Secondary Logo

Journal Logo

Basic Science Aspects

Modulation of the HGF/c-Met Axis Impacts Prolonged Hematopoietic Progenitor Mobilization Following Trauma and Chronic Stress

Loftus, Tyler J.; Kannan, Kolenkode B.; Mira, Juan C.; Brakenridge, Scott C.; Efron, Philip A.; Mohr, Alicia M.

Author Information
doi: 10.1097/SHK.0000000000001506
  • Free
  • Editor's Choice

Abstract

INTRODUCTION

Following traumatic injury and hemorrhagic shock, there is increased mobilization of hematopoietic progenitor cells (HPC) from the bone marrow to peripheral blood and sites of injury (1, 2). This process appears to be necessary for wound healing and tissue repair, but prolonged HPC mobilization and loss of these progenitor cells from the bone marrow is also associated with bone marrow dysfunction and anemia (3, 4). Activation of the granulocyte colony-stimulating factor (G-CSF)/stromal cell derived factor-1 (SDF-1) axis hones HPCs to the site of injury (5, 6). Early mobilization of HPCs following traumatic injury and hemorrhagic shock has been associated with elevation of plasma G-CSF 24 h after injury, and exogenous administration of G-CSF and SDF-1 to rats subjected to traumatic injury and hemorrhagic shock has been shown to increase HPC mobilization to injured tissue 5 days after injury (5, 6).

Our understanding of post-traumatic HPC mobilization remains incomplete. Downstream of the G-CSF/SDF-1 axis, hepatocyte growth factor (HGF), tyrosine-protein kinase Met (c-Met), matrix-metallopeptidase-9 (MMP-9), and circulating corticosterone may each play a role in this process. HGF is produced by bone marrow leukocytes in response to G-CSF/SDF-1 activation and interacts with c-Met, its receptor on HPCs. HGF/c-Met interaction is a process that may be best known for its role in propagating malignant potential and promoting stem and progenitor cell homing following bone marrow transplantation, but has also been implicated in stress-induced HPC mobilization (4, 7, 8). Tesio et al. (4) demonstrated that G-CSF induces c-Met expression and signaling leading to HPC mobilization, and that c-Met inhibition decreases HPC mobilization by interfering with chemotactic migration toward SDF-1 in a process mediated by reactive oxygen species signaling. MMP-9, produced by bone marrow leukocytes and HPCs in response to G-CSF activation and pro-inflammatory cytokines, also appears to be an important mediator of stress-induced HPC mobilization (9, 10). Kollet et al. (10) found that his process occurs in both murine and human HPC mobilization, demonstrating that neutralization of the SDF-1 receptor CXCR4 disrupted this process and that exogenous SDF-1 restored mobilization, suggesting causality. Circulating corticosterone, under the direct influence of the neuroendocrine stress response, has also been shown to promote hematopoietic stem cell mobilization (11). Pierce et al. (11) reported that corticosterone promotes hematopoietic stem cell mobilization by upregulating actin-organizing molecules and interacts with the Nr3c1 glucocorticoid receptor, which is nearly ubiquitous on human cells and influences several stress-response pathways.

The effects of traumatic injury and chronic stress on HGF, c-Met, MMP-9, and corticosterone have not been reported, and the impact of propranolol and clonidine on this pathway is unknown. We hypothesized that 7 days following severe trauma and chronic stress, rats would have increased bone marrow expression of HGF, c-Met, and MMP-9 as well as increased plasma corticosterone levels, increased HPC mobilization that is associated with decreased hemoglobin levels. Further, we hypothesized that beta blockade with propranolol and sympathetic outflow inhibition with clonidine would decrease HGF, c-Met, MMP-9, corticosterone, and HPC mobilization, resolving persistent injury-associated anemia.

METHODS

Animals

Male Sprague-Dawley rats (Charles River, Raleigh, NC) weighing 300 g to 400 g were housed in pairs and fed ad lib with Teklad Diet #7912 (Harlan Laboratories Inc, Tampa, Fla) and water during a 1 week acclimation period. Light and dark cycles were 12 h each throughout acclamation and experimental periods. All animal care was conducted in accordance with University of Florida Institutional Animal Care and Use Committee standards. Animal injury models were performed as previously described, using isolated lung contusion to recapitulate blunt trauma, using lung contusion with hemorrhagic shock to recapitulate blunt trauma with life-threatening hemorrhage, and using lung contusion with hemorrhagic shock followed by chronic stress in a restraint cylinder to recapitulate blunt trauma with life-threatening hemorrhage followed by daily stressors or the intensive care unit (ICU) environment associated with hypercatecholaminemia, neuroendocrine activation, and bone marrow dysfunction manifest as anemia which is reversible by attenuating the impact of hypercatecholaminemia and neuroendocrine activation with propranolol or clonidine (12, 13). Animals were randomized to 10 groups, as listed in Table 1. Animals were sacrificed on postinjury day seven by cardiac puncture following intraperitoneal injection of ketamine (80 mg/kg to100 mg/kg) and xylazine (5 mg/kg to10 mg/kg). Bone marrow, peripheral blood, and plasma were collected.

Table 1
Table 1:
Injury model groups.

Lung contusion

Prior to performing LC, animals were anesthetized by intraperitoneal injection of sodium pentobarbital (50 mg/kg). LC was performed by applying a percussive staple gun (PowerShot Model 5700 M, Saddle Brook, NJ) to a 12 mm metal plate applied to the right lateral chest wall 1 cm to 2 cm below the axillary fold. This technique generates a clinically significant and reproducible pulmonary contusion, based on histologic findings (3, 14, 15).

Hemorrhagic shock

Immediately following LC, animals randomized to LCHS or LCHS/CS were placed on a heating pad to maintain normothermia, and PE-50 tubing was inserted into the right internal jugular vein and right femoral artery under direct visualization. The arterial catheter was applied to a BP-2 Digital Blood Pressure Monitor (Columbus Instruments, Columbus, Ohio) for continuous blood pressure monitoring. Blood was withdrawn through the venous catheter into a heparinized syringe until a mean arterial pressure of 30 mm Hg to 35 mm Hg was reached. This blood pressure range was maintained for 45 min by withdrawing or reinfusing blood as needed. After 45 min, shed blood was reinfused at 1 mL/min. No additional resuscitation fluids were administered.

Chronic stress

Chronic restraint stress was incorporated to simulate stressors associated with the intensive care unit environment for human trauma patients. For animals randomized to LCHS/CS, CS began 1 day after LCHS, and was performed by placing animals in a restraint cylinder (Kent Scientific, Torrington, Conn) for 2 h each day until sacrifice on day 7. To prevent acclimation, the cylinders were rotated 180° every 30 min, and alarms (80 dB) were transmitted by speakers adjacent to the restraint cylinders for 2 min each time the cylinders were rotated. Previous work demonstrates that these interventions induce neuroendocrine activation and inflammation consistent with chronic stress associated with severe injury and ICU admission for trauma patients (16, 17). All non-CS groups were subjected to a 2 h daily fast while CS was being performed.

Propranolol and clonidine

Propranolol and clonidine were administered by intraperitoneal injection 10 min following resuscitation from hemorrhagic shock (i.e., systolic blood pressure 80 mm Hg), and then daily for 6 days following CS or daily handling. Propranolol and clonidine doses were 10 mg/kg and 75 μg/kg, respectively, based on previous work demonstrating the safety and efficacy of these doses in reducing heart rate by 10% to 20% without causing significant hypotension (14, 18). There were occasional mild decreases in systolic blood pressure (≤ 10 mm Hg) following propranolol or clonidine administration but no apparent cases of medication-induced of shock following propranolol or clonidine administration.

Bone marrow HGF, c-Met, and MMP-9

Bone marrow HGF, c-Met, and MMP-9 were chosen as analytes because they have been implicated in the pathophysiology of stress-induced HPC mobilization (4–6, 9, 10). Bone marrow expression of HGF, c-Met, and MMP-9 were assessed by real-time polymerase chain reaction. The following primers were used: HGF: forward 5’ tgcaacggtgaaagctacag, reverse 5’ agcccttgtcgggatatctt (product region: 785–908, product size: 124 base pairs), C-Met: forward 5’ gaggaagagtcaggccagtg, reverse 5’ tcgggagggtaggaagagtt (product region: 499–626, product size: 128 base pairs), MMP-9: forward 5’ cactgtaactgggggcaact, reverse 5’ agagtactgcttgcccagga (product region: 1008–1080, product size: 73 base pairs). Results were presented as mRNA fold change relative to naive expression levels.

Plasma corticosterone

Plasma corticosterone was chosen as an analyte because it has been implicated in the pathophysiology of stress-induced HPC mobilization (11). Plasma corticosterone was measured by enzyme linked immunosorbent assay (Abcam, Cambridge, Mass) performed according to the manufacturer's instructions with samples run in duplicate.

Hematopoietic progenitor mobilization

Mobilization of hematopoietic progenitor cells from the bone marrow to peripheral blood was assessed by flow cytometry. Blood was stained with CD71 antibodies (BD Biosciences, San Jose, Calif) to identify hematopoietic progenitors, which are more differentiated than hematopoietic stem cells. (Southern Biotech, Birmingham, Ala) conjugated to phycoerythrin (BD Biosciences, San Jose, Calif). Hematopoietic progenitors were identified as CD71+/c-kit+, analyzed by a BD LSR II flow cytometer with FACSDiva software (BD Biosciences, San Jose, Calif).

Hemoglobin

Peripheral blood hemoglobin levels (g/dL) were assessed in heparinized whole blood samples by a hematology analyzer (Abaxis, Union City, Calif).

Statistical analysis

Statistical analysis was performed using GraphPad Prism version 6.05 (GraphPad Software, La Jolla, Calif) to calculate one-way analysis of variance. Data were reported as mean ±standard deviation. Significance was set at α = 0.05. In figures, a single asterisk (∗) was used to denote P < 0.05 compared with naive animals; two asterisks (∗∗) were used to denote P < 0.05 compared with untreated counterparts who had the same injury but did not receive propranolol or clonidine.

RESULTS

Bone marrow HGF, c-Met, and MMP-9

Bone marrow expression of HGF, c-Met, and MMP-9 is illustrated in Figure 1A–C. LC, LCHS, and LCHS/CS groups had increasing bone marrow expression of HGF, c-Met, MMP-9 that correlated with increasing injury severity, i.e., LC < LCHS < LCHS/CS. Compared with naive animals, LCHS/CS animals had significantly higher bone marrow expression of HGF (2.3 ± 0.9, P <0.001) and MMP-9 (3.3 ± 2.7, P = 0.006).

Fig. 1
Fig. 1:
Bone marrow expression of HGF (Fig. 2A), c-Met (Fig. 2B), and MMP-9 (Fig. 2C) following severe trauma and chronic stress with and without propranolol and clonidine.

In the LCHS/CS group, bone marrow HGF was slightly reduced by propranolol (1.9 ± 0.7) and clonidine (1.6 ± 0.9), though the expression level remained significantly higher than naive animals (P < 0.001 and P = 0.019, respectively), and was not significantly lower than untreated LCHS/CS animals (P = 0.490 and P = 0.233, respectively). However, MMP-9 was significantly reduced by propranolol (1.1 ± 0.4, P = 0.023) and clonidine (1.5 ± 1.5, P = 0.035) compared with untreated counterparts, and was not significantly greater than naive (P = 0.425 and P = 0.348, respectively).

Plasma corticosterone

Plasma corticosterone levels are illustrated in Figure 2. Plasma corticosterone levels (ng/mL) increased with increasing injury severity in each of the rodent models (naive: 115 ± 51, LC: 161 ± 65, LCHS: 182 ± 91, LCHS/CS: 276 ± 148). Plasma corticosterone was significantly increased following LCHS/CS compared with naive (P = 0.043).

Fig. 2
Fig. 2:
Plasma corticosterone levels were slightly elevated following severe trauma and chronic stress, and were closer to naive levels when propranolol and clonidine were administered.

Following LCHS/CS, plasma corticosterone levels were significantly decreased by the addition of propranolol (146 ± 53, P = 0.016) and clonidine (151 ± 47, P = 0.041).

Hematopoietic progenitor mobilization

Hematopoietic progenitor mobilization data are illustrated in Figure 3. Compared with naive animals (1.2 ± 0.7%), HPC mobilization was slightly increased 7 days following LC (1.8 ± 1.0, P = 0.140), significantly higher following LCHS (2.7 ± 1.9, P = 0.015), and highest following LCHS/CS (5.4 ± 1.8, P < 0.001).

Fig. 3
Fig. 3:
The effects of propranolol and clonidine on persistent hematopoietic progenitor cell (HPC) mobilization from the bone marrow to the peripheral blood 7 days after injury, measured by flow cytometry to detect CD 71+/c-kit+ cells.

Following LCHS, HPC mobilization was decreased by the addition of propranolol (1.4 ± 0.8) and clonidine (1.8 ± 0.7), though the differences were not statistically significant (P = 0.093 and P = 0.114, respectively). Following LCHS/CS, HPC mobilization was significantly decreased by the addition of propranolol (2.2 ± 0.9, P < 0.001) and clonidine (1.7 ± 0.5, P < 0.001).

Hemoglobin

Hemoglobin levels (g/dL) 7 days following LC alone were similar to naive (14.4 ± 0.8 vs. 14.3 ± 0.4, P = 0.706) (Fig. 4). Compared with naive animals, hemoglobin was significantly decreased 7 days following LCHS (13.4 ± 1.2, P = 0.022), and was lowest following LCHS/CS (12.3 ± 1.2, P < 0.001).

Fig. 4
Fig. 4:
The effects of propranolol and clonidine on hemoglobin 7 days after injury. LC indicates lung contusion; HS, hemorrhagic shock; CS, chronic stress.

Following LCHS, hemoglobin was increased by the addition of propranolol (14.3 ± 0.9) and clonidine (13.8 ± 0.5), though propranolol and clonidine did not significantly increase hemoglobin compared with untreated counterparts (P = 0.070 and P = 0.414, respectively). Following LCHS/CS, our most clinically relevant rodent model, hemoglobin was significantly increased by the addition of propranolol (13.7 ± 0.4, P = 0.004) and clonidine (14.1 ± 1.1, P = 0.001) compared with untreated counterparts.

DISCUSSION

Following blunt traumatic injury with hemostasis, HPCs mobilize from the bone marrow to the peripheral blood and to site of injury, encouraging wound healing and tissue repair (3). When blunt trauma is accompanied by hemorrhagic shock and chronic stress, HPC mobilization is prolonged, leaving the bone marrow devoid of progenitors that are necessary to restore erythrocyte mass, resulting in bone marrow dysfunction and anemia. Our results suggest that HGF, c-Met, MMP-9, and corticosterone may each play a role in mobilizing HPCs from the bone marrow to peripheral blood following severe traumatic injury and chronic stress, consistent with known interactions among HPC mobilization pathways, as illustrated in Figure 5. Attenuating the neuroendocrine stress response with propranolol and clonidine had the greatest effects on MMP-9 and corticosterone. HGF and c-Met may have been less affected because they are indirectly influenced by the neuroendocrine stress response via upstream modulation of G-CSF, whereas MMP-9 and corticosterone are directly stimulated by high catecholamine levels and pro-inflammatory cytokines (9, 10). Untreated animals had prolonged increases in HPC mobilization and anemia 7 days after injury; propranolol and clonidine each decreased HPC mobilization and abrogated persistent injury-associated anemia (13).

Fig. 5
Fig. 5:
Conceptual diagram of hematopoietic progenitor cell (HPC) mobilization from bone marrow to peripheral blood.

Mobilization of HPCs by rodents subjected traumatic injury and hemorrhagic shock appears to be mediated by beta-2 and beta-3 adrenergic receptors in a process that is reversed by non-selective beta blockade, as demonstrated by Beiermeister et al. (2). Therefore, non-selective beta blockade with propranolol and sympathetic outflow inhibition with clonidine may inhibit HPC mobilization. This application of propranolol and clonidine is especially germane in the setting of persistent activation of the neuroendocrine stress response, which has been achieved by performing daily restraint stress following traumatic injury and hemorrhagic shock, resulting in persistent elevation of urine norepinephrine levels (16). Beta blockade with propranolol has shown efficacy in decreasing plasma G-CSF levels 7 days after the combination of injury, shock, and daily restraint stress, consistent with the hypothesis that the neuroendocrine stress response upregulates G-CSF (14). Previously, animals treated with propranolol had less HPC mobilization from the bone marrow to the peripheral blood but did not have histologic evidence of impaired wound healing (19, 20). In the same model of injury, shock, and daily restraint stress, clonidine has been shown to decrease plasma G-CSF levels and HPC mobilization to the peripheral blood (18). Therefore, modulating the neuroendocrine stress response to severe injury and chronic stress with propranolol and clonidine has the potential to attenuate HPC mobilization, bone marrow dysfunction, and anemia without adversely affecting wound healing and tissue repair. The clinical translation of these findings depends on effectively recapitulating neuroendocrine activation and inflammation experienced by severely injured trauma patients requiring ICU admission. Based on previous work, the authors believe that the experimental methods presented herein accomplish this goal (16, 17). However, future research should investigate the efficacy of other potentially useful methods for recapitulating chronic ICU stressors, such as dysregulation of day and night sleep-wake cycles, which were not used in the present study, representing a methodological limitation.

Although propranolol and clonidine act by different mechanisms, they had similar effects on HPC mobilization pathways following severe injury and chronic stress. Propranolol is a non-selective beta adrenergic receptor antagonist that blocks the MAPK, JNK, and NF-κB stress response pathways occurring downstream of the NE-beta adrenergic receptor complex (21, 22). Clonidine blocks sympathetic nervous system outflow by acting as a central alpha-2 agonist, and has been shown to attenuate the inflammatory response to surgery and experimental sepsis (23, 24). Because both propranolol and clonidine were effective in decreasing HPC mobilization and abrogating persistent injury-associated anemia, it seems that central sympathetic blockade is effective but unnecessary. This observation may have important implications for clinical translation.

Although both propranolol and clonidine are used clinically, propranolol seems more apt for use in trauma patients, especially in the tenuous period immediately following initial resuscitation. Clonidine has a tendency to promote hypotension, and has effects lasting for 6 to 10 h, whereas propranolol has been safely administered to severely injured trauma patients following resuscitation and stabilization within 24 h of admission (12). In a pilot study, trauma patients receiving propranolol had decreased growth of cultured HPCs beginning 1 day after injury and persisted 14 days after injury, suggesting that propranolol may have decreased HPC mobilization among human trauma patients (12). In this study, beta-blockers were not administered until initial resuscitation was complete and serum lactate was 4 mg/dL or less, and was then titrated to a 10% to 20% decrease in heart rate. Under these conditions, propranolol was held for one patient due to bradycardia, and there were no other adverse effects.

Our study was limited by a lack of mechanistic detail. The effects of increasing injury severity, initial versus persistent sympathetic activation due to chronic stress, and different mechanisms of action for propranolol and clonidine allow for the identification of associations, but do not establish causal relationships. In addition, this study was limited by the exclusive use of male rats. Male rats were used to avoid the potentially confounding effects of female hormones on the physiologic response to hemorrhagic shock. However, there may be important differences between male and female rats in the pathophysiology of HPC mobilization following severe injury and chronic stress, and further research in this area is needed. In addition, future research should also investigate the impact of aging on HPC mobilization and persistent injury-associated anemia, given that norepinephrine levels rise with increasing age, and aging has been associated with reduced hematopoietic stem cell proliferative and regenerative capacity (25–31). Therefore, the elderly may be particularly vulnerable to post-injury HPC mobilization and persistent injury-associated anemia. Finally, HGF and c-Met may have been less affected because they are indirectly influenced by the neuroendocrine stress response via upstream modulation of G-CSF. This hypothesis should also be tested in future studies.

CONCLUSIONS

Severe injury was associated with increased bone marrow expression of HGF, c-Met, and MMP-9, increased circulating corticosterone, prolonged mobilization of HPCs to the peripheral blood, and persistent anemia. Attenuating the neuroendocrine response to injury and stress with propranolol and clonidine led to reduced bone marrow MMP-9 expression, decreased circulating corticosterone levels, reduced HPC mobilization, and resolution of anemia. Future studies should evaluate the safety and efficacy of propranolol in preventing prolonged HPC mobilization and persistent injury-associated anemia in human trauma patients.

REFERENCES

1. Badami CD, Livingston DH, Sifri ZC, Caputo FJ, Bonilla L, Mohr AM, Deitch EA. Hematopoietic progenitor cells mobilize to the site of injury after trauma and hemorrhagic shock in rats. J Trauma 63 (3):596600, 2007.
2. Beiermeister KA, Keck BM, Sifri ZC, ElHassan IO, Hannoush EJ, Alzate WD, Rameshwar P, Livingston DH, Mohr AM. Hematopoietic progenitor cell mobilization is mediated through beta-2 and beta-3 receptors after injury. J Trauma 69 (2):338343, 2010.
3. Shah S, Ulm J, Sifri ZC, Mohr AM, Livingston DH. Mobilization of bone marrow cells to the site of injury is necessary for wound healing. J Trauma 67 (2):315321, 2009.
4. Tesio M, Golan K, Corso S, Giordano S, Schajnovitz A, Vagima Y, Shivtiel S, Kalinkovich A, Caione L, Gammaitoni L, et al. Enhanced c-Met activity promotes G-CSF-induced mobilization of hematopoietic progenitor cells via ROS signaling. Blood 117 (2):419428, 2011.
5. Baranski GM, Offin MD, Sifri ZC, Elhassan IO, Hannoush EJ, Alzate WD, Rameshwar P, Livingston DH, Mohr AM. beta-blockade protection of bone marrow following trauma: the role of G-CSF. J Surg Res 170 (2):325331, 2011.
6. Hannoush EJ, Sifri ZC, Elhassan IO, Mohr AM, Alzate WD, Offin M, Livingston DH. Impact of enhanced mobilization of bone marrow derived cells to site of injury. J Trauma 71 (2):283289, 2011.
7. Lai L, Jin J, Hodio J, Goldschneider I. A human recombinant IL-7/HGFalpha hybrid cytokine enhances T-cell reconstitution in mice after syngeneic bone marrow transplantation. Transplantation 92 (5):516522, 2011.
8. Trusolino L, Comoglio PM. Scatter-factor and semaphorin receptors: cell signalling for invasive growth. Nat Rev Cancer 2 (4):289300, 2002.
9. Heissig B, Hattori K, Dias S, Friedrich M, Ferris B, Hackett NR, Crystal RG, Besmer P, Lyden D, Moore MA, et al. Recruitment of stem and progenitor cells from the bone marrow niche requires MMP-9 mediated release of kit-ligand. Cell 109 (5):625637, 2002.
10. Kollet O, Shivtiel S, Chen YQ, Suriawinata J, Thung SN, Dabeva MD, Kahn J, Spiegel A, Dar A, Samira S, et al. HGF, SDF-1, and MMP-9 are involved in stress-induced human CD34+ stem cell recruitment to the liver. J Clin Invest 112 (2):160169, 2003.
11. Pierce H, Zhang D, Magnon C, Lucas D, Christin JR, Huggins M, Schwartz GJ, Frenette PS. Cholinergic signals from the CNS regulate G-CSF-mediated HSC mobilization from bone marrow via a glucocorticoid signaling relay. Cell Stem Cell 20:648.e4658.e4, 2017.
12. Bible LE, Pasupuleti LV, Alzate WD, Gore AV, Song KJ, Sifri ZC, Livingston DH, Mohr AM. Early propranolol administration to severely injured patients can improve bone marrow dysfunction. J Trauma Acute Care Surg 77 (1):5460, 2014.
13. Alamo IG, Kannan KB, Ramos H, Loftus TJ, Efron PA, Mohr AM. Clonidine reduces norepinephrine and improves bone marrow function in a rodent model of lung contusion, hemorrhagic shock, and chronic stress. Surgery 161 (3):795802, 2017.
14. Bible LE, Pasupuleti LV, Gore AV, Sifri ZC, Kannan KB, Mohr AM. Daily propranolol prevents prolonged mobilization of hematopoietic progenitor cells in a rat model of lung contusion, hemorrhagic shock, and chronic stress. Surgery 158 (3):595601, 2015.
15. Gore AV, Bible LE, Livingston DH, Mohr AM, Sifri ZC. Can mesenchymal stem cells reverse chronic stress-induced impairment of lung healing following traumatic injury? J Trauma Acute Care Surg 78 (4):767772, 2015.
16. Bible LE, Pasupuleti LV, Gore AV, Sifri ZC, Kannan KB, Mohr AM. Chronic restraint stress after injury and shock is associated with persistent anemia despite prolonged elevation in erythropoietin levels. J Trauma Acute Care Surg 79 (1):9196, 2015.
17. Loftus TJ, Mira JC, Miller ES, Kannan KB, Plazas JM, Delitto D, Stortz JA, Hagen JE, Parvataneni HK, Sadasivan KK, et al. The post-injury inflammatory state and the bone marrow response to anemia. Am J Respir Crit Care Med 198:629638, 2018.
18. Alamo IG, Kannan KB, Ramos H, Loftus TJ, Efron PA, Mohr AM. Clonidine reduces norepinephrine and improves bone marrow function in a rodent model of lung contusion, hemorrhagic shock, and chronic stress. Surgery 161:795802, 2016.
19. Alamo IG, Kannan KB, Bible LE, Loftus TJ, Ramos H, Efron PA, Mohr AM. Daily propranolol administration reduces persistent injury-associated anemia after severe trauma and chronic stress. J Trauma Acute Care Surg 82 (4):714721, 2017.
20. Ali A, Herndon DN, Mamachen A, Hasan S, Andersen CR, Grogans RJ, Brewer JL, Lee JO, Heffernan J, Suman OE, et al. Propranolol attenuates hemorrhage and accelerates wound healing in severely burned adults. Crit Care 19:217, 2015.
21. Ballard-Croft C, Maass DL, Sikes P, White J, Horton J. Activation of stress-responsive pathways by the sympathetic nervous system in burn trauma. Shock 18 (1):3845, 2002.
22. Zaugg M, Schaub MC, Pasch T, Spahn DR. Modulation of beta-adrenergic receptor subtype activities in perioperative medicine: mechanisms and sites of action. Br J Anaesth 88 (1):101123, 2002.
23. Hofer S, Steppan J, Wagner T, Funke B, Lichtenstern C, Martin E, Graf BM, Bierhaus A, Weigand MA. Central sympatholytics prolong survival in experimental sepsis. Crit Care 13 (1):R11, 2009.
24. Aantaa R, Jalonen J. Perioperative use of alpha2-adrenoceptor agonists and the cardiac patient. Eur J Anaesthesiol 23 (5):361372, 2006.
25. Ziegler MG, Lake CR, Kopin IJ. Plasma noradrenaline increases with age. Nature 261 (5558):333335, 1976.
26. Rowe JW, Troen BR. Sympathetic nervous system and aging in man. Endocr Rev 1 (2):167179, 1980.
27. McCarty R. Age-related alterations in sympathetic-adrenal medullary responses to stress. Gerontology 32 (3):172183, 1986.
28. Barnes RF, Raskind M, Gumbrecht G, Halter JB. The effects of age on the plasma catecholamine response to mental stress in man. J Clin Endocrinol Metab 54 (1):6469, 1982.
29. Dumble M, Moore L, Chambers SM, Geiger H, Van Zant G, Goodell MA, Donehower LA. The impact of altered p53 dosage on hematopoietic stem cell dynamics during aging. Blood 109 (4):17361742, 2007.
30. Rossi DJ, Bryder D, Weissman IL. Hematopoietic stem cell aging: mechanism and consequence. Exp Gerontol 42 (5):385390, 2007.
31. Stelzer I, Fuchs R, Schraml E, Quan P, Hansalik M, Pietschmann P, Quehenberger F, Skalicky M, Viidik A, Schauenstein K. Decline of bone marrow-derived hematopoietic progenitor cell quality during aging in the rat. Exp Aging Res 36 (3):359370, 2010.
Keywords:

Hematopoietic progenitor mobilization; hepatocyte growth factor; stress; trauma; tyrosine-protein kinase met

Copyright © 2020 by the Shock Society