Share this article on:

Molecular Subtyping of Treponema pallidum in Paris, France

Grange, Philippe Alain PhD*; Allix-Beguec, Caroline PhD; Chanal, Johan MD*‡; Benhaddou, Nadjet MD§; Gerhardt, Philippe MD; Morini, Jean-Pierre MD; Deleuze, Jean MD; Lassau, François MD; Janier, Michel MD; Dupin, Nicolas MD*‡

doi: 10.1097/OLQ.0000000000000006

Two major Treponema pallidum subtypes, 14 d/g and 14 d/f, were identified in a population of 119 patients with syphilis in Paris, France, characterized by a high proportion of men who have sex with men. A new subtype named 11 q/j was characterized, and a reinfection case was determined in 1 patient having consecuitve syphilis infection at 19-month interval.

This epidemiological study of Treponema pallidum strains has shown a low genetic variation with the 14 d/g subtype predominating in the men who have sex with men population in Paris, France.

From the *Laboratoire de Recherche en Dermatologie, EA 1833, Centre National de Référence Syphilis, Faculté de Médecine, Université Sorbonne Paris Descartes, Paris, France; †Genoscreen, Lille, France; ‡Service de Dermatologie-Vénéréologie, Hôpital Cochin, Pavillon Tarnier, APHP, Paris, France; §Service de Bactériologie, Groupe Hospitalier Paris Centre Cochin-Hôtel Dieu-Broca, Paris, France; and ¶Centre des MST, Hôpital Saint-Louis, APHP, Paris, France

Acknowledgment: The authors thank Soline Dhauteville for technical supports and all the nurses of the sexually transmitted disease unit and Frédérique De Matos for the molecular analysis. This work was supported by the Institut National de Veille Sanitaire, the Société Française de Dermatologie, and the Association de Recherche en Virologie et Dermatologie.

Conflicts of interest and source of funding: None declared.

Correspondence: Nicolas Dupin, MD, Hôpital Cochin, Pavillon Tarnier, Laboratoire de Recherche en Dermatologie, UPRES EA 1833 et CNR Syphilis, 89, rue d’Assas, 75006 Paris, France. E-mail:

Received for publication January 28, 2013, and accepted April 30, 2013.

Treponema pallidum subsp. pallidum (T. pallidum) is the causal agent of syphilis, which remains a major sexually transmitted disease. Understanding the epidemiology of syphilis through the monitoring of clusters in the population may improve knowledge of the infection spreading. Since the publication of a molecular typing method for distinguishing between T. pallidum strains, several T. pallidum subtypes have been identified worldwide.1 T. pallidum subtypes identification is based on the Centers for Disease Control and Prevention typing method, involving the determination of the number of 60-base-pair (bp) repeats in the acidic repeat protein gene (arp), denoted by a number in the subtype and differences in the sequence of the T. pallidum repeat subfamily II genes (tprE, G, and J; referred to as tpr), as determined by restriction fragment length polymorphism (RFLP) analysis and denoted by a letter in the subtype.2 The discriminatory capacity of this test was greatly improved by combining it with the sequence analysis for an 84-bp region of the tp0548 gene of T. pallidum, corresponding to the second letter in the subtype name.3 Molecular typing was carried out on multiple specimens, and full molecular typing efficiency was found to be higher for primary and secondary lesions and for ear lobe blood and skin biopsy specimens than for whole blood, plasma, and cerebrospinal fluid.4–9 We report here, for the first time, T. pallidum typing results for a cohort of patients with syphilis in Paris, France.

As part of the National Surveillance Syphilis Infection program in France, we enrolled prospectively 119 patients with syphilis consulting at 2 major sexually transmitted disease centers in Paris, France, between December 2005 and January 2012. The study was approved by the institutional review board of the Comité de Protection des Personnes d’Ile de France 3 (#S.C.3005) and was conducted according to the Declaration of Helsinki Principles. All patients signed a written informed consent form. When patients have mucosal ulceration or erosion, the lesion excudate was collected with swab. In case of secondary syphilis, patients without mucosal lesion but with skin lesions such as macules or papules have these lesions gently scrapped to obtain serosity which was further collected. Genital, anal, oral, and cutaneous ulcer swabs were collected and immediately examined by dark-field microscopy (DFM) made by 2 independent experienced observers at ×900 magnification. The detection of at least 1 typical motile organism was considered to constitute a positive result. The samples were then sent to the Centre National de Référence de la syphilis for serological and molecular analysis. Serum samples were tested in routine analysis with the venereal disease research laboratory (VDRL) test (Latex Pasteur, Bio-Rad, France) and the T. pallidum haemagglutination assay (TPHA) test (Newmarket, UK), according to the manufacturers’ instructions. HIV-1 and HIV-2 antigen and antibody detection in serum was performed in routine by an automated enzyme-linked immunosorbent assay (Genscreen ULTRA HIV Ag-Ab; Bio-Rad, Marne-la-Coquette, France), according to the manufacturers’ instructions. Positive detection of antibodies was confirmed by HIV-1 and HIV-2 immunoblottings (NEW Lav-Blot I and New Lav-Blot II; Bio-Rad, Marne-la Coquette, France). DNA was extracted from all specimens with the Nucleospin Blood kit (Macherey-Nagel Eurl, Hoerd, France) and screened by diagnostic nested polymerase chain reaction, which amplifies a 168-bp region of the tpp47 gene, as described previously.10 A total of 113 patients (95%) were positive by nested polymerase chain reaction and thus were eligible for typing based on the enhanced method, as described previously.3 Full typing results were obtained for 71 patients (63%), which was in accordance with previous studies.11 All (100%) 71 patients were male, and 94% (n = 67) were men who have sex with men (MSM), with a median and mean age of 36 and 37.5 years, respectively (range, 18–63 years). Primary and secondary syphilis were diagnosed in 59% (n = 42) and 41% (n = 29) of the patients, respectively. DFM results were positive for only 68% (48/71) of the patients, and 51% (n = 36) of the patients were HIV positive. We obtained a total of 84 specimens from these 71 patients: 1 swab from each of 62 patients, 2 swabs each from 6 patients, 3 swabs each from 2 patients, and 4 swabs from 1 patient. Most of these swabs were genital swabs (62%; 52/84), but some were cutaneous (19%; 16/84), anal (12%; 10/84), and oral (7%; 6/84).

Five subtypes—11 q/j, 14 d/d 14 d/f, 14 d/g, and 15 d/f — were identified in this population with 2 predominant subtypes, 14 d/g and 14 d/f, found in 69% (49/71) and 27% (19/71), respectively (Table 1). Previous studies have shown that 14d is the most common subtype identified around the world,5–7,12 but 14a predominates in Portugal (50% and 65%) and in South Africa (54%).4,13,14 Full typing analysis have shown that the 14 d/f subtype may represented from 34% to 90% on the T. pallidum strains identified in Eastern Asia at the time of the study,1,15,16 whereas a high proportion of the 14 d/g subtype was reported in Dublin and Seattle.3,17,18



We identified 3 subtypes, 11 q/j, 14 d/d, and 15 d/f, present sporadically in the population with “q,” corresponding to a new restriction profile with bands at 911, 722, 410, 382, and 310 bp after MseI digestion, and “j” to a new tp0548 sequence: CAGGCGGCAGTGGCCGCACGCGCTGGAGGGTC–CGGCGGTAATGACAACCACCCCGGCAAGGAACAGTTTCTCCAGTT (Fig. 1). Although the 15 d/f subtype was described in Seattle at a frequency of 12% over the period 1999 to 2008,3 these uncommon subtypes may suggest the presence for separate sexual networks among the population. Around the world, T. pallidum presents a high level of genotype polymorphism, but the only 2 major subtypes identified in Paris suggest the low level of cross-border transmission, reflecting the gregariousness of the population studied, with MSM accounting for 94% of the patients. However, owing to the high number of HIV-infected MSM, as previously described for this location,19 it should be noted that these results may not reflect the proportion of T. pallidum subtype, which may circulate in the entire population in Paris.

Figure 1

Figure 1

Temporal distribution analysis of strains from 2005 to 2012 showed that 14 d/g predominated, accounting for 0%, 64%, 67%, 67%, 67%, 86%, 100%, and 100%, of patients for 2005, 2006, 2007, 2008, 2009, 2010, 2011, and 2012, respectively, whereas 14 d/f remained a minor subtype until 2010, subsequently disappearing in 2011 (100%, 36%, 25%, 22%, 33%, 14%, 0%, 0%, respectively), which could be in accordance with a similar phenomenon reported for a period from 1999 through 2008, possibly caused by HIV serosorting in the MSM population (Table 1).3,18 For the purpose of statistical analysis using the Cochran-Mantel-Haenszel test, the years 2005 and 2012 containing only 1 patient were removed, and the remaining years of sampling were divided into 2 groups (2006–2008, 2009–2011). There was no significant change in strain type over the 2 periods.

Nine patients studied had several sites, such as genital, oral, anal, and cutaneous lesions. One patient had primary syphilis (TPHA 160, VDRL 4) with genital and anal lesions; the other 8 patients had secondary syphilis, with serological results ranging from 5120 to 20,480 for TPHA and from 16 to 256 for the VDRL. Seven patients were MSM, and 5 patients were HIV positive. Six of these patients presented subtype 14 d/g, whereas the other 3 patients presented subtype 14 d/f (Table 1). The same subtype was found in the different sites for each patient in accordance with previous report.4

One patient consulted twice at a 19-month interval and presented successive syphilis infections. At the first consultation in December 2005, this HIV-positive patient presented with secondary syphilis (TPHA 20,480, VDRL 16), with a papular skin lesion on the abdomen, testing positive by DFM. He was diagnosed as having secondary syphilis and treated with benzathine penicillin G. The second consultation occurred in July 2007. The patient presented with genital lesion and cutaneous eruption on the thorax, testing negative by DFM, and with a high titer serology (TPHA 20,480, VDRL 16), he was diagnosed as having secondary syphilis and treated with benzathine penicillin G. We identified the 14 d/f subtype during the first consultation, whereas the 14 d/g subtype was identified during the second visit (Table 1 and Fig. 2). This result suggests that subtyping may contribute to characterize a new infection, as previously described.3 However, this method cannot rule out a reinfection if the subtype remains the same.

Figure 2

Figure 2

In conclusion, subtyping T. pallidum strains allowed a better characterization of the infected population, and we found that subtype 14 d/g was the most common subtype in the MSM population in Paris. However, these combined techniques are time consuming and not applicable in routine analysis. Based on new advanced high-throughput screening technologies, T. pallidum genome complete analysis will need to be investigated to access to genome variability.

Back to Top | Article Outline


1. Ho EL, Lukehart SA. Syphilis: Using modern approaches to understand an old disease. J Clin Invest 2011; 121: 4584–4592.
2. Pillay A, Liu H, Chen CY, et al. Molecular subtyping of Treponema pallidum subspecies pallidum. Sex Transm Dis 1998; 25: 408–414.
3. Marra CM, Sahi SK, Tantalo LC, et al. Enhanced molecular typing of Treponema pallidum: Geographical distribution of strain types and association with neurosyphilis. J Infect Dis 2010; 202: 1380–1388.
4. Castro R, Prieto E, Aguas MJ, et al. Molecular subtyping of Treponema pallidum subsp. pallidum in Lisbon, Portugal. J Clin Microbiol 2009; 47: 2510–2512.
5. Cruz AR, Pillay A, Zuluaga AV, et al. Secondary syphilis in Cali, Colombia: New concepts in disease pathogenesis. PLoS Negl Trop Dis 2010; 4: e690. doi:10.1371/journal.pntd.0000690.
6. Martin IE, Gu W, Yang Y, et al. Macrolide resistance and molecular types of Treponema pallidum causing primary syphilis in Shanghai, China. Clin Infect Dis 2009; 49: 515–521.
7. Pillay A, Liu H, Ebrahim S, et al. Molecular typing of Treponema pallidum in South Africa: Cross-sectional studies. J Clin Microbiol 2002; 40: 256–258.
8. Pope V, Fox K, Liu H, et al. Molecular subtyping of Treponema pallidum from North and South Carolina. J Clin Microbiol 2005; 43: 3743–3746.
9. Sutton MY, Liu H, Steiner B, et al. Molecular subtyping of Treponema pallidum in an Arizona county with increasing syphilis morbidity: Use of specimens from ulcers and blood. J Infect Dis 2001; 183: 1601–1606.
10. Grange PA, Gressier L, Dion PL, et al. Evaluation of a PCR test for detection of Treponema pallidum in swabs and blood. J Clin Microbiol 2012; 50: 546–552.
11. Peng RR, Wang AL, Li J, et al. Molecular typing of Treponema pallidum: A systematic review and meta-analysis. PloS Negl Trop Dis 2011; 5: e1273. doi:10.1371/journal.pntd.0001273
12. Cole MJ, Ghisholm SA, Palmer HM, et al. Molecular epidemiology of syphilis in Scotland. Sex Transm Infect 2009; 85: 447–451.
13. Florindo C, Reigado V, Gomes JP, et al. Molecular typing of Treponema pallidum clinical strains from Lisbon, Portugal. J Clin Microbiol 2008; 46: 3802–3803.
14. Molepo J, Pillay A, Weber B, et al. Molecular typing of Treponema pallidum strains from patients with neurosyphilis in Pretoria, South Africa. Sex Transm Infect 2007; 83: 189–192.
15. Peng RR, Yin YP, Wei WH, et al. Molecular typing of Treponema pallidum causing early syphilis in China: A cross-sectional study. Sex Transm Dis 2012; 39: 42–45.
16. Wu H, Chang SY, Lee NY, et al. Evaluation of macrolide resistance and enhanced molecular typing of Treponema pallidum in patients with syphilis in Taiwan: A prospective multicenter study. J Clin Microbiol 2012; 50: 2299–2304.
17. Hopkins S, Lyons F, Coleman C, et al. Resurgence in infectious syphilis in Ireland: An epidemiological study. Sex Transm Dis 2004; 31: 317–321.
18. Grimes M, Sahi SK, Godornes BC, et al. Two mutations associated with macrolide resistance in Treponema pallidum: Increasing prevalence and correlation with molecular strain type in Seattle, Washington. Sex Transm Dis 2012; 39: 954–958.
19. Farhi D, Zizi N, Grange P, et al. The epidemiological and clinical presentation of syphilis in a venereal disease centre in Paris, France. A cohort study of 284 consecutive cases over the period 2000–2007. Eur J Dermatol 2009; 19: 484–489.
© Copyright 2013 American Sexually Transmitted Diseases Association