminary clinical studies have demonstrated that human bone marrow stromal cells, referred as mesenchymal stem cells (MSCs), have an important immunomodulatory function in the management of allogeneic hematopoietic stem cell (HSC) transplantation (1). Injection of MSCs could cure severe graft versus host disease (GVHD) (2, 3) and promote hematopoietic recovery (4, 5). Furthermore, MSC injection in immunocompetent baboons prolonged skin allograft survival (6).

MSC-mediated inhibition of immune response is a complex mechanism that involves changes in the maturation of antigen-presenting cells (7) as well as suppression of differentiation and function of monocyte derived dendritic cells (DCs) (8). Furthermore, MSCs altered the cytokine secretion profile of naïve DC, effector T cells, and natural killer cells (NKs) and modified the proinflammatory TH1 profile towards TH2 anti-inflammatory profile. These properties could be useful for the prevention and treatment of GVHD and the inhibition of graft rejection (9).

MSCs exert profound immunosuppression by inhibiting T-cell proliferation in response to various stimuli in vitro (10). They induce regulatory immunosuppressive lymphocytes (9) and CD8 apoptosis (11). MSCs inhibit cell cycle progression (12) and CD4 allo-proliferation (10). This immunosuppressive effect of MSCs is mediated through several inducible soluble factors, such as transforming growth factor-β) (10), hepatocyte growth factor (10), interleukin-10 (IL-10) (7), prostaglandin E2 (PGE2) (9), and indoleamine 2,3-dioxygenase (IDO) (13). In these studies, a partial reversion of the MSC inhibitory effect on T-cell proliferation was demonstrated.

Natural processes allow fetal allografts to evade from rejection by the mother. This phenomenon is partially dependant on histocompatibility locus antigen (HLA)-G molecules (14). HLA-G is a nonclassical major histocompatibility complex (MHC) class I, which is expressed in both membrane-bound and soluble isoforms. Both of them can display tolerogenic properties via interaction with inhibitory receptors on DC, NK, and T cells. Soluble HLA-G exerts an immunosuppressive effect by inducing apoptosis of CD8+ T cells and down modulating CD4+ T cells proliferation. Membrane-bound HLA-G protein has been shown to inhibit NK cells and T cell-mediated cytolysis, to suppress proliferation of allo- specific CD4+ T lymphocytes and to induce TH2 cytokine profile. For review, see (15). Furthermore, a good correlation between HLA-G expression and graft acceptance has been evidenced (16).

Production of HLA-G protein by adult MSCs had never been demonstrated. We investigated whether HLA-G was expressed by MSCs and contributed to MSC-mediated inhibition of immune response in vitro. We report here that MSCs express HLA-G protein and demonstrate that HLA-G is involved in MSC-mediated lymphocytes proliferation inhibition.

Back to Top | Article Outline

MATERIALS AND METHODS

Isolation and Culture of Human Bone Marrow (BM) MSCs

BM cells were obtained after informed consent of patients undergoing total hip replacement surgery and were used in accordance with the procedures approved by the human experimentation and ethic committees of Hospital St Antoine (France). Ten to twenty milliliters of BM were harvested in α-minimum essential medium (MEM; Invitrogen, Cergy, France) supplemented with heparin. Total cells were isolated from bone fragments after two rounds of mechanical extraction/sedimentation. The recovered cells were centrifuged and resuspended in culture medium. Nucleated cells were counted after red cells lysis by acetic acid. Then, the nucleated cells were plated at 50,000 cells/cm2 in α-MEM supplemented with 10% fetal calf serum (research- grade FCS, Hyclone, Perbio, France), 1% L-glutamine, 1% penicillin streptomycin, and 1 ng/mL betaFGF (Sigma, France) referred as FCS-αMEM. FCS-αMEM corresponds to the culture techniques used in clinics (17). To study the importance of culture conditions for HLA-G protein expression, α-MEM medium supplemented with platelet lysat from platelet-rich plasma (PRP-αMEM) was used in comparison with FCS-αMEM. For the culture in PRP-αMEM, the cells were plated at 2.105 cells/cm2 in α-MEM, 1% L-glutamine, 1% penicillin streptomycin, heparin 2U/mL, and 5% of platelet lysat from PRP as previously published (18). Culture flasks were incubated at 37°C with 5% CO2 in humidified atmosphere. After 72 hr, nonadherent cells were removed, and the medium was replaced twice a week until the 90% of confluence was reached. Then, cells were detached using 0.25% trypsin (Stem Cell Technologies), and passaged up to passage 4 (P4). The cells were characterized by phenotypic analysis, and ability to differentiate into adipocytic, chondrocytic and osteocytic lineages as previously described (19).

Back to Top | Article Outline

Antibodies, Flow Cytometry, and Enzyme-Linked Immunosorbent Assay (ELISA)

At each passage, the cells were characterized using monoclonal antibodies specific for CD105 (SEROTEC, France), CD73 (BD Pharmingen, France), and CD45 (Beckman Coulter, France) conjugated with FITC, PE, and PC5, respectively. Acquisitions and data analysis were performed using the flow cytometer FACScalibur (BD Biosciences) and CELLquest software (Becton Dickinson). For HLA-G analysis we used the mouse anti HLA-G1/G5 MEMG/9 FITC antibody (Exbio, Praha, Czech Republic) at 1/500 final concentration. For all analysis isotypic controls were systematically included. Intracellular staining was performed using the Cytofix/cytoperm kit (BD Biosciences) according to the recommended conditions. To detect soluble HLA-G molecule in culture supernatant we performed an ELISA coated with the same MEMG/9 antibody, according to the manufacturer’s instructions (Exbio, Praha, Czech Republic). Functional assessment of HLA-G activity was performed using (87 G) anti HLA-G blocking antibody (Exbio, Praha, Czech Republic, 10-437-C100).

Back to Top | Article Outline

Semiquantitative Real-Time Reverse Transcription-Polymerase Chain Reaction (RT-PCR)

Total RNA was prepared from MSCs using the Trizol method according to the manufacturer’s instructions (Invitrogen, Paisley, Scotland). A total of 1 μg of DNase treated RNA was transcribed into cDNA using 200 units of SuperScript II reverse transcriptase (Invitrogen, Groningen, Netherlands) and 150 ng of random primers (Invitrogen). PCRs were performed in duplicate using the SYBR green Master Mix according to the manufacturer’s instructions (Applera, Foster City CA USA). GAPDH (glyceraldehyde-3-phosphate dehydrogenase, access number NM002046) was used as a reference gene. GAPDH gene forward GAAGGTGAAGGTCGGAGTC and reverse primer GAAGATGGTGATGGGATTTC and HLA-G genes (access number X17273) forward primer ACCATCCCCATCAGGTATC and reverse primer ACCGCAGCTCCAGTGACTACA were designed on Primer Express™ software (Applera). Primers sequences were checked for theoretical target genes specificity on BLAST2. The specificity of PCR products was checked with melting temperature dissociation software (Applera). We used universal RNA control (Clontech Universal Reference Total RNA, Clontech) to prepare standard curve. Then sample quantity is determined from the standard curve. We calculated the average of HLA-G value from six healthy donors in duplicate using equation of standard curve.

Back to Top | Article Outline

Immunofluorescence

MSCs were cultured on Labtek chamber slide system (Nunc) up to 80% confluence. After three washes in phosphate-buffered saline 1×, the cells were fixed for 20 min in 4% paraformaldehyde. Permeabilization and blocking were done with 0.3% Triton X-100, 1% BSA, and 10% SVF in phosphate-buffered saline 1× during 45 min at room temperature. MSCs and positive control were incubated with the 87G (Exbio, Praha, Czech Republic) primary antibody (1/50) in 300 μL of the same buffer without Triton X-100 for 4 hr at room temperature. After washing, cells were incubated with the secondary fluorescent antibody diluted at 1/100 for 1 hr. To visualize nuclei, slides were mounted with 10 μl DAPI anti fading and visualized on microscope.

Back to Top | Article Outline

Peripheral Blood Mononuclear Cells (PBMCs) Proliferation Assay

Human PBMCs from two different donors were isolated from heparinized blood by gradient centrifugation on a Ficoll solution (density 1.077 g/mL, Biochrom, Germany) at 400g for 20 min at room temperature. Stimulator PBMCs were treated by mitomycin at 25 μg/mL for 30 min at 37°C (Sigma, Isle d’Abeau, France). Cell count and viability were assessed by trypan blue dye exclusion, and then used directly in mixed lymphocyte reaction (MLR).

Human MSCs were plated in triplicate at passage 2 onto U-bottomed 96-well plates at 105 cells/mL in 100 μL of FCS-αMEM and were allowed to adhere to the plate for 1 to 2 hr. Human respondor (105 PBMCs) and an equal number of stimulator PBMCs were added to wells in 100 μL of RPMI 1640 (Invitrogen, Cergy, France) 10% inactivated FCS (Sigma, France). Cultures were incubated at 37°C in 5% CO2 for 5 days and then pulsed with thymidine for the final 18 hr (1 μCi per well, Amersham Pharmacia). Thymidine incorporated in DNA was recovered on filters, counted, and expressed in count per minute. Donors are different for MSCs, respondor or stimulator PBMCs.

Back to Top | Article Outline

HLA-G Functional Assay

To test the ability of anti HLA-G blocking antibody (87G) to restore lymphocyte proliferation, the same procedures were followed with addition of 3 μg/well of 87G antibody (concentration of 1 mg/mL), as previously described (20), on the first day of the MSC/MLR cultures (9 MSC donors). We performed an antibody titration for optimal concentration at 3, 6, 9, and 12 μL per well. We confirmed that the dose of 3 μL was optimal and the upper doses (6, 9, 12 μl) did not increase the restoration.

Back to Top | Article Outline

Statistical Analysis

The statistical analysis was performed with the statistical package for the social sciences (SPSS Institute, Chicago, IL) version 10. Statistical significance was calculated using t test analyses. Significance was set at P<0.05 (*). All values were expressed as the mean and SEM (standard error of the mean). Twenty different MCS samples were used to evaluate the difference in the percentage of intracellular and membrane bound HLAG in MSC/MLR. As well, lymphocyte proliferation in the presence or absence of HLA-G blocking antibody was compared from nine individually acquired MSC samples. Finally, the percentage of HLA-G positive MSC was determined through up to four successive in vitro passages from six independent samples.

Back to Top | Article Outline

RESULTS

MSC Characteristics

Primary human MSCs were generated from adherent fraction of bone marrow of healthy donors. At each passage the percentage of CD105, CD73 and the absence of the hematopoietic marker CD45 were analyzed. At the end of the second passage MSCs were negative for hematopoietic antigens CD45 (0.96%) and they expressed antigens known to be present in MSCs: CD73 (80.45±6.27%) and CD105 (97.98± 5.5%). The immune suppressive properties of the studied populations were assayed in MLR. An inhibition of 56±4.5% of the PBMC proliferation was observed. We have also verified that MSCs retain their capacity to differentiate into adipocytic, osteoblastic and chondroblastic lineages, using adequate media (data not shown) as previously described (19).

Back to Top | Article Outline

MSCs Expression of the HLA-G Molecule

RT-PCR was used to analyze the expression of mRNA hla-g transcripts by MSCs. A total of 10 ng of total RNA of MSCs expressed 0.03±0.01 ng of HLA-G transcripts. To analyze the presence of HLA-G protein on MSCs, we used the specific 87G antibody, which recognizes the soluble and membrane-bound isoforms of the native molecule, and performed immunofluorescence. As shown in Figure 1A, HLA-G molecule was readily detectable on human MSCs. Figure 1B and 1C show positive (fetal tissue) (15) and negative control (isotype-matched mouse monoclonal antibodies), respectively.

FIGURE 1.

FIGURE 1.

Presence of HLA-G molecule on MSCs was quantified by flow cytometry using the specific MEMG/9 antibody on 16 different healthy donors. Extracellular and intracellular staining were used to study membrane-bound and intracytoplasmic HLA-G protein. A mean value of 52.4±3.6% of HLA-G- positive MSCs (Fig. 2A) was detected using intracellular staining. A low percentage of 13.7±1.3% HLA-G-positive MSCs (Fig. 2B) was detected using membrane-bound HLA-G staining. The immunostaining specificity was verified using lymphocytes from healthy donors as negative control; no extracellular or intracellular HLAG molecule was detected (data not shown).

FIGURE 2.

FIGURE 2.

To quantify soluble HLA-G in culture supernatants, we performed an ELISA on 14 different MSC donors using the same MEMG/9 antibody. A mean value of 38.7±5.2 ng/mL HLA-G proteins was detected in MSC culture supernatants. The expression of HLA-G varied with the length of culture:successive passage showed a decrease of HLA-G positive cells (Fig. 3).

FIGURE 3.

FIGURE 3.

Back to Top | Article Outline

Percentage of HLA-G-Positive MSCs and Culture Conditions

To test whether HLA-G production was dependant of the MSC culture conditions, a medium supplemented with platelet lysate obtained from PRP (PRP-α-MEM) was used (18) and compared with FCS-enriched medium (FCS-αMEM). Using flow cytometry, we found no difference in the percentages of MSCs expressing CD105 or CD73 antigens. In both culture conditions, intracellular HLA-G is readily detectable in a large percentage of the MSC population (Table 1). HLA-G membrane-bound molecule was found on a low percentage of both MSC-cultures. The percentage of intracellular HLA-G-positive cells is significantly higher in PRP-αMEM than in FCS-αMEM cultures, with a p value of 0.023 (Table 1).

TABLE 1

TABLE 1

Back to Top | Article Outline

HLA-G Molecule Is Implied in the Inhibition Induced by MSCs of Allogenic PBMC Proliferation

To test the role of HLA-G expressed by MSCs on lymphocyte proliferation, we analyzed the modifications in HLA-G expression in MSC/MLR as compared with MSC cultures alone. Flow cytometry experiments performed on MSCs from four different donors showed no statistical change in the percentages of membrane-bound or intracytoplasmic HLA-G-positive MSCs in MSC/MLR when compared with MSC cultures alone (Fig. 4A). In the same experimental conditions, no HLA-G-positive PBMC was detected in MLR (Fig. 4B). Soluble HLA-G in the supernatant of the cultures was quantified with ELISA. Results showed that the level of soluble HLA-G in supernatants of MSC/MLR culture was (40.6±7.1 ng/mL) and of MSC alone was (38.7±5.2 ng/mL). The difference between both types of cultures was not statistically significant (P=0.89). The level of soluble HLA-G detected by ELISA could be linked to the high percentage of intra-cellular HLA-G positive cells detected by flow cytometry.

FIGURE 4.

FIGURE 4.

No change in HLA-G production could be detected upon allogenic stimulation (MSC/MLR). However, the role of HLA-G as a possible mediator of MSC immunosuppressive effect cannot be excluded. To test the functional role of the HLA-G protein expressed by MSCs, the specific neutralizing antibody 87G was used in MSC/MLR (MSC/MLR+87G). Allogenic PBMC proliferation was taken as a reference of 100% proliferation. The mean percentage of PBMC proliferation was significantly greater in MSC/MLR+87 G (65.9±7%) when compared with MSC/MLR (44±4.5%, P=0.01, Fig. 5). The MSC induced inhibition of allogenic lymphocyte proliferation was alleviated by 87G antibody blockade with a mean value of 35.5%. These results suggest that HLA-G could be a novel T-cell inhibitory effector produced by human MSCs.

FIGURE 5.

FIGURE 5.

Back to Top | Article Outline

DISCUSSION

In this work, we studied the expression of the immunotolerogenic molecule HLA-G by MSCs and studied its implication toward the MSC immunosuppressive effects. We analyzed HLA-G expression at messenger RNA and protein level. This is the first report showing that human adult bone marrow MSCs express HLA-G as detected by RT-PCR, immunofluorescence, flow cytometry and ELISA.

Our results confirm the presence of hla-g transcripts in adult MSCs (21, 22). Gotherstrom et al. (22) have already reported detection of HLA-G protein by western blot in fetal MSCs, however not in adult MSCs. This later result differs from our report. This could be due to the differences in experimental design or culture conditions. Indeed in vitro we demonstrated (Table 1) that MSC culture in FCS-αMEM or in PRP-αMEM could induce significant differences in the percentage of HLA-G-positive MSCs.

Human MSCs are multipotent unspecialized cells with a capacity for self-renewal and differentiation into multiple cell lineages. These stem cell characteristics could explain the expression of HLA-G molecules, which is found on numerous fetal tissues such as cytotrophoblast, hematopoietic progenitors (23) and fetal MSCs (22). This is in accordance with our results. Indeed, a decrease of the number of HLA-G- positive cells was observed over time using intracellular staining. Whether the observed decrease is linked with senescence of the cell remains to be studied (24).

It has been shown that co-culture of nonhuman primate or human MSCs with peripheral blood lymphocytes from allogenic donors did not stimulate their proliferation in vitro (6, 25). This effect could be mediated through constitutive HLA-G expression by MSCs. Hereby, we demonstrated that, with two different antibodies (MEMG/9 and 87G), MSCs expressed constitutively the strong immune-inhibitory HLA-G molecule, which could explain the escape of immune recognition of MSCs by allogeneic peripheral blood lymphocytes.

MSCs can exert profound immunosuppression by inhibiting T-cell proliferation in response to various stimuli in vitro (10, 25). In vivo, injection of MSCs leads to prolonged allograft survival in non-human primate (6) and murine models (26). A possible mechanism to explain the MSC inhibitory effect was a veto cell-like activity (27). Indeed, in vitro veto cells inhibit CTL function against their own antigens, but not against third-party allogenic cells. This contrasts with reported inhibition of allogenic lymphocytes cytotoxicity and proliferation by MSCs (6, 10). A veto cell like activity is in agreement with the extensive data demonstrating engraftment and detection of MSCs (17, 28, 29) in various species. The constitutive expression of HLA-G by MSCs could support the veto cell-like activity, which plays an important role in their low immunogencity.

It has been shown that human MSCs in cultures can mediate suppression of lymphocytes proliferation by several secreted factors such as hepatocyte growth factor, transforming growth factor-β (10)and IL-10 (30). However blocking these factors with antibodies does not completely reverse the MSC-mediated immunosuppression. Recently, the role of tryptophan catabolizing enzyme IDO has been suggested to play a role in the MSC-mediated immunosuppression (13). IDO is not constitutively expressed in MSCs but depends on their activation by lymphocytes or exogenous IFN-γ. This could explain the inhibition of allogenic lymphocytes but could not explain the low immunogenicity and the engraftment of MSCs in allogeneic recipients. More recently, PGE2 which modulates a wide variety of immune cell functions in vitro (31), has been suggested to play a role in the MSC-mediated immunosuppression (30). However, using PGE2 synthesis inhibitors negated 70% of MSC’s inhibitory effect (9). The overall data suggest the possibility of other anticipated molecules.

MSCs inhibit CD4+ T cells proliferation and DC maturation. They induce regulatory immunosuppressive cells, cell cycle arrest, and TH2 cytokines profile. It has been demonstrated that HLA-G exerts the same immuosuppressive effects (15), which could indicate that HLA-G expressed by MSCs may be responsible for much of human MSC-mediated immunomodulatory effects. We studied the implication of HLA-G in the inhibitory effect mediated by MSCs. We evaluated the percentage of HLA-G-positive cell expression (flow cytometry) and the level of HLA-G in culture supernatant (ELISA) in MSC/MLR compared with cultured MSCs alone. We could not detect a statistically significant difference in HLA-G expression in both assays. However, this does not exclude the effective role of HLA-G in MSC-mediated suppressive effect and could indicate an optimal operational concentration of HLA-G expressed by MSCs. This is supported by our results: we have shown that with a neutralizing HLA-G antibody it was possible to partly counterbalance MSC-immunosuppressive effects. Hereby we demonstrated that HLA-G is a tolerogenic molecule constitutively expressed in cultured MSCs alone or in MSC/MLR.

Restoration of lymphocytes proliferation was consistently demonstrated in MSC/MLR using allogenic PBMCs from different donors. The significant restoration of lymphocytes proliferation in presence of HLA-G neutralizing antibody suggests that HLA-G may be partly responsible for human MSC-mediated immunomodulatory effects in vitro.

The constitutive expression of HLA-G protein, along with other reported inhibitory factors expressed by human MSCs, corroborates the effectiveness of MSCs in the management of GVHD (2). Our results showing that MSCs can limit lymphocytes response via HLA-G secretion could offer one explanation for this beneficial effect. It has been demonstrated that HLA-G secretion was associated with a better heart and liver graft acceptance (16, 32). A careful evaluation of the harmful immunomodulatory effects of MSCs is needed with regard to minimal residual disease and tumor escape in vivo. MSCs open new insights in the prevention and treatment of graft rejection in tissue and organ transplantation.

Back to Top | Article Outline

ACKNOWLEDGMENTS

We thank Dr. Olla Ringden Center for Allogeneic Stem Cell Transplantation, Karolinska Institutet, Karolinska University Hospital Huddinge, Stockholm, Sweden, for his kind revision of the paper. We thank Prof. L. Douay (EA1638 Hematology and Cellular Therapy Dpt, Faculty of Medicine Saint Antoine, Université Paris VI) for help in furnishing tissue samples. We wish to thank Dr EL Taguri Adel for his helpful contribution.

Back to Top | Article Outline

REFERENCES

1. Lazarus HM, Koc ON, Devine SM, et al. Cotransplantation of HLA-identical sibling culture-expanded mesenchymal stem cells and hematopoietic stem cells in hematologic malignancy patients. Biol Blood Marrow Transplant 2005; 11: 389.
2. Le Blanc K, Rasmusson I, Sundberg B, et al. Treatment of severe acute graft-versus-host disease with third party haploidentical mesenchymal stem cells. Lancet 2004; 363: 1439.
3. Ringden O, Uzunel M, Rasmusson I, et al. Mesenchymal stem cells for treatment of therapy-resistant graft-versus-host disease. Transplantation 2006; 81: 1390.
4. Koc ON, Gerson SL, Cooper BW, et al. Rapid hematopoietic recovery after coinfusion of autologous-blood stem cells and culture-expanded marrow mesenchymal stem cells in advanced breast cancer patients receiving high-dose chemotherapy. J Clin Oncol 2000; 18: 307.
5. Almeida-Porada G, Flake AW, Glimp HA, Zanjani ED. Cotransplantation of stroma results in enhancement of engraftment and early expression of donor hematopoietic stem cells in utero. Exp Hematol 1999; 27: 1569.
6. Bartholomew A, Sturgeon C, Siatskas M, et al. Mesenchymal stem cells suppress lymphocyte proliferation in vitro and prolong skin graft survival in vivo. Exp Hematol 2002; 30: 42.
7. Beyth S, Borovsky Z, Mevorach D, et al. Human mesenchymal stem cells alter antigen-presenting cell maturation and induce T-cell unresponsiveness. Blood 2005; 105: 2214.
8. Jiang XX, Zhang Y, Liu B, et al. Human mesenchymal stem cells inhibit differentiation and function of monocyte-derived dendritic cells. Blood 2005; 105: 4120.
9. Aggarwal S, Pittenger MF. Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood 2005; 105: 1815.
10. Di Nicola M, Carlo-Stella C, Magni M, et al. Human bone marrow stromal cells suppress T-lymphocyte proliferation induced by cellular or nonspecific mitogenic stimuli. Blood 2002; 99: 3838.
11. Plumas J, Chaperot L, Richard MJ, Molens JP, Bensa JC, Favrot MC. Mesenchymal stem cells induce apoptosis of activated T cells. Leukemia 2005; 19: 1597.
12. Glennie S, Soeiro I, Dyson PJ, Lam EW, Dazzi F. Bone marrow mesenchymal stem cells induce division arrest anergy of activated T cells. Blood 2005; 105: 2821.
13. Meisel R, Zibert A, Laryea M, Gobel U, Daubener W, Dilloo D. Human bone marrow stromal cells inhibit allogeneic T-cell responses by indoleamine 2,3-dioxygenase-mediated tryptophan degradation. Blood 2004; 103: 4619.
14. Rouas-Freiss N, LeMaoult J, Moreau P, Dausset J, Carosella ED. HLA-G in transplantation: a relevant molecule for inhibition of graft rejection? Am J Transplant 2003; 3: 11.
15. Carosella ED, Moreau P, Le Maoult J, Le Discorde M, Dausset J, Rouas-Freiss N. HLA-G molecules: From maternal-fetal tolerance to tissue acceptance. Adv Immunol 2003; 81: 199.
16. Lila N, Carpentier A, Amrein C, Khalil-Daher I, Dausset J, Carosella ED. Implication of HLA-G molecule in heart-graft acceptance. Lancet 2000; 355: 2138.
17. Fouillard L, Bensidhoum M, Bories D, et al. Engraftment of allogeneic mesenchymal stem cells in the bone marrow of a patient with severe idiopathic aplastic anemia improves stroma. Leukemia 2003; 17: 474.
18. Doucet C, Ernou I, Zhang Y, et al. Platelet lysates promote mesenchymal stem cell expansion: A safety substitute for animal serum in cell-based therapy applications. J Cell Physiol 2005; 205: 228.
19. Francois S, Bensidhoum M, Mouiseddine M, et al. Local irradiation not only induces homing of human mesenchymal stem cells at exposed sites but promotes their widespread engraftment to multiple organs: A study of their quantitative distribution after irradiation damage. Stem Cells 2006; 24: 1020.
20. Lila N, Rouas-Freiss N, Dausset J, Carpentier A, Carosella ED. Soluble HLA-G protein secreted by allo-specific CD4+ T cells suppresses the allo-proliferative response: A CD4+ T cell regulatory mechanism. Proc Natl Acad Sci U S A 2001; 98: 12150.
21. Nasef A, Chapel C, Mazurier C, et al. Identification of IL-10 and TGF-bêta transcripts involved in inbiting T Lymphocyte proliferation during cell contact with human mesenchymal stem cells. Gene Expression, in press.
22. Gotherstrom C, West A, Liden J, Uzunel M, Lahesmaa R, Le Blanc K. Difference in gene expression between human fetal liver and adult bone marrow mesenchymal stem cells. Haematologica 2005; 90: 1017.
23. Menier C, Rabreau M, Challier JC, Le Discorde M, Carosella ED, Rouas-Freiss N. Erythroblasts secrete the nonclassical HLA-G molecule from primitive to definitive hematopoiesis. Blood 2004; 104: 3153.
24. Bonab MM, Alimoghaddam K, Talebian F, Ghaffari SH, Ghavamzadeh A, Nikbin B. Aging of mesenchymal stem cell in vitro. BMC Cell Biol 2006; 7: 14.
25. Le Blanc K, Tammik L, Sundberg B, Haynesworth SE, Ringden O. Mesenchymal stem cells inhibit and stimulate mixed lymphocyte cultures and mitogenic responses independently of the major histocompatibility complex. Scand J Immunol 2003; 57: 11.
26. Chung NG, Jeong DC, Park SJ, et al. Cotransplantation of marrow stromal cells may prevent lethal graft-versus-host disease in major histocompatibility complex mismatched murine hematopoietic stem cell transplantation. Int J Hematol 2004; 80: 370.
27. Potian JA, Aviv H, Ponzio NM, Harrison JS, Rameshwar P. Veto-like activity of mesenchymal stem cells: Functional discrimination between cellular responses to alloantigens and recall antigens. J Immunol 2003; 171: 3426.
28. Chapel A, Bertho JM, Bensidhoum M, et al. Mesenchymal stem cells home to injured tissues when co-infused with hematopoietic cells to treat a radiation-induced multi-organ failure syndrome. J Gene Med 2003; 5: 1028.
29. Bensidhoum M, Chapel A, Francois S, et al. Homing of in vitro expanded Stro-1- or Stro-1+ human mesenchymal stem cells into the NOD/SCID mouse and their role in supporting human CD34 cell engraftment. Blood 2004; 103: 3313.
30. Rasmusson I, Ringdén O, Sundberg B, Le Blanc K. Mesenchymal stem cells inhibit lymphocyte proliferation by mitogens and alloantigens by different mechanisms. Exp Cell Res 2005; 15: 33.
31. Harris SG, Padilla J, Koumas L, Ray D, Phipps RP. Prostaglandins as modulators of immunity. Trends Immunol 2002; 23: 144.
32. Creput C, Durrbach A, Charpentier B, Carosella ED, Rouas-Freiss N. [HLA-G: immunoregulatory molecule involved in allograft acceptance]. Nephrologie 2003; 24: 451.
Keywords:

Mesenchymal stem cell; Immunosuppression; Mixed lymphocytes reaction; Histocompatibility locus antigen-G; Graft versus host disease

© 2007 Lippincott Williams & Wilkins, Inc.