INTRODUCTION
It has long been appreciated that inflammatory signaling cascades initiated by the innate immune system can occur via both infectious and noninfectious insults (1-3 4-6 7-10 11 phox , IL-12, IL-15, and cyclooxygenase 2, among others (12, 13 14
The pathophysiology behind the injury of I/R lies not only in the direct cellular damage from the ischemic insult, but also in the activation of inflammatory cascades subsequent to the return of blood flow to the compromised tissue. Although much of the distally acting portions of this process have been defined, the proximal events that initiate the inflammatory response are not yet fully elucidated (15-17 18, 19 20, 21 19, 22 19 18 19
Here we demonstrate that IRF-1 activation contributes to HMGB1 release from hepatocytes during liver I/R. Furthermore, we demonstrate a relationship between TLR4 and IRF-1 in the release of HMGB1 and provide support for IRF-1 in modulating the acetylation status and subsequent release of HMGB1 through histone acetyltransferases (HATs).
MATERIALS AND METHODS
Western blot analysis
Western blot assay using nuclear or whole-cell isolates from liver specimens or hepatocytes (5-20 μg) was performed as previously described (21
Isolation of cytoplasmic and nuclear proteins
Frozen liver tissues were homogenized, and cells from culture harvested for protein isolation. Nuclear and cytoplasmic proteins were isolated according to a technique described previously (23
Immunoprecipitation
A protocol by Santa Cruz Biotechnology was followed. Briefly, 100 μg of whole-liver or cell lysates or 15 μL of serum was diluted with PBS to the volume of 1 mL. They were then precleared for 1 h with 1 μg of normal rabbit IgG (Santa Cruz Biotechnology) and 20 μL of protein A/G PLUS-Agarose (Santa Cruz Biotechnology). They were centrifuged at 5,000 revolutions per min (rpm) for 5 min at 4°C. Next, the supernatants were removed and incubated overnight on a rotating device with 1 μL of primary acetyl-lysine antibody (Cell Signaling, Danvers, Mass) or p300 (Santa Cruz Biotechnology). Twenty microliters of protein A/G PLUS-Agarose was added to the supernatant and was incubated for 3 h. Immunoprecipitates were then collected by centrifugation at 5,000 rpm for 5 min at 4°C, and the supernatants were discarded. The pellets were washed with PBS and centrifuged at 5,000 rpm for 5 min. The washing step was repeated three times. After the final wash, the pellets were collected and resuspended in 40 μL of 3Ă— sample buffer. The samples were boiled for 2 min and run on a 12% agarose gel.
Confocal immunofluorescence imaging
Liver tissue and cultured cells were prepared for immunofluorescence imaging as previously described (24
Animals
Male wild-type (WT) (C57BL/6, and C3H/HeOuj), IRF-1 KO (C57BL/6 IRF-1−/− ), and TLR4-defective (C3H/HeJ) mice (8-12 weeks old) were purchased from the Jackson Laboratory (Bar Harbor, Maine). Animal protocols were approved by the University of Pittsburgh Institutional Animal Care and Use Committee and were performed according to the National Institutes of Health guidelines for the use of laboratory animals.
In vivo experimental designFor adoptive gene transfer experiments, mice were administered intravenous injection (tail vein) of either AdIRF-1 or AdLacZ at doses of 3 Ă— 108 , 1.5 Ă— 109 , or 3 Ă— 109 plaque-forming units (PFUs) for 24 to 48 h before assessment of predetermined end points. For warm liver I/R, WT, IRF-1 KO, and TLR4 mutant mice were subjected to 1 h of ischemia and killed at predetermined reperfusion time points for tissue and serum sample collection.
Liver ischemia
A previously described I/R protocol involving a nonlethal model of segmental (70%) hepatic warm ischemia was used (14
Chimeric mice
Chimeric mice were produced by adoptive transfer of donor bone marrow cells into irradiated recipient animals as previously described (18 −/− ) mice were used in the following recipient-donor combinations: WT/WT, WT/KO, KO/KO, and KO/WT.
Preparation and delivery of adenoviral vectors
An E1- and E3-deleted adenoviral vector carrying the mouse AdIRF-1, AdTLR4, or AdLacZ cDNA was constructed as previously described (25 12 PFUs/mL. For adenoviral gene transfer in vivo , recombinant adenovirus was diluted to an appropriate final concentration in normal saline. The total volume of adenovirus-containing solution was injected intravenously through the tail vein, and the animals were used 24 to 48 h later.
In vitro hepatocyte transfections with AdIRF-1, AdTLR4, or AdLacZ were performed at the titers described. Virus was incubated with the hepatocytes for 4 h in Opti-mem reduced serum media (Gibco Life Technologies, Carlsbad, Calif). After incubation, the media was then removed, and the cells were washed with warmed PBS. Cells were placed in Williams Medium E growth media for 20 h before harvest or treatment.
Construction of an adenovirus vector expressing micro-RNA to block IRF-1 expression
The IRF-1 micro-RNA hairpin structure was obtained from Open Biosystems (Huntsville, Ala). The IRF-1 micro-RNA hairpin sequence is TGCTGTTGACAGTGAGCGACCTGGCTAGAGATGCAGATT ATAGTGAAGCCACAGATGTATAATCTGCATCTCTAGCCAG GGTGCCTACTGCCTCGGA. The target sequences are as follows: Homo sapiens IRF-1 mRNA (NM_002198.1) 3′-UTR 227-245; Mus musculus IRF-1 mRNA (NM_008390.1) 3′-UTR 235-253; and Rattus norvegicus IRF-1 mRNA (NM_012591.1) 3′-UTR 227-245. The IRF-1 micro-RNA hairpin structure was subcloned into the adenoviral shuttle vectors DUAL-BASIC-EGFP (Vector Biolab, Philadelphia, Pa). The expression cassette was transferred into a replication deficiency adenovirus genome vector (human adenovirus type5, dE1/E3). The recombinant adenoviral DNA was linearized and transfected into 293 cells to generate viruses. The virus was purified by centrifugation using two sequential cesium chloride gradients.
Liver function tests
Liver injury assessed by serum alanine aminotransferase (ALT) levels was determined using the HESKA 4000 Dri-chem veterinary chemistry analyzer (HESKA Corporation, Loveland, Colo).
Hepatocyte isolation
Hepatocytes were isolated by an in situ collagenase (type IV; Sigma) perfusion technique, as described previously (19
Cell culture and treatment
Hepatocytes were cultured as previously described (23 2 , 5%CO2 , and 94% N2 ) and placed into a modular incubator chamber (Billups-Rothenberg, Del Mar, Calif), which was flushed with the same hypoxic gas mixture. The cells were exposed to hypoxia for various time points for determination of IRF-1 nuclear localization or HMGB1 release in the supernatants.
Statistical analysis
Results are expressed as means ± SE. Group comparisons were performed using Student t test or ANOVA. Differences were considered significant at P < 0.05.
RESULTS
IRF-1 mediates hepatic HMGB1 release in warm liver I/R injury
We have previously shown that IRF-1 plays an important role in injury after liver I/R as an early immediate transcription factor that is upregulated in the nuclei of hepatocytes (14 Fig. 1A ). In contrast, IRF-1 KO mice released less HMGB1 into the circulation after I/R liver injury. Additionally, immunofluorescence staining of the liver sections was performed to assess changes in hepatocyte HMGB1 content. Both WT and IRF-1 KO animals demonstrated similar baseline levels of nuclear HMGB1 in hepatocytes (Fig. 1B ). After I/R, hepatocytes in the WT mice exhibited decreased nuclear HMGB1 staining, suggesting that nucleocytoplasmic shuttling and release of HMGB1 in hepatocytes had occurred. However, the cells from IRF-1 KO mice had a similar HMGB1 expression pattern before and after I/R, indicating minimal changes in the levels of hepatocellular HMGB1 content.
Fig. 1: IRF-1 mediates hepatic HMGB1 release in warm liver I/R injury . Interferon regulatory factor 1 KO and WT mice (8-12 weeks old) were subjected to 6 h of partial liver warm I/R. Serum and liver specimens were taken when the mice were killed and analyzed for HMGB1. A, Western blot analysis of serum for HMGB1. B, Immunofluorescence staining for HMGB1 was performed on liver sections. Figures are representative of three independent experiments.
IRF-1 overexpression in the liver induces HMGB1 release
To determine the role of IRF-1 in mediating HMGB1 release, we sought to determine if IRF-1 overexpression in the liver, without an ischemic insult, could induce the release of HMGB1. Having previously demonstrated that IRF-1 overexpression can lead to hepatic damage, we first sought to find an inducible level of hepatic nuclear IRF-1 protein expression without causing hepatocellular damage. This was performed to ensure that any HMGB1 release observed with IRF-1 overexpression was due to IRF-1 and not due to hepatocellular damage from adenovirus. We performed intravenous injections of recombinant adenovirus encoding murine IRF-1 (AdIRF-1) or control vector LacZ (AdLacZ) in C57B/6 mice at doses of 3 Ă— 108 , 1.5 Ă— 109 , and 3 Ă— 109 PFUs, as previously described (14 Fig. 2A ). Mice treated with the lowest dose of AdIRF-1 (3 Ă— 108 PFUs) did not exhibit significant changes to baseline serum ALT levels at 36 h after injection in contrast to mice treated with the higher doses (Fig. 2B ). Additionally, there was no gross histologic damage at this dose (data not shown). We thus chose to continue our experiments using this dose of AdIRF-1. Western blot analysis of the serum of mice treated with 3 Ă— 108 PFUs of AdIRF-1 demonstrated increased levels of serum HMGB1 up to 48 h after treatment compared with AdLacZ-treated mice (Fig. 2C ). In addition, immunofluorescence staining of liver sections from mice treated with AdIRF-1 demonstrated decreased cellular expression of HMGB1 in hepatocytes when compared with AdLacZ treatment (Fig. 2D ). These results suggest that IRF-1 upregulation alone, in the absence of clinically significant liver injury, can induce HMGB1 mobilization and release from hepatocytes.
Fig. 2: IRF-1 overexpression in the liver induces HMGB1 release . C57B/6 mice (8-12 weeks old) underwent adoptive transfer of IRF-1 or control vector LacZ by tail vein injection of varying doses of AdIRF-1 or AdLacZ for predetermined time points. Liver and serum were assessed for IRF-1 expression and presence of HMGB1, respectively. A, Liver nuclear extracts were taken at 36 h after AdIRF-1 or AdLacZ injection at 3 × 108 , 1.5 × 109 , or 3 × 109 PFUs. Western blot analysis on nuclear extracts was performed for IRF-1 to determine expression in the liver (n = 3 per treatment). B, Serum ALT levels were determined at 36 h after treatment with the above doses of AdIRF-1 or AdLacZ. Levels are expressed as mean ± SE (n = 3 per treatment). C, Western blot analysis for HMGB1 of serum from mice injected with 3 × 108 PFUs of AdIRF-1 or AdLacZ at 36 and 48 h. Blot is representative of three independent experiments. D, Immunofluorescence staining for HMGB1 of liver sections from mice treated with 3 × 108 PFUs of AdIRF-1 or AdLacZ; HMGB1 is shown in green. Figures are representative of three independent experiments.
HMGB1 release from hepatocytes under oxidative stress is IRF-1 dependent
Tissue hypoxia is a major component of the in vivo I/R insult, and we have previously observed that oxidative stress induced by hypoxia leads to HMGB1 release by hepatocytes in a process dependent on reactive oxygen species (19 in vitro hypoxia has some differences from in vivo I/R, this model produces a similar oxidative stress on the cells and is used here to augment our in vivo studies using the I/R model. Our previous work indicates that the initial hypoxia-induced HMGB1 release by hepatocytes is primarily an active process and not due to necrosis (19, 26, 27 Fig. 3A ). Actin and LDH levels were not significantly different between WT and IRF-1 KO cells exposed to hypoxia compared with control cells (data not shown), confirming that IRF-1-induced HMGB1 release from hepatocytes undergoing oxidative stress is not due to differences in cell death but an active process regulated by IRF-1.
Fig. 3: HMGB1 release from hepatocytes under oxidative stress is IRF-1 dependent . Primary cultured hepatocytes were plated in serum-free Williams Medium E and placed under hypoxic (1% oxygen) or normoxic conditions with or without prior adoptive gene transfer of IRF-1 (AdIRF-1), LacZ (AdLacZ), or IRF-1 shRNA (AdIRF-1shRNA) by adenoviral delivery. A, Western blot analysis for HMGB1 of supernatants from hypoxic or normoxic WT and IRF-1 KO hepatocytes (8 h hypoxia). B, Western blot analysis of supernatants from normoxic hepatocytes 18 h after adoptive gene transfer with AdIRF-1 or AdLacZ at MOI 10, 50, or 100. C, Western blot analysis of supernatants for HMGB1 and nuclear extracts for IRF-1 from hepatocytes pretreated with AdIRF-1 (MOI 100) or AdIRF-1shRNA (MOI 50) after 8 h of hypoxia. Figures are representative of at least three independent experiments.
To confirm the role of IRF-1 in regulating the release of HMGB1 from hepatocytes, we overexpressed nuclear IRF-1 in cultured hepatocytes with AdIRF-1 or control AdLacZ at multiplicity of infection (MOI) 10, 50, and 100 in the absence of oxidative stress. Examination of the supernatants by Western blot 18 h after gene transfer revealed that overexpression of nuclear IRF-1 protein promoted the extracellular release of HMGB1 from hepatocytes into the supernatant (Fig. 3B ). Cell viability, as determined by actin and LDH in the supernatant, was also not significantly different in cells treated with any dose of AdIRF-1 when compared with AdLacZ or baseline (data not shown). Finally, to determine if blocking IRF-1 upregulation would abrogate the effect of hypoxia-induced HMGB1 release, we performed adenoviral gene transfer of IRF-1 shRNA to hepatocytes before hypoxia. Inhibition of IRF-1 resulted in reduced HMGB1 release into the supernatant after 8 h of hypoxia when compared with control hepatocytes (Fig. 3C ). These findings suggest that the active release of HMGB1 from hepatocytes under oxidative stress is IRF-1 dependent.
Functional TLR4 signaling is required for IRF-1 expression during oxidative stress
Although IRF-1 levels are regulated in response to various stimuli such as IFNs (types I and II), double-stranded RNA, cytokines, and hormones (12, 13 Fig. 4A ). This finding was also confirmed with immunofluorescence imaging of hypoxic hepatocytes (Fig. 4B ). Because we have previously shown that TLR4 participates in hypoxia-induced reactive oxygen species production (19 Fig. 4, B and C ). To confirm that functional TLR4 signaling was involved in IRF-1 expression in hepatocytes during hypoxia, TLR4 mutant hepatocytes were transfected with recombinant adenovirus carrying WT TLR4 (Ad-TLR4). Interestingly, transfection with WT TLR4 in the mutant hepatocytes increased the level of nuclear IRF-1 in hypoxia (Fig. 4C ). This effect was not seen when mutant cells were transfected with the empty adenoviral vector control in hypoxia (data not shown). To determine if IRF-1 activity is TLR4 dependent in vivo , we examined hepatic nuclear extracts from TLR4 WT and mutant mice subjected to 1 h of ischemia and 3 h of reperfusion; TLR4 WT mice subjected to liver I/R exhibited increased IRF-1 expression compared with the TLR4 mutant mice (Fig. 4D ). Together, these findings demonstrate that IRF-1 expression during hypoxia and liver I/R is TLR4 dependent.
Fig. 4: Functional TLR4 signaling is required for IRF-1 expression during oxidative stress . A, Western blot analysis for IRF-1 of nuclear extracts from cultured hepatocytes at baseline, or after 1, 3, 6, or 12 h of hypoxia (1% oxygen). Figure is reperesentative of three independent experiments. B, Immunofluorescence staining for IRF-1 (green) of TLR4 mutant (C3HeJ) and WT (C3HeOuJ) hepatocytes subjected to 1 h of hypoxia. Figure is reperesentative of three independent experiments. C, Western blot analysis for IRF-1 on nuclear extracts from TLR4 mutant (C3HeJ) and WT (C3HeOuJ) hepatocytes subjected to 1 h of hypoxia with or without prior adenoviral gene transfer of TLR4 (AdTLR4). Figure is representative of three independent experiments. D, TLR4 mutant and WT mice were subjected to 1 h of partial liver ischemia followed by 3 h of reperfusion. Western blot analysis for IRF-1 was performed on heptic nuclear extracts. Each lane represents a different animal. Figure is representative of two independent experiments.
HMGB1 release after liver I/R is dependent on hepatocyte IRF-1 expression
Immune cells and hepatic parenchymal cells have both been implicated in contributing to liver I/R injury. Although our above findings demonstrate the upregulation of IRF-1 and subsequent release of HMGB1 from cultured hepatocytes after oxidative stress, it is unknown if IRF-1 in other cells types of the liver is important in vivo for the inflammatory response and organ injury after liver I/R. The liver consists of parenchymal cells (hepatocytes) and nonparenchymal cells, including Kupffer cells, sinusoidal endothelial cells, stellate cells, and hepatic dendritic cells. Because IRF-1 can be expressed in both hepatocytes and nonparenchymal cells, we sought to determine if hepatocyte IRF-1 was essential to the release of HMGB1 in vivo . We thus generated IRF-1 chimeric mice by adoptive transfer of donor bone marrow cells into irradiated recipient animals using combinations of IRF-1 WT and IRF-1 KO mice. To confirm successful engraftment of donor cells in chimeric animals, expression of IRF-1 protein in the bone marrow-derived cells of chimeric mice was confirmed by Western blot analysis of whole-spleen homogenates (Fig. 5A ). To determine the cell type in the liver important in IRF-1-mediated inflammation and injury, IRF-1 chimeric mice were subjected to I/R. We found that mice with IRF-1-deficient hepatocytes (but IRF-1-competent cells of bone marrow origin) were protected after liver I/R when compared with mice with IRF-1-competent hepatocytes (but IRF-1-deficient cells of bone marrow origin) (Fig. 5B ). Mice deficient in hepatocyte IRF-1 also demonstrated lower circulating levels of HMGB1 when compared with chimeric mice that have hepatocyte IRF-1 (Fig. 5C ), suggesting that hepatocyte IRF-1 is primarily responsible for the release of HMGB1 after hepatic I/R. Additionally, immunofluorescence of liver sections from the chimeric mice deficient for IRF-1 in the hepatocytes (IRF-1 WT donor to KO recipient) had more HMGB1 retained in the liver compared with mice containing hepatocyte IRF-1 expression (IRF-1 KO donor to WT recipient) (Fig. 5D ). Taken together, these findings demonstrate that HMGB1 release from the liver after I/R is mainly dependent on the ability of hepatocytes, not cells of bone marrow origin, to upregulate nuclear IRF-1.
Fig. 5: HMGB1 release after liver I/R is dependent on hepatocyte IRF-1 expression . Chimeric mice were produced by adoptive transfer of donor bone marrow cells into irradiated recipient animals using combinations of IRF-1 WT (C57B/6) and IRF-1 KO (C57B/6 IRF-1−/− ) mice in the following recipient/donor combinations: WT/WT, WT/KO, KO/KO, and KO/WT. A, Expression of IRF-1 protein in the bone marrow-derived cells of chimeric mice was confirmed by Western blot analysis of whole-spleen homogenates. Figure is representative of three independent experiments. B, IRF-1 chimeric mice were subjected to 6 h of partial liver warm I/R. Serum ALT levels were assessed. Values are expressed as mean ± SE (n = 6-8 mice per chimera; *P < 0.05). C, Western blot analysis of serum for HMGB1 from WT/KO and KO/WT chimeric mice after 6-h liver I/R. Figure is representative of three independent experiments (D) Immunofluorescence staining for HMGB1 from liver sections of WT/KO and KO/WT chimeric mice after 6-h liver I/R. Figure is representative of three independent experiments.
Liver I/R induces IRF-1-dependent HMGB1 acetylation
The acetylation status of HMGB1 is involved in regulating HMGB1's DNA-binding properties along with its subcellular location. Acetylation of HMGB1 lysine residues modulates its nuclear export signal, causing it to be translocated from the nucleus to the cytoplasm, with subsequent ready release into the extracellular space (28 Fig. 6A ). To determine if the acetylation of HMGB1 was dependent on the presence of IRF-1, we examined the acetylation status of HMGB1 in the livers of WT and IRF-1 KO mice subjected to I/R. Immunoprecipitation and Western blot analysis of acetylated HMGB1 revealed decreased acetylated HMGB1 in the livers of IRF-1 KO mice, demonstrating the importance of IRF-1 in HMGB1 acetylation and subsequent release (Fig. 6B ).
Fig. 6: Liver I/R induces IRF-1-dependent HMGB1 acetylation . C57B/6 mice (8-12 weeks old) were subjected to various time points of warm liver I/R. A,Immunoprecipitation with 10 μL of acetyl-lysine antibody was performed on mouse serum after warm I/R. Negative control is immunoprecipitation with rabbit IgG. The precipitates were then subjected to Western blot analysis for HMGB1. Figure is representative of three independent experiments. B, Mouse whole-liver extracts were taken at baseline, or after 1 h of ischemia and 3 h of reperfusion. Immunoprecipitation with 10 μL of HMGB1 antibody was performed on 100 μg of whole-liver extracts. Negative control is immunoprecipitation with rabbit IgG of extracts from baseline liver. The precipitates were then subjected to Western blot analysis for acetylated proteins. Figure is representative of three independent experiments.
IRF-1 modulates HAT activity in liver I/R
Previous studies have shown that IRF-1 can closely interact with HAT enzymes in the nucleus and influence their activity on nuclear proteins (29 30, 31 Fig. 7A ). Additionally, garcinol inhibition of HMGB1 release into the supernatant is shown by Western blot (Fig. 7B ). Because IRF-1 has been shown to directly interact and enhance the acetylation activity of HAT p300 (29 Fig. 7C ).
Fig. 7: IRF-1 modulates HAT activity in liver I/R . Primary cultured hepatocytes were plated in serum-free Williams Medium E and placed under hypoxic (1%oxygen) or normoxic conditions with or without prior treatment with 1.25 μM garcinol. Interferon regulatory factor 1 KO and WT mice (8-12 weeks old) were subjected to 3 h of partial liver warm I/R. Nuclear or whole-liver homogenates were extracted from the ischemic lobes. A, Immunofluorescence staining for HMGB1 (green) of WT hepatocytes subjected to 8 h of hypoxia with or without garcinol pretreatment. Figure is representative of three independent experiments. B, Western blot analysis of supernatants for HMGB1 from mouse hepatocytes in normoxic and hypoxic conditions with or without pretreatment with 1.25 μM garcinol shows inhibition of HMGB1 release by garcinol. Figure is representative of three independent experiments. C, Wild-type whole-liver extracts were taken at baseline, or after a time course of I/R. Immunoprecipitation with 10 μL of p300 antibody was performed on 100 μg of whole-liver extracts. Negative control is with rabbit IgG from baseline liver. The precipitates were then subjected to Western blot analysis for IRF-1. Figure is representative of at least three independent experiments.
DISCUSSION
The IRF family is a diverse and ubiquitous group of regulatory proteins that are involved in cellular differentiation, gene expression, and inflammation (10 7, 8 32, 33 Fig. 8 ).
Fig. 8: Proposed mechanism of IRF-1-mediated mobilization and release of HMGB1 from hepatocytes during I/R injury.
Hepatocytes play a crucial role in the inflammatory response after infectious and sterile insults by upregulating and secreting inflammatory mediators. Although the distal cascade of inflammatory responses resulting from the activation of immune cells after I/R injury has been studied extensively, the process by which the initial cellular injury after a noninfectious ischemic insult contributes to activation of immune responses is poorly understood. Although our previous studies suggest that the mobilization and release of a key DAMP, HMGB1, from stressed hepatocytes are one of the earliest events to notify adjacent immune cells of impending tissue injury, the pathways governing HMGB1 release from hepatocytes are unclear. Our findings demonstrate that early HMGB1 nucleocytoplasmic shuttling and release in hepatocytes during oxidative stress are active, regulated processes that occur in the absence of cellular death (19 34-38 39
In this study, we identified the pattern recognition receptor (PRR), TLR4, as necessary for the activation of IRF-1. The TLR family of PRR has been implicated as playing a pivotal role in many inflammatory processes, including liver I/R (23, 40, 41 23 42, 43 44 14
Posttranslational modifications by intracellular enzymes, such as acetylation, have been associated with nucleocytoplasmic shuttling of HMGB1 during LPS stimulation in macrophages (28 29
Studies on the inflammatory response caused by liver I/R injury have provided interesting mechanistic insights into the activation and regulation of the innate immune system during "sterile" tissue injury. It is becoming increasingly clear that the activation of PRRs and the release of DAMPs play key roles in this process. Understanding the relationship between DAMP-PRR signaling and key downstream signaling pathways could lead to the identification of unique therapeutic targets. In this study, three key regulators of immune function seem to be linked: the proximally acting PRR TLR4, the global intracellular inflammatory mediator IRF-1, and the extracellular DAMP HMGB1. Our observations provide a novel mechanistic relationship between TLR4, HMGB1, and IRF-1 that could have broad implications to other inflammatory responses and stress.
ACKNOWLEDGMENTS
The authors thank Zongxian Cao for assistance with viral constructs and N. L. Martik and X. Liao for technical support.
REFERENCES
1. Matzinger P: Tolerance, danger, and the extended family.
Annu Rev Immunol 12:991-1045, 1994.
2. Matzinger P: The danger model: a renewed sense of self.
Science 296(5566):301-305, 2002.
3. Medawar P: Immunological Tolerance. In:
Nobel Lectures, Physiology or Medicine 1942-1962 . Amsterdam, The Netherlands: Elsevier Publishing Company, 1964.
4. Bianchi ME, Manfredi AA: Immunology. Dangers in and out.
Science 323(5922):1683-1684, 2009.
5. Medzhitov R, Janeway CA Jr: Decoding the patterns of self and nonself by the innate immune system.
Science 296(5566):298-300, 2002.
6. Palumbo R, Galvez BG, Pusterla T, De MF, Cossu G, Marcu KB, Bianchi ME: Cells migrating to sites of tissue damage in response to the danger signal HMGB1 require NF-kappaB activation.
J Cell Biol 179(1):33-40, 2007.
7. Fujita T, Kimura Y, Miyamoto M, Barsoumian EL, Taniguchi T: Induction of endogenous IFN-alpha and IFN-beta genes by a regulatory transcription factor, IRF-1.
Nature 337(6204):270-272, 1989.
8. Honda K, Taniguchi T: IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors.
Nat Rev Immunol 6(9):644-658, 2006.
9. Ozato K, Tailor P, Kubota T: The interferon regulatory factor family in host defense: mechanism of action.
J Biol Chem 282(28):20065-20069, 2007.
10. Tamura T, Yanai H, Savitsky D, Taniguchi T: The IRF family transcription factors in immunity and oncogenesis.
Annu Rev Immunol 26:535-584, 2008.
11. Miyamoto M, Fujita T, Kimura Y, Maruyama M, Harada H, Sudo Y, Miyata T, Taniguchi T: Regulated expression of a gene encoding a nuclear factor, IRF-1, that specifically binds to IFN-beta gene regulatory elements.
Cell 54(6):903-913, 1988.
12. Geller DA, Nguyen D, Shapiro RA, Nussler A, Di SM, Freeswick P, Wang SC, Tweardy DJ, Simmons RL, Billiar TR: Cytokine induction of interferon regulatory factor-1 in hepatocytes.
Surgery 114(2):235-242, 1993.
13. Kroger A, Koster M, Schroeder K, Hauser H, Mueller PP: Activities of IRF-1.
J Interferon Cytokine Res 22(1):5-14, 2002.
14. Tsung A, Stang MT, Ikeda A, Critchlow ND, Izuishi K, Nakao A, Chan MH, Jeyabalan G, Yim JH, Geller DA: The transcription factor interferon regulatory factor-1 mediates liver damage during ischemia-reperfusion injury.
Am J Physiol Gastrointest Liver Physiol 290(6):G1261-G1268, 2006.
15. Clavien PA, Rudiger HA, Selzner M: Mechanism of hepatocyte death after ischemia: apoptosis versus necrosis.
Hepatology 33(6):1555-1557, 2001.
16. Jaeschke H: Molecular mechanisms of hepatic ischemia-reperfusion injury and preconditioning.
Am J Physiol Gastrointest Liver Physiol 284(1):G15-G26, 2003.
17. Mavier P, Preaux AM, Guigui B, Lescs MC, Zafrani ES, Dhumeaux D:
In vitro toxicity of polymorphonuclear neutrophils to rat hepatocytes: evidence for a proteinase-mediated mechanism.
Hepatology 8(2):254-258, 1988.
18. Tsung A, Hoffman RA, Izuishi K, Critchlow ND, Nakao A, Chan MH, Lotze MT, Geller DA, Billiar TR: Hepatic ischemia/reperfusion injury involves functional TLR4 signaling in nonparenchymal cells.
J Immunol 175(11):7661-7668, 2005.
19. Tsung A, Klune JR, Zhang X, Jeyabalan G, Cao Z, Peng X, Stolz DB, Geller DA, Rosengart MR, Billiar TR: HMGB1 release induced by liver ischemia involves Toll-like receptor 4 dependent reactive oxygen species production and calcium-mediated signaling.
J Exp Med 204(12):2913-2923, 2007.
20. Shen XD, Ke B, Zhai Y, Gao F, Tsuchihashi S, Lassman CR, Busuttil RW, Kupiec-Weglinski JW: Absence of toll-like receptor 4 (TLR4) signaling in the donor organ reduces ischemia and reperfusion injury in a murine liver transplantation model.
Liver Transpl 13(10):1435-1443, 2007.
21. Zhai Y, Qiao B, Shen XD, Gao F, Busuttil RW, Cheng G, Platt JL, Volk HD, Kupiec-Weglinski JW: Evidence for the pivotal role of endogenous toll-like receptor 4 ligands in liver ischemia and reperfusion injury.
Transplantation 85(7):1016-1022, 2008.
22. Katsargyris A, Klonaris C, Alexandrou A, Giakoustidis AE, Vasileiou I, Theocharis S: Toll-like receptors in liver ischemia reperfusion injury: a novel target for therapeutic modulation?
Expert Opin Ther Targets 13(4):427-442, 2009.
23. Tsung A, Sahai R, Tanaka H, Nakao A, Fink MP, Lotze MT, Yang H, Li J, Tracey KJ, Geller DA, et al.: The nuclear factor HMGB1 mediates hepatic injury after murine liver ischemia-reperfusion.
J Exp Med 201(7):1135-1143, 2005.
24. Cardinal J, Pan P, Dhupar R, Ross M, Nakao A, Lotze M, Billiar T, Geller D, Tsung A: Cisplatin prevents high mobility group box 1 release and is protective in a murine model of hepatic ischemia/reperfusion injury.
Hepatology 50(2):565-574, 2009.
25. Kim PK, Armstrong M, Liu Y, Yan P, Bucher B, Zuckerbraun BS, Gambotto A, Billiar TR, Yim JH: IRF-1 expression induces apoptosis and inhibits tumor growth in mouse mammary cancer cells
in vitro and
in vivo .
Oncogene 23(5):1125-1135, 2004.
26. Kim PK, Vallabhaneni R, Zuckerbraun BS, McCloskey C, Vodovotz Y, Billiar TR: Hypoxia renders hepatocytes susceptible to cell death by nitric oxide.
Cell Mol Biol (Noisy -le-grand) 51(3):329-335, 2005.
27. Vodovotz Y, Kim PK, Bagci EZ, Ermentrout GB, Chow CC, Bahar I, Billiar TR: Inflammatory modulation of hepatocyte apoptosis by nitric oxide:
in vivo ,
in vitro , and in silico studies.
Curr Mol Med 4(7):753-762, 2004.
28. Bonaldi T, Talamo F, Scaffidi P, Ferrera D, Porto A, Bachi A, Rubartelli A, Agresti A, Bianchi ME: Monocytic cells hyperacetylate chromatin protein HMGB1 to redirect it towards secretion.
EMBO J 22(20):5551-5560, 2003.
29. Dornan D, Eckert M, Wallace M, Shimizu H, Ramsay E, Hupp TR, Ball KL: Interferon regulatory factor 1 binding to p300 stimulates DNA-dependent acetylation of p53.
Mol Cell Biol 24(22):10083-10098, 2004.
30. Bolden JE, Peart MJ, Johnstone RW: Anticancer activities of histone deacetylase inhibitors.
Nat Rev Drug Discov 5(9):769-784, 2006.
31. Calao M, Burny A, Quivy V, Dekoninck A, Van LC: A pervasive role of histone acetyltransferases and deacetylases in an NF-kappaB-signaling code.
Trends Biochem Sci 33(7):339-349, 2008.
32. Lotze MT, Tracey KJ: High-mobility group box 1 protein (HMGB1): nuclear weapon in the immune arsenal.
Nat Rev Immunol 5(4):331-342, 2005.
33. Wang H, Bloom O, Zhang M, Vishnubhakat JM, Ombrellino M, Che J, Frazier A, Yang H, Ivanova S, Borovikova L, et al.: HMG-1 as a late mediator of endotoxin lethality in mice.
Science 285(5425):248-251, 1999.
34. Clarke CN, Kuboki S, Tevar A, Lentsch AB, Edwards M: CXC chemokines play a critical role in liver injury, recovery, and regeneration.
Am J Surg 198(3):415-419, 2009.
35. Lentsch AB, Yoshidome H, Kato A, Warner RL, Cheadle WG, Ward PA, Edwards MJ: Requirement for interleukin-12 in the pathogenesis of warm hepatic ischemia/reperfusion injury in mice.
Hepatology 30(6):1448-1453, 1999.
36. Takamatsu Y, Shimada K, Yamaguchi K, Kuroki S, Chijiiwa K, Tanaka M: Inhibition of inducible nitric oxide synthase prevents hepatic, but not pulmonary, injury following ischemia-reperfusion of rat liver.
Dig Dis Sci 51(3):571-579, 2006.
37. Tsuchihashi S, Kaldas F, Chida N, Sudo Y, Tamura K, Zhai Y, Qiao B, BusuttilRW, Kupiec-Weglinski JW: FK330, a novel inducible nitric oxide synthase inhibitor, prevents ischemia and reperfusion injury in rat liver transplantation.
Am J Transplant 6(9):2013-2022, 2006.
38. Tsuchihashi S, Zhai Y, Bo Q, Busuttil RW, Kupiec-Weglinski JW: Heme oxygenase-1 mediated cytoprotection against liver ischemia and reperfusion injury: inhibition of type-1 interferon signaling.
Transplantation 83(12):1628-1634, 2007.
39. Ueki S, Dhupar R, Cardinal J, Tsung A, Yoshida J, Ozaki KS, Klune JR, Murase N, Geller DA: Critical role of interferon regulatory factor-1 in murine liver transplant ischemia reperfusion injury.
Hepatology 51(5):1692-1701, 2010.
40. Bamboat ZM, Balachandran VP, Ocuin LM, Obaid H, Plitas G, Dematteo RP: Toll-like receptor 9 inhibition confers protection from liver ischemia-reperfusion injury.
Hepatology 51(2):621-632, 2010.
41. Zhai Y, Shen XD, O'Connell R, Gao F, Lassman C, Busuttil RW, Cheng G, Kupiec-Weglinski JW: Cutting edge: TLR4 activation mediates liver ischemia/reperfusion inflammatory response via IFN regulatory factor 3-dependent MyD88-independent pathway.
J Immunol 173(12):7115-7119, 2004.
42. Honda K, Yanai H, Mizutani T, Negishi H, Shimada N, Suzuki N, Ohba Y, Takaoka A, Yeh WC, Taniguchi T: Role of a transductional-transcriptional processor complex involving MyD88 and IRF-7 in Toll-like receptor signaling.
Proc Natl Acad Sci U S A 101(43):15416-15421, 2004.
43. Takaoka A, Yanai H, Kondo S, Duncan G, Negishi H, Mizutani T, Kano S, Honda K, Ohba Y, Mak TW, et al.: Integral role of IRF-5 in the gene induction programme activated by Toll-like receptors.
Nature 434(7030):243-249, 2005.
44. Negishi H, Fujita Y, Yanai H, Sakaguchi S, Ouyang X, Shinohara M, Takayanagi H, Ohba Y, Taniguchi T, Honda K: Evidence for licensing of IFN-gamma-induced IFN regulatory factor 1 transcription factor by MyD88 in Toll-like receptor-dependent gene induction program.
Proc Natl Acad Sci U S A 103(41):15136-15141, 2006.
