Secondary Logo

Journal Logo

Original Articles

Prevalence andtetM Subtype of Tetracycline-ResistantNeisseria gonorrhoeaein Ohio, 1994

Trees, David L. PhD; Fakile, Yetunde PhD; Neal, Sandra W. MS; Knapp, Joan S. PhD

Author Information
Sexually Transmitted Diseases: January 2000 - Volume 27 - Issue 1 - p 46-48
  • Free

TETRACYCLINE RESISTANCE IN Neisseria gonorrhoeae is mediated in one of two ways. Chromosomal resistance is mediated by the chromosomal loci tet and mtr and results in low-level resistance with minimum inhibitory concentrations (MICs) ranging from 1.0 to 8.0 μg/ml of tetracycline.1 High-level resistance (usually MICs of ≥ 16.0 μg/ml of tetracycline) is caused by the presence of a 25.2-MDa conjugative plasmid that contains the tetM gene.2,3TetM is present in a number of bacteria and has been shown to have a highly mosaic structure depending on the host species.4 Two distinct tetM genes have been identified in N gonorrhoeae and have been designated as “Dutch-type” (Netherlands) or “American-type” (United States) based on the location where they were originally isolated.5,6 A polymerase chain reaction (PCR)/restriction endonuclease analysis has been described that can determine the tetM type present in a gonococcal isolate.7 In this study, we performed tetM PCR/restriction endonuclease analysis in combination with auxotype/serotype (A/S) classification to determine the relatedness of N gonorrhoeae strains with plasmid-mediated resistance to tetracycline (TRNG) and to penicillin and tetracycline (PP/TR) which were isolated from patients attending sexually transmitted disease (STD) clinics in four cities in Ohio in 1994.

A total of 591 gonococcal strains were collected from consecutive patients at STD clinics in Cleveland, Akron, Columbus, and Toledo for characterization of their antimicrobial-resistance profiles. Isolates were frozen in trypticase soy broth containing 20% glycerol and provided to the Centers for Disease Control and Prevention (CDC) where they were stored at −70 °C. Isolates were characterized by auxotype, serovar, and plasmid content as described previously.8–10 Agar dilution susceptibilities of isolates to penicillin G and tetracycline were determined and interpreted by National Committee for Clinical Laboratory Standards (NCCLS)-recommended methods as described previously.11,12 Isolates were assigned to penicillin/tetracycline resistance phenotypes as described previously.13,14 Isolates exhibiting MICs of ≥ 4.0 μg/ml of tetracycline were analyzed by PCR to determine the presence of the tetM gene. Subtyping of the tetM determinant was performed by using PCR/restriction analysis as described by Ison et al.7 Briefly, extracted chromosomal DNA was amplified using the primers 5′GGCGTACAAGCACAAACTCG 3′ and 5′TCTCTGTTCAGGTTTACTCG 3′, which amplify a 750-bp region of the tetM gene. PCR reactions consisted of 35 cycles at 94 °C for 15 seconds, 60 °C for 15 seconds, and 72 °C for 2 minutes, with a final extension at 72 °C for 5 minutes. Resulting amplicons were then restricted with HinfI and examined by agarose gel electrophoresis. Dutch-type tetM determinants exhibited bands of 600-bp and 150-bp, while American-type determinants exhibited 350-bp, 250-bp, and 150-bp bands.

The penicillin/tetracycline-resistance phenotypes of the 591 gonococcal isolates examined in the study are shown in Table 1. Of these isolates, 14.6% (86/591) exhibited plasmid-mediated resistance to tetracycline, with seven isolates having an MIC of 8.0 μg/ml and one isolate having an MIC of 4.0 μg/ml; all other isolates had an MIC of ≥16.0 μg/ml. Seventy-two of the isolates were classified as TRNG, whereas 14 were classified as PP/TR. TRNG or PP/TR isolates accounted for 25.6% (20/78) of isolates in Toledo, 8.0% (11/137) in Cleveland, 25.9% (20/77) in Akron, and 11.7% (35/299) in Columbus. These 86 isolates were further analyzed by PCR/restriction analysis to determine the subtype of the tetM gene present in each isolate. Overall, the percentage of isolates containing the American-type tetM gene was 87.2% (75/86), while 12.8% (11/86) contained the Dutch-type tetM gene. Only the American-type tetM gene was observed in isolates from Toledo and Columbus (Table 2). The American and Dutch-type tetM genes were observed in Cleveland and Akron isolates, with the Dutch-type tetM gene accounting for 63.6% (7/11) and 20% (4/20) of isolates, respectively.

TABLE 1
TABLE 1:
Penicillin/Tetracycline Resistance Phenotypes of 591 Isolates ofNeisseria gonorrhoeae Isolated in Four Cities in Ohio, 1994
TABLE 2
TABLE 2:
tetM Gene Type, by City and A/S Classification, for 86 TRNG and PP/TR Isolates of Neisseria gonorrhoeae in Ohio, 1994

We used A/S classification to further determine the diversity of the isolates (Table 2). Isolates that possessed the American-type tetM gene exhibited a diversity of A/S classifications, with nine A/S classes in Columbus, eight in Akron, four in Toledo, and two in Cleveland. Some classes appeared in isolates from more than one location and Proto/IB-6 was present in all four cities (Table 2). By city, the predominant A/S class was Proto/IA-8 in Columbus, Proto/IB-3 in Toledo, and Proto/IA-6 in Cleveland. No A/S class was predominant in Akron. Among isolates containing the Dutch-type tetM gene, 2 A/S classes were present in Cleveland and Akron, with Proto/IA-6 predominating in Cleveland (six of seven isolates) and Proto/IA-1 in Akron (three of four isolates). In some instances, isolates that possessed the same tetM subtype and belonged to the same A/S class were further differentiated by comparison of their penicillin/tetracycline phenotype. Of three isolates from Akron classified as Dutch-type and Proto/IA-1, two isolates were TRNG and one isolate was PP/TR. In Columbus, of 11 isolates classified as American-type and Proto/IA-8, 2 were TRNG and 9 PP/TR; of 7 isolates of American-type and Proto/IB-2, 6 were TRNG and 1 was PP/TR.

Although tetracycline is rarely used to treat gonococcal infections in the United States, it is used in various locations around the world, especially in less developed countries, because of its low cost and availability through non-prescription routes. Therefore, the need to monitor the presence of tetracycline resistant gonococcal isolates continues in that the ability to efficiently subtype tetracycline-resistant isolates through the use of PCR is a useful tool for typing gonococcal strains, in combination with other typing methods such as A/S classification, and useful epidemiologically for monitoring the movement or importation of strains within a geographical region.

In this study, we used PCR/restriction endonuclease analysis to demonstrate the presence of the Dutch-type and American-type tetM genes among the 86 plasmid-mediated tetracycline-resistant gonococcal isolates examined. These results are in agreement with the observations made in a recent study that examined the prevalence of tetM subtypes of tetracycline-resistant strains isolated in the United Kingdom from patients who had been infected at various geographic locations.15 In that study, isolates originating from the Americas, the Caribbean, and Europe possessed both tetM subtypes. However, isolates originating in Africa were almost exclusively (59/60) American-type tetM, whereas those from the Far East contained only the Dutch-type tetM. These results led the authors to suggest that the origins of the American-type tetM and the Dutch-type tetM were Africa and the Far East, respectively.

In our study, the American-type tetM gene was observed in isolates from all four cities while the Dutch-type determinant was present only in Cleveland and Akron. While the close geographic proximity of Cleveland and Akron would suggest that the Dutch-type tetM isolates from these two cities could be identical, further characterization by A/S classification demonstrated that each city had distinct Dutch-type isolates. A/S classification also showed that isolates containing the American-type tetM determinant were diverse at each location and that the predominant A/S class was different at each city. In addition, isolates with the same tetM type and A/S class could be further differentiated by examining an isolate's penicillin/tetracycline phenotype. Therefore, this study also demonstrates the need to use more than one gonococcal typing method to effectively determine the diversity of isolates within a given geographic region. Accurate information as to strain diversity can be used to determine if the isolates present in an outbreak are caused by a single source or multiple sources and therefore allow proper intervention and control measures to be undertaken.

References

1. Sparling PF. Antibiotic resistance in the gonococcus. In: Roberts RB, ed. The gonococcus. New York: John Wiley & Sons, Inc., 1977: 111–136.
2. Knapp JS, Johnson SR, Zenilman JM, et al. High-level tetracycline resistance due to tetM in strains of Neisseria species, Kingella denitrificans, and Eikenella corrodens. Antimicrob Agents Chemother 1988;32:765–767.
3. Knapp JS, Zenilman JM, Biddle JW, et al. Frequency and distribution in the United States of strains of Neisseria gonorrhoeae with plasmid-mediated high-level resistance to tetracycline. J Infect Dis 1987;155:819–822.
4. Oggioni MR, Dowson CG, Smith JM, et al. The tetracycline resistance gene tetM exhibits mosaic structure. Plasmid 1996;35:156–163.
5. Gascoyne DM, Heritage J, Hawkey PM, et al. Molecular evolution of tetracycline-resistance plasmids carrying TetM found in Neisseria gonorrhoeae from different countries. J Antimicrob Chemother 1991;28:173–183.
6. Gascoyne-Binzi DM, Heritage J, Hawkey PM. Nucleotide sequence of the tetM genes from the American and Dutch type tetracycline-resistance plasmids of Neisseria gonorrhoeae. J Antimicrob Chemother 1993;32:667–676.
7. Ison CA, Tekki N, Gill MJ. Detection of the tetM determinant in Neisseria gonorrhoeae. Sex Transm Dis 1993;20:329–333.
8. Meyers JA, Sanchez D, Elwell S, Falkow S. Simple agarose gel electrophoretic method for the identification and characterization of plasmid deoxyribonucleic acid. J Bacteriol 1976;127:1529–1537.
9. Short HB, Ploscowe VB, Weiss JS, Young FE. Rapid method for auxotyping multiple strains of Neisseria gonorrhoeae. J Clin Microbiol 1977;6:244–248.
10. Knapp JS, Tam MR, Nowinski RC, Holmes KK, Sandström EG. Serological classification of Neisseria gonorrhoeae with use of monoclonal antibodies to gonococcal outer membrane protein I. J Infect Dis 1984;150:44–48.
11. National Committee for Clinical Laboratory Standards. Approved standard M7-A3. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. National Committee for Clinical Laboratory Standards, Villanova, Pa. 1993.
12. National Committee for Clinical Laboratory Standards. Performance standards for antimicrobial susceptibility testing. M100-S8. National Committee for Clinical Laboratory Standards, Wayne, Pa. 1998.
13. Rice RJ, Knapp JS. Antimicrobial susceptibilities of Neisseria gonorrhoeae representing five distinct resistance phenotypes. Antimicrob Agents Chemother 1994;38:155–158.
14. Rice RJ, Knapp JS. Susceptibility of Neisseria gonorrhoeae associated with pelvic inflammatory disease to cefoxitin, ceftriaxone, clindamycin, gentamicin, doxycycline, azithromycin, and other antimicrobial agents. Antimicrob Agents Chemother 1994;38:1688–1691.
15. Turner A, Gough KR, Leeming JP. Molecular epidemiology of the tetM genes in Neisseria gonorrhoeae. Sex Transm Infect 1999;75:60–66.
© Copyright 2000 American Sexually Transmitted Diseases Association