Share this article on:

Baboon Bone-Marrow Xenotransplant in a Patient with Advanced HIV Disease: Case Report and 8-Year Follow-Up

Michaels, Marian G.1; Kaufman, Christina2; Volberding, Paul A.3; Gupta, Phalguni1; Switzer, William M.4; Heneine, Walid4; Sandstrom, Paul5; Kaplan, Lawrence6; Swift, Patrick7; Damon, Lloyd6; Ildstad, Suzanne T.2,8

doi: 10.1097/01.TP.0000141365.23479.4E

Background. Xenotransplantation offers a solution to the shortage of organ donors and may offer resistance to human-specific pathogens. Baboons are resistant to productive infection with HIV-1. A baboon bone-marrow transplant (BMT) was performed in an attempt to reconstitute the immune system of a patient with advanced AIDS. The aims of this pilot study were to evaluate the safety of the procedure and develop an approach to prevent and monitor for xenozoonoses.

Methods. A source animal was selected on the basis of infectious disease surveillance protocols. Baboon bone marrow, engineered to remove graft-versus-host-disease-producing mature lineages, but to retain hematopoietic stem cells and facilitating cells, was infused into the patient after nonmyeloablative conditioning. Serial clinical, virologic, immunologic, and hematologic evaluations were performed.

Results. A 38-year-old male with advanced AIDS, who had failed to respond to triple-drug antiretroviral therapy, underwent baboon BMT in 1995. The patient tolerated the procedure without complication. Baboon cells were detected in the peripheral blood on days 5 and 13 after transplantation. Baboon endogenous virus (BaEV) was detected on day 5 but not subsequently. Antibody to BaEV was not detected. HIV-1 viral load declined 1.5 log and remained low until 11 months. The patient improved clinically, and no adverse events occurred. The patient is alive 8 years after the procedure.

Conclusions. Baboon BMT to treat AIDS was attempted using nonmyeloablative conditioning and resulted in transient microchimerism and clinical and virologic improvements. Long-term improvement was not achieved; however, no adverse events occurred, and no evidence of transmission of xenogeneic infections was found.

1 University of Pittsburgh, School of Medicine, Pittsburgh, PA.

2 Institute for Cellular Therapeutics, University of Louisville, Louisville, KY.

3 University of California, San Francisco and San Francisco General Hospital, San Francisco, CA.

4 HIV and Retrovirology Branch, Division of AIDS, STD, and TB Laboratory Research, Center for Disease Control and Prevention (CDC), Atlanta, GA.

5 National HIV and Retrovirology Laboratories, Health Canada, Ottawa, Canada.

6 Hematology and Oncology Division, University of California San Francisco, San Francisco, CA.

7 Alta Bates Comprehensive Cancer Center, Radiation Oncology, Berkeley, CA.

This research was carried out in the General Clinical Research Center at San Francisco General Hospital with support from the National Center for Research Resources, National Institutes of Health (RROO083–84), AIDS Clinical Research Center, San Francisco, California, the Center for AIDS Research, University of California San Francisco, P30 AI 27763–11, NIH K08 AI 01437–03, and Project Inform.

8 Address Correspondence to: Dr. Suzanne T. Ildstad, Director, Institute for Cellular Therapeutics Jewish Hospital Distinguished Professor of Transplantation, Professor of Surgery, University of Louisville, Baxter I Biomedical Research Building, 570 South Preston Street, Suite 404, Louisville, KY 40202–1760. E-mail:

Received 11 February 2004. Accepted 10 June 2004.

Combination antiretroviral therapy can dramatically suppress HIV-1 replication. However, many patients do not achieve restoration of immune function (1). For patients with advanced immunodeficiency, novel approaches are necessary. Cell-based therapies, including allogeneic bone-marrow transplantation (BMT) and lymphocyte transfer, have been performed in patients with acquired immunodeficiency syndrome (AIDS) in an attempt to achieve immune reconstitution (2, 3). These approaches failed, often because the transplanted cells were reinfected. Cell-based therapy to reconstitute immune function may require the development or isolation of HIV-1 resistant cells.

The search for an animal model to study HIV-1 infection led to the recognition that many nonuman primate species, including baboons, are resistant to productive infection with HIV-1 (4). This finding suggested that the hematopoietic stem cells (HSC) from a baboon donor may remain resistant to HIV-1 infection in a xenogeneic transplant environment, potentially allowing immune reconstitution. More recent data support that nonhuman primates are resistant to HIV-1 (5). However, two significant hurdles would need to be overcome: engraftment of bone marrow across a species barrier and graft-versus-host disease (GvHD).

Because the goal of BMT in treatment of HIV-1 disease is not to replace but to augment the patient’s own immune system, mixed chimerism was selected as the therapeutic approach (6–8). Bone-marrow stem cells have been shown to engraft in disparate species in a number of animal models, including pigs and nonhuman primates (6, 9, 10). T cells develop in a phenotypically normal fashion in xenogeneic chimeras and are functional in responding to allogeneic and xenogeneic antigens, as well as mediate lysis of viral infection (8, 11–13). Positive and negative selection events that shape the T-cell repertoire can occur in a xenogeneic environment.

Allogeneic BMT has been limited by GvHD, which increases as the disparity between host and donor increases. T cells, B cells, and natural killer (NK) cells are the primary effector cells in GvHD. Removal of these cells before transplantation decreases GvHD but increases the risk of graft rejection (14). The facilitating cell (FC) is a CD8+/T-cell receptor negative (TCR) cell in bone marrow that promotes engraftment of HSC in allogeneic recipients without causing GvHD (15). These observations provided the preclinical rationale that the establishment of xenogeneic chimerism using a donor graft resistant to infection with HIV-1 may provide a mechanism to achieve immune reconstitution in advanced AIDS.

The objectives of this study were to determine the safety and feasibility of establishing mixed xenogeneic chimerism in a patient with advanced HIV-1 disease using nonmyeloablative conditioning and transplantation of baboon bone marrow engineered to remove T and B cells but retain HSC plus FC. An additional primary objective of the study was to determine the potential and clinical relevance of transferring simian infectious agents from a baboon to a human recipient. This is a case report with 8-year follow-up of a patient with AIDS who underwent xenotransplantation.

Back to Top | Article Outline


The protocol was reviewed and approved by the Institutional Review Boards (IRB) and Biosafety Committees at the University of California, San Francisco, and the University of Pittsburgh as well as the Institutional Animal Care and Review Committee of the University of Pittsburgh. An Investigational New Drug application was approved by the Food and Drug Administration. Testing for baboon microchimerism and baboon endogenous retrovirus (BaEV) was approved by the IRB of the Centers for Disease Control and Prevention.

Major criteria for human subject selection were (1) documented infection with HIV-1 and absence of HIV-2; (2) advanced immunodeficiency (total CD4+ T-cell count<75 cells/mm3); (3) failure of viral titer to respond to highly active antiretroviral therapy (HAART) for 2 months or more; 4) greater than 50% cellularity on bone-marrow biopsy; (5) clinical stability without evidence of an active or chronic opportunistic infection or malignancy; (6) ability to give informed consent; and (7) 6 months or less projected life expectancy.

Candidate source baboons underwent screening for infectious agents and viruses (Fig. 1) (16), including α, β, and γ-herpesviruses, retroviruses, and systemic parasites including Toxoplasmosis gondii and Babesia species. Negative serologic assays for baboon-specific viruses were performed at least three times. Mycobacterium tuberculosis infection was evaluated by serial skin testing. The source animal was transferred to the University of Pittsburgh, where quarantine was maintained for 3 months.



Bone marrow was harvested from the vertebral column of the baboon donor and processed to deplete T cells, B cells, and NK cells and retain FC, progenitors, and HSC using a ferromagnetic approach. The composition of the processed marrow was analyzed by flow cytometry. Quality control testing included colony assays and sterility culture.

Peripheral blood mononuclear cells (PBMC) and plasma were obtained following standard Ficoll-Hypaque centrifugation procedures. DNA lysates were prepared from PBMC as previously described (17). Engraftment was assessed by subjecting DNA lysates from the source animal (control) and the patient to polymerase chain reaction (PCR) assays (17) with primer pairs directed at baboon-specific mitochondrial (mtDNA) sequences. This assay can detect DNA from 0.015 baboon cells in a background of 150,000 human PBMC (17). One-way mixed lymphocyte reaction (MLR) was used to assess the patient’s response to donor antigen (18), self, third-party alloantigen, and xenoantigen and phytohemagglutinin (PHA).

Back to Top | Article Outline

HIV-1 Studies

Paired plasma HIV-1 RNA levels were monitored using two commercially available assays: nucleic acid sequence based amplification (NASBA, Organon Teknika Corporation, Durham, NC) as previously described (19), and a quantitative branched DNA (bDNA) (Chiron Corporation, Emeryville, CA) signal amplification assay as described previously (20) for the first year. Subsequently, commercially available RNA quantitative assays were used.

Baboon and human PBMC were infected with HIV-1 obtained from the subject before and after the procedure (21). Cells (7×106) were cultured with PHA-P (5 μg/mL) for 3 days and then infected for 1 hour with 1 mL (1×105 pg of P24) of the subject’s cell-free HIV-1. Cells were washed three times and cultured for 21 days in RPMI 1640 medium containing 5% interleukin-2 and 20% fetal calf serum with weekly change of half of the medium. Culture fluids were tested at indicated days for the presence of HIV-1 p24 by the antigen capture test (Dupont Merck Pharmaceutical Company, Clinical Research and Development, Wilmington, DE). During the culture period, 0.5×106 cells were harvested at days 0, 12, and 21 and stored at −70°C in a pellet form for qualitative DNA PCR. The sensitivity of the assay was 50 HIV-1 RNA copies per milliliter.

Back to Top | Article Outline

Non-HIV-1 Viral Studies

Serial specimens collected from urine, throat, and saliva, and peripheral blood leukocytes (PBL) were inoculated onto monolayers of human foreskin fibroblasts, Vero cells, rhesus monkey kidney cells, A549, and MRC5 cells as previously described (22). Rapid spin culture for human cytomegalovirus (HCMV) was evaluated by standard techniques on all specimens (23). Cultures that were negative for cytopathic effect (CPE) at 14 to 21 days were scraped and frozen at −80°C. Positive cultures were passed one to three times and frozen for further analysis. Cultures with CPE consistent with CMV were subjected to PCR analysis using primers directed against HCMV and baboon BCMV as previously described (22). Infection with H. papio was retrospectively evaluated using PCR primers against H. papio nuclear antigen as described by Hayashi et al. (24) on PBL from the patient before BMT and serially afterwards. Positive control consisted of DNA extracted from an H. papio driven tumor in an unrelated baboon and negative control was DNA from human Epstein-Barr virus (EBV).

Back to Top | Article Outline

BaEV Studies

Detection of BaEV sequences was performed using a nested PCR strategy (Genbank accession number for the BaEV strain M16550). The first round of PCR used the primers BPOLF4 and BPOLR5 to amplify a 389-bp proviral polymerase sequence. PCR conditions and primer sequences were as previously described (25). The second round of PCR used the primers BPOLF5 (5′ AGGGCGGGAGCAGCGGTAGTAGAC GG 3′) and BPOLR6 (5′ CTTGGACAGCTCTAGGGCCTTGGTTA 3′) to amplify a 120-bp sequence using the same conditions as the primary PCR reaction. Sequences were detected by Southern blot analysis using the radiolabeled oligoprobe BPOLP3 (5′ GGGCACAATCACTACCTCCTGGCA 3′). The sensitivity of this nested PCR assay was equivalent to DNA from 0.015 baboon cells in a background of 150,000 human PBMC.

Back to Top | Article Outline


The subject was a 38-year-old man diagnosed with HIV-1 infection 10 years before the study. His history was notable for two episodes of Pneumocystis carinii pneumonia, cryptococcemia, wasting syndrome, and recurrent hospitalizations for bacterial pneumonia. He had asthma and colonization of his airway with Pseudomonas aeruginosa. Before transplant, he had serologic evidence of infection with HCMV and Epstein-Barr infection. In addition, he shed HCMV in the urine. He failed to exhibit clinical or laboratory improvement after a 16-week course of HAART with indinavir, zidovudine, and lamivudine. The subject’s medications included acyclovir, itraconazole, recombinant growth hormone, and trimethoprim/sulfamethoxazole in addition to HAART. His review of systems and physical examination was notable for chronic disabling fatigue, weight loss, intermittent night fevers and sweats, bilateral peripheral neuropathy, facial seborrhea, temporalis wasting, and chronic wheezing and dyspnea.

A 27.4-kg adult male baboon, bred in the United States for research purposes and housed in a single cage, was chosen as the source animal. Serologic tests were negative for all agents classified as absolute contraindications and for all but one of microbial agents classified as relative contraindications including foamy virus, simian agent-8, and BCMV (Fig. 1). Serum was seropositive for H. papio on the basis of cross-reacting antigen with EBV.

The subject underwent nonmyeloablative conditioning using intravenous cyclophosphamide (300 mg/m2 /d) on days −3 and −2 followed by a single dose of total lymphoid irradiation (TLI) (600 cGy) on day 0. Radiation was delivered with 6 MV photons, with opposed anterior and posterior fields. The treatment included a full mantle arrangement for the upper half of the body followed by a subdiaphragmatic field that covered the para-aortic, pelvic and inguinal lymph nodes and spleen but not the liver. Twelve hours later, processed baboon bone marrow containing 3.32×106 CD34+ cells/kg and 1.2×106 FC/kg recipient body weight was infused intravenously. The patient was hospitalized 21 days for observation. Zidovudine and recombinant growth hormone were discontinued from day −14 to day +14. All other medications were continued throughout the procedure. Intravenous foscarnet was administered as CMV prophylaxis from day −2 to day +21. GvHD prophylaxis was not used. The subject was evaluated three times pretransplant (days −14, −7, −3), daily as an inpatient (days 0 to +21), weekly for the first 4 weeks postdischarge (days +28, +35, +42, and +49), monthly for the first year, biannually for 2 years, then every 1 to 3 years.

Engraftment was evaluated using primers directed against baboon mtDNA; donor cells were detected on days 5 and 13 but not subsequently in PBMC (Fig. 2). At year 4, PBMC was retested and did not show evidence of donor cells (data not shown). Analysis of DNA extracted from the recipient bone marrow on day 33 showed no donor-derived cells (Fig. 2). The subject’s mean baseline CD4+ T lymphocyte count was 45 cells/mm3. Posttransplant, the level decreased to 10 cells/mm3, returning to baseline by month 2. At 7.7 years posttransplant, the CD4 cell count was 32 cells/mm3. In general, the absolute numbers of CD4+ and CD8+ T cells paralleled changes in the total white blood cell count, which fell after conditioning and BMT to a low of 1,700 9 days after BMT. Other cell counts (B cells, NK cells) behaved similarly.



During the immediate posttransplant period, the patient reported subjective improvement in his general well being with improved energy level and appetite, 15 pound weight gain, and absence of his previous chronic symptoms including sinus congestion, night sweats, bronchospasm, and seborrhea. The patient also subjectively reported the return of a sense of smell and taste. This improved status lasted approximately 11 months. He demonstrated no evidence for GvHD. At month 7, the subject was hospitalized briefly for nephrolithiasis attributed to indinavir, which was replaced by nelfinavir. During the first 36 months of follow-up, the subject remained clinically stable without new infections or HIV–1-related complications. Subsequently, he experienced episodes of clinical sinusitis and bronchitis. The subject remains alive 8 years and 5 months after the procedure. Disease from mycobacterium avium complex (MAC) was diagnosed 7.5 years after the procedure. At 8 years, his antiretroviral medications included lamivudine, tenofovir, didanosine, and atazanavir. In addition, he received treatment for MAC and prophylaxis against Pneumocystis jiroveci pneumonia fungal infections.

The patient’s ability to respond in proliferation and cytotoxicity assays before and after transplantation was measured. Three months before the transplant, lymphocytes from the subject showed extremely high background proliferation with no significant increases in proliferation to PHA, donor, or alloantigen. However, 2 weeks earlier, BMT proliferative responses were present against PHA, donor, and alloantigen. Unfortunately, third-party xenogeneic responses were not tested before the transplant. As shown in Figure 3, the strong response to PHA in the pretransplant sample was lost and regained several times over the first 8 months. A strong response was seen at year 4. In general, there was a stronger response to alloantigen than to xenoantigen. There were poor responses to either donor or xenoantigen in the first 3 months, but this recovered somewhat at months 5 and 6. At month 8 and year 4, there was no response to xenoantigen.



Plasma HIV-1 RNA levels (bDNA assay, Chiron) are shown in Figure 4 and averaged a mean pretransplant level of 69,920 copies/mm3. On day 0 (after irradiation and cyclophosphamide administration), the viral load decreased to 31,260 copies/mm3, and by day +4 had declined to 2,100 copies/mm3, likely because of lympholysis. The HIV-1 RNA levels remained low through 6 months of follow-up, increasing transiently at days +14 and +35 (Fig. 4A). Similar trends were seen using the NASBA assay, with a transient increase at days +14 and +40 (Fig. 4B). HIV-1 RNA levels were consistently over 20,000 copies RNA/ml by 1 year after BMT (data not shown). At 7.5 years, his viral load was 45,193 copies RNA/mL.



Quantitative cultures for cell associated HIV-1 decreased approximately 25-fold during the first 6 months after transplantation (Fig. 4C). A transient increase was observed at day 19. In addition, the level of proviral DNA detected by quantitative PCR decreased by approximately 3-fold 6 months after transplantation (data not shown).

Replication properties in human and baboon PBMC of HIV-1 isolated from the subject pre- and post-BMT did not change in vitro. Isolates from the subject 3 days before and 33 days after BMT did not grow in baboon PBMC but did grow efficiently in normal human PBMC controls. To rule out abortive infection of HIV-1 in baboon PBMC, viral DNA synthesis was measured by qualitative DNA PCR after infection. No HIV-1 DNA PCR signal was observed up to 21 days postinfection of baboon PBMC (data not shown).

Baboon endogenous retrovirus DNA was detected by nested PCR on day 5 (Fig. 2) but not subsequently up to 7 years post-BMT (data not shown). The simultaneous detection of baboon mtDNA on day 5 is consistent with the presence of microchimerism. No detectable BaEV sequences were seen in the bone-marrow sample at day 32. In addition, antibody directed against BaEV was not found on serial samples obtained between days −2 and +410 after BMT (Fig. 5). Serial viral cultures were performed at 20 time points through year 4. Surveillance viral cultures consistently revealed CMV in the urine. Other sampled sites were without CPE and negative for CMV antigen stains with the exception of a throat specimen obtained before transplantation. The DNA extracted from CMV isolates amplified with primers directed against HCMV but not with primers directed against BCMV (data not shown). The patient’s PBL before and through 4 years after BMT were negative for H. papio by PCR analysis (data not shown). No blood exposures to hospital personnel or close contacts were disclosed.



Back to Top | Article Outline


A strong interest in xenotransplantation has emerged as a result of the shortage of allogeneic organs available for transplantation (26). Xenotransplantation also offers other potential benefits, including the appreciation that some animals are resistant to infectious agents that affect humans (27). The first application of disease-resistance for xenotransplantation occurred in two patients with hepatic failure from hepatitis B virus who received baboon liver transplants (27). The rationale for the presented study was to transplant bone marrow from a nonhuman primate resistant to infection with HIV-1 into patients with advanced disease in an attempt to achieve immune reconstitution. Subsequently, the U.S. Department of Health and Human Services regulations exclude the use of nonhuman primates as source animals for human xenotransplant trials; however, antecedent protocols still require long-term follow-up (28).

The primary objectives of this pilot study were to evaluate safety and feasibility of transplanting bone marrow from an HIV–1-resistant species (baboon) to a nonmyeloablatively conditioned patient with AIDS who had not responded to HAART. The approach was well tolerated, and serial monitoring did not identify xenozoonoses. Baboon hematopoietic cell microchimerism was detected in the peripheral blood of the recipient at days 5 and 13. However, long-term engraftment was not observed, possibly because of the low level of conditioning used. Only slightly more conditioning has now been shown to reliably establish mixed allogeneic chimerism in humans with hematologic malignancy (29, 30). Although the xenogeneic barrier is more formidable, chimerism can be established in xenogeneic rodent models nonmyeloablatively (31).

The subject exhibited transient pancytopenia postconditioning. Recovery kinetics were slightly faster but similar to patients without HIV infection who received TLI, albeit at higher doses (32). Despite a low CD4 count, the subject was reactive to allo- and xenoantigen pretransplant. In the posttransplant period, the patient exhibited variable proliferative responses but in general responded to mitogen and alloantigen. The subject did respond to donor and third-party xenoantigen in MLR assays after the transplant, but these responses were in general lower than alloantigen responses. The lack of either donor or xenoantigen response in the month 8 samples is probably more reflective of the general state of immunoincompetence in this patient with end-stage HIV infection rather than a specific induction of xenotolerance.

Before the procedure, the subject had evidence of advanced HIV-1 disease requiring recurrent hospitalizations. His baseline viral RNA level was greater than 50,000 copies RNA/mL, despite 4 months of aggressive antiretroviral therapy including indinavir. During the immediate posttransplant period, he had transient virologic response (approximately 1.5 logs) until 11 months after transplantation. Immediately after the transplant, the subject reported subjective clinical improvement. Although the subject’s clinical and virologic improvement is consistent with that seen in patients who receive protease inhibitor therapy, this patient had no clear response to HAART before the transplant. One could hypothesize that the conditioning itself, or conditioning in the presence of antiretroviral therapy, or possibly the transient baboon microchimerism, could have contributed to the significant decline in viral burden.

Xenozoonoses were not detected during extensive monitoring for 4 years after transplantation. Although only transient engraftment was achieved, many infections are transmitted without sustained presence of cells, as noted after blood transfusion (33). It is likely that the protocol for donor selection eliminated many potential xenozoonoses, including exogenous retroviruses and most herpesviruses. The source animal had evidence for previous infection with H. papio based on antibody cross-reacting with that against human EBV (34). However, because the human recipient was seropositive for EBV before BMT, transmission of H. papio could not be evaluated by this method, and specific assays differentiating the two viruses were not initially available. Retrospective analysis of PBL from the patient did not detect H. papio nuclear antigen up to 4 years post BMT. However, low levels of virus may not be detected. H. papio, similar to EBV, is latent within B cells; accordingly, the initial BM preparation, which included removal of B cells, would likely have removed cells carrying latent H. papio. Likewise, BaEV, found in the genome of all baboons, was not eliminated by screening. Therefore, the observed absence of both serologic and molecular evidence of infection with BaEV in the patient is significant given the possible exposure to the virus and the known ability of BaEV to replicate in human cells (35).

Although definitive conclusions are not possible in this single pilot study, these observations raise intriguing questions regarding the use of immunosuppressive therapies for patients with HIV-1 disease who are not responsive to HAART. Although seemingly counterintuitive, immunosuppressive therapies may be beneficial in selected patients because (1) many symptoms of HIV-1 disease are believed to be autoimmune mediated; (2) the immune response to HIV-1 may be partially responsible for T-cell death and disease progression; and (3) efficient HIV-1 replication requires an activated immune system (36). The preparative regimen may have also influenced the patient’s HIV-1 infection. T cells are susceptible to low doses of radiation, leading to the use of TLI in various autoimmune conditions (37). In patients with severe rheumatoid arthritis, fractionated TLI results in clinical improvement, sustained lymphopenia (particularly CD4+ T cells), reduced B-cell activity, and increased suppresser T-cell activity. However, experience with TLI in patients with HIV-1 disease is limited (38). A sustained decrease in the absolute levels or CD4+ T cells and plasma simian immunodeficiency virus (SIV) levels was observed when SIV-infected macaques were treated with fractionated TLI. The PBMC isolated before TLI better supported viral replication than those cells isolated after TLI (39), possibly because of the “nonactivated” nature of circulating T cells post TLI (39). This report used a dose of TLI much higher (cumulative 3,420 cGy) than the 600 cGy dose used for our subject. However, at least for the first year or so after transplant, it is conceivable that the in vivo activation response of the subject’s T cells were lower than normal.

In summary, we report that the use of nonmyeloablative conditioning followed by the infusion of baboon bone marrow was safe and well tolerated in a patient with advanced HIV-1 disease. These safety data have potential implications for other groups considering cell-based clinical research, including the development of HIV-resistant genetically modified human stem cells. Long-term engraftment of donor cells was not seen. Dose escalation studies, using more aggressive preparative regimens, would be required to establish chimerism. Studies analyzing the use of low-dose, nonfractionated TLI in patients with advanced HIV-1 disease should also be evaluated. With no cure for AIDS in sight, novel strategies to achieve a cure should continue to be pursued.

Back to Top | Article Outline


The authors thank Martin Delaney and Brenda Lien of Project Inform for encouraging and supporting this project. We are indebted to John Montgomery for coordinating this study; Drs. Louisa Chapman and Tom Folks from the Center for Disease Control and Prevention for their assistance and kind reviews; Richard L. Simmons, MD, at the University of Pittsburgh and Nancy L. Ascher, MD, at UCSF for helpful advice; Ming Ding at the University of Pittsburgh and Jan Capper at UCSF for performing PCR analysis; and Denise Capozzi, DVM, Edwin Klein, DVM, and the staff at the Animal Facility of the University of Pittsburgh. We are also grateful to the nurses and staff at the SFGH General Clinical Research Center, and to Carolyn DeLautre for administrative assistance in the preparation of this manuscript. Finally, we recognize the courage of those patients who are willing to go first.

Back to Top | Article Outline


1. Hogg RS, Yip B, Chan KJ, et al. Rates of disease progression by baseline CD4 cell count and viral load after initiating triple-drug therapy. JAMA 2001; 286: 2568.
2. Lane HC, Zunich KM, Wilson W, et al. Syngeneic bone marrow transplantation and adoptive transfer of peripheral blood lymphocytes combined with zidovudine in human immunodeficiency virus (HIV) infection. Ann Intern Med 1990; 113: 512.
3. Riddell SR, Elliott M, Lewinsohn DA, et al. T-cell mediated rejection of gene-modified HIV-specific cytotoxic T lymphocytes in HIV-infected patients. Nat Med 1996; 2: 216.
4. Morrow WJ, Homsy J, Eichberg JW, et al. Long-term observation of baboons, rhesus monkeys, and chimpanzees inoculated with HIV and given periodic immunosuppressive treatment. AIDS Res Hum Retroviruses 1989; 5: 233.
5. Stremlau M, Owens CM, Perron MJ, et al. The cytoplasmic body component TRIM5alpha restricts HIV-1 infection in Old World monkeys. Nature 2004; 427: 848.
6. Ildstad ST, Sachs DH. Reconstitution with syngeneic plus allogeneic or xenogeneic bone marrow leads to specific acceptance of allografts or xenografts. Nature 1984; 307: 168.
7. Ildstad ST, Wren SM, Bluestone JA, et al. Characterization of mixed allogeneic chimeras: Immunocompetence, in vitro reactivity and genetic specificity of tolerance. J Exp Med 1985; 162: 231.
8. Colson YL, Tripp RA, Doherty PC, et al. Antiviral cytotoxic activity across a species barrier in mixed xenogeneic chimeras: functional restriction to host MHC. J Immunol 1998; 160: 3790.
9. Gritsch HA, Glaser RM, Emery DW, et al. The importance of nonimmune factors in reconstitution by discordant xenogeneic hematopoietic cells. Transplantation 1994; 57: 906.
10. Allen MD, Weyhrich J, Gaur L, et al. Prolonged allogeneic and xenogeneic microchimerism in unmatched primates without immunosuppression by intrathymic implantation of CD34+ donor marrow cells. Cell Immunol 1997; 181: 127.
11. Ildstad ST, Wren SM, Boggs SS, et al. Cross-species bone marrow transplantation: Evidence for tolerance induction, stem cell engraftment, and maturation of T lymphocytes in a xenogeneic stromal environment (Rat -> Mouse). J Exp Med 1991; 174: 467.
12. Van Den Brink MR, French SW, Beck TP, et al. Characterization of maturation and function of natural killer cells in xenogeneic (rat - mouse) bone marrow chimeras. Evidence that rat NK cells are present and functional in an xenogeneic environment. Transplantation 1993; 55: 355.
13. Ildstad ST, Wren SM, Sharrow SO, et al. In vivo and in vitro characterization of specific hyporeactivity to skin xenografts in mixed xenogeneically reconstituted mice (B10 + F344 Rat->B10). J Exp Med 1984; 160: 1820.
14. Vallera DA, Blazar BR. T cell depletion for graft-versus-host disease prophylaxis. A perspective on engraftment in mice and humans. Transplantation 1989; 47: 751.
15. Kaufman CL, Colson YL, Wren SM, et al. Phenotypic characterization of a novel bone-marrow derived cell that facilitates engraftment of allogeneic bone marrow stem cells. Blood 1994; 84: 2436.
16. Michaels MG. Infectious concerns of cross-species transplantation: xenozoonoses. World J Surg 1997; 21: 968.
17. Heneine W, Switzer WM. Highly sensitive and specific polymerase chain reaction assays for detection of baboon and pig cells following xenotransplantation in humans. Transplantation 1996; 62: 1360.
18. Sheehy MJ, Sondel PM, Bach ML, et al. HL-A LD (lymphocyte defined) typing: a rapid assay with primed lymphocytes. Science 1975; 188: 1308.
19. Kievits T, van Gemen B, van Strijp D, et al. NASBA isothermal enzymatic in vitro nucleic acid amplification optimized for the diagnosis of HIV-1 infection. J Virol Methods 1991; 35: 273.
20. Pachl C, Todd JA, Kern DG. et al. Rapid and precise quantification of HIV-1 RNA in plasma using a branched DNA signal amplification assay. J Acquir Immune Defic Syndr Hum Retrovirol 1995; 8: 446.
21. Balachandran R, Thampatty P, Enrico A, et al. Human immuno deficiency virus isolates from asymptomatic homosexual men and from AIDS patients have distinct biologic and genetic properties. Virology 1991; 180: 229.
22. Michaels MG, Alcendor DJ, St George K, et al. Distinguishing baboon cytomegalovirus from human cytomegalovirus: importance for xenotransplantation. J Infect Dis 1997; 176: 1476.
23. St George K, Rinaldo CR Jr. Effects of enhancing agents on detection of cytomegalovirus in clinical specimens. J Clin Microbiol 1994; 32: 2024.
24. Hayashi K, Ohara N, Teramoto N, et al. An animal model for human EBV-associated hemophagocytic syndrome: herpesvirus papio frequently induces fatal lymphoproliferative disorders with hemophagocytic syndrome in rabbits. Am J Pathol 2001; 158: 1533.
25. Allan JS, Broussard SR, Michaels MG, et al. Amplification of simian retroviral sequences from human recipients of baboon liver transplants. AIDS Res Hum Retroviruses 1998; 14: 821.
26. Dunning JJ, White DJ, Wallwork J. The rationale for xenotransplantation as a solution to the donor organ shortage. Pathol Biol (Paris) 1994; 42: 231.
27. Starzl TE, Fung J, Tzakis A, et al. Baboon to human liver transplantation. Lancet 1993; 341: 65.
28. DHHS, FDA, CBER. Guidance for industry: public health issues posed by the use of nonhuman primate xenografts in humans. 1–6. Washington, DC, U.S. Department of Health and Human Services, Food and Drug Administration, Center for Biologics Evaluation and Research (CBER) 1999.
29. Sandmaier BM, McSweeney P, Yu C, et al. Nonmyeloablative transplants: preclinical and clinical results. Semin Oncol 2000; 27: 78.
30. Champlin R. Nonmyeloablative chemotherapy with allogeneic hematopoietic transplantation as adoptive immunotherapy for malignancies. Hematology. Am Soc Hematol 1999; 413.
31. Sharabi Y, Aksentijevich I, Sundt TM, et al. Specific tolerance induction across a xenogeneic barrier: production of mixed rat/mouse lymphohematopoietic chimeras using a non-lethal preparative regimen. J Exp Med 1990; 172: 195.
32. Saper V, Chow D, Engleman ED, et al. Clinical and immunological studies of cadaveric renal transplant recipients given total-lymphoid irradiation and maintained on low-dose prednisone. Transplantation 1988; 45: 540.
33. Klein HG. Will blood transfusion ever be safe enough? Transfus Med 2001; 11: 122.
34. Michaels MG, McMichael JP, Brasky K, et al. Screening donors for xenotransplantation. The potential for xenozoonoses. Transplantation 1994; 57: 1462.
35. Huang LH, Silberman J, Rothschild H, et al. Replication of baboon endogenous virus in human cells. Kinetics of DNA synthesis and integration. J Biol Chem 1989; 264: 8811.
36. Noel PJ, Boise LH, Green JM, et al. CD28 costimulation prevents cell death during primary T cell activation. J Immunol 1996; 157: 636.
37. Halperin EC. Total lymphoid irradiation as an immunosuppressive agent for transplantation and the treatment of “autoimmune” disease: a review. Clin Radiol 1985; 36: 125.
38. Nobler MP, Leddy ME, Huh SH. The impact of palliative irradiation on the management of patients with acquired immune deficiency syndrome. J Clin Oncol 1987; 5: 107.
39. Fultz PN, Schwiebert RS, Su L, et al. Effects of total lymphoid irradiation on SIV-infected macaques. AIDS Res Hum Retroviruses 1995; 11: 1517.

Xenotransplantation; Immune reconstitution; AIDS; Xenozoonoses; Xenogeneic chimerism

© 2004 Lippincott Williams & Wilkins, Inc.