Secondary Logo

Journal Logo

EFFECT OF GTS-21, AN ALPHA7 NICOTINIC ACETYLCHOLINE RECEPTOR AGONIST, ON CLP-INDUCED INFLAMMATORY, GASTROINTESTINAL MOTILITY, AND COLONIC PERMEABILITY CHANGES IN MICE

Nullens, Sara; Staessens, Michael; Peleman, Cédric; Schrijvers, Dorien M.; Malhotra-Kumar, Surbhi; Francque, Sven; Matteoli, Gianluca; Boeckxstaens, Guy E.; De Man, Joris G.; De Winter, Benedicte Y.

doi: 10.1097/SHK.0000000000000519
Basic Science Aspects
Free
SDC

Background: During abdominal sepsis, the inhibition of gastrointestinal (GI) motility together with mucosal barrier dysfunction will lead to increased bacterial translocation and maintenance of sepsis. The activation of the vagal anti-inflammatory pathway remains an appealing therapeutic strategy in sepsis. In this respect, selective alpha7 nicotinic acetylcholine receptor (α7nAChR) agonists have shown anti-inflammatory properties in several animal models of inflammation.

Methods: Sepsis was induced in OF-1 mice by cecal ligation and puncture (CLP). GI transit was quantified, and cytokine levels were determined in serum and colon. Colonic permeability was assessed by means of Evans blue injection. We studied the effect of GTS-21, an α7nAChR agonist, on the aforementioned parameters. Splenectomized animals as well as α7nAChR-knock-out animals (Chrna7−/−) were included to study the role of splenic macrophages and the α7nAChR during polymicrobial abdominal sepsis.

Results: In septic animals, GTS-21 significantly ameliorated GI motility, lowered systemic and colonic levels of IL-6, decreased colonic permeability, and decreased the number of positive cultures obtained from blood and mesenteric lymph nodes. Splenectomy prevented animals from developing sepsis-induced ileus. Chrna7−/− mice displayed a more severe septic phenotype, whereas GTS-21 remarkably was also beneficial in these animals.

Conclusion: Our results show that peripheral targeting of the vagal anti-inflammatory pathway proves beneficial in an animal model of polymicrobial abdominal sepsis. A major role is allocated to splenic immune cells in the development of sepsis, as preventive splenectomy was protective for the development of sepsis. Data on the Chrna7−/− mice suggest that the beneficial effects mediated by GTS-21 on inflammation and motility might be related to activation of other receptors besides the α7nAChR.

*Laboratory of Experimental Medicine and Pediatrics, Division of Gastroenterology

Laboratory of Physiopharmacology

Laboratory of Medical Microbiology, University of Antwerp

§Antwerp University Hospital, Department of Gastroenterology and Hepatology, Antwerp

||Department of Clinical and Experimental Medicine, Translational Research Center for Gastrointestinal Disorders (TARGID), University of Leuven, Leuven, Belgium

Address reprint requests to Prof. Dr. Benedicte Y. De Winter, Laboratory of Experimental Medicine and Pediatrics, University of Antwerp, Universiteitsplein 1, 2610 Antwerp, Belgium. E-mail: benedicte.dewinter@uantwerpen.be

Received 20 August, 2015

Revised 3 September, 2015

Accepted 15 October, 2015

SN is an aspirant of the Fund for Scientific Research (FWO), Flanders (11G7415N). This work was supported financially by the FWO (G028615N), and by a GOA-2013 funding of the University of Antwerp.

The authors report no conflicts of interest.

Supplemental digital content is available for this article. Direct URL citations appear in the printed text and are provided in the HTML and PDF versions of this article on the journal's Website (www.shockjournal.com).

SN performed the animal experiments, statistical analysis and drafted the manuscript. MS and CP participated in the motility and permeability experiments. DS carried out the in vitro macrophage and dendritic cell cultures. SM-K performed the cultures to quantify bacterial translocation. SF participated in the design of the study. GM and GB participated in the Chrna7−/− experiments. JDM and BDW designed the study and aided in the animal experiments. All authors read and approved the final manuscript.

Back to Top | Article Outline

INTRODUCTION

Sepsis remains a major cause of morbidity and mortality in modern-day intensive care units. The manifestations of sepsis comprise a diverse spectrum of disease, ranging from the presence of micro-organisms in the bloodstream to the development of multiple organ dysfunction syndrome (1). The gastrointestinal (GI) tract is involved in these failing events with the occurrence of ileus, defined as an inhibition of the propulsive motility of the entire GI tract, and the disturbance of the intestinal barrier. Besides, multiple sepsis-related events such as initial ischemia, ischemia-reperfusion-injury, infiltration of inflammatory cells in the GI tract, and secretion of systemic and paracrine mediators by inflammatory cells as a response to infectious agents affect smooth muscle cell contractility and afferent nerve fiber activity (2). Therefore, the GI tract is no longer considered an innocent bystander in the pathophysiology of sepsis, but regarded as a major player in the development and maintenance of organ failure during sepsis (3). Recent experiments substantiate that gut-derived factors in lymph collected from mesenteric lymph nodes, and not only bacteria as such, can damage distant organ systems in an animal model of trauma followed by hemorrhagic shock (4), supporting the “gut-lymph” hypothesis and importance of understanding the role of the failing GI tract during sepsis (3, 5).

The role and management of the failing GI tract remains a subject of debate in guidelines tackling the approach of the septic patient and was often somewhat neglected by physicians in favor of other organ systems such as the renal and cardiovascular tract. The most recent guidelines of the 2013 Surviving Sepsis Campaign Executive Committee suggest that selective oral and digestive tract decontamination by means of antibiotics should be investigated within the scope of infection prevention (e.g., ventilator-associated pneumonia) and that continuous research is warranted in order to ascertain benefits, risks, and cost-effectiveness (6).

Compounds that are currently being studied in the context of sepsis include agonists of the alpha7 nicotinergic acetylcholine receptor (α7nAChR). This receptor has been demonstrated on the cell surface of macrophages, where binding of its endogenous ligand acetylcholine results in the inhibition of the release of proinflammatory cytokines from macrophages due to a post-transcriptional inhibition of cytokine synthesis (7). This mechanism represents the final step in the so-called “cholinergic” or “vagal anti-inflammatory” pathway, an endogenously present reflex pathway that suppresses the release of proinflammatory cytokines during inflammation (8). GTS-21, a selective partial α7nAChR agonist currently under investigation for its neuroprotective effects, has been demonstrated to suppress inflammation in various animal models of inflammation, such as acute kidney injury (9), pancreatitis (10), and ventilator-induced injury (11). Animal studies have already demonstrated the beneficial effects of vagal nerve stimulation (VNS) on survival following LPS-induced murine sepsis (12), whereas mortality was increased following vagotomy in the colon ascendens stent peritonitis animal model (13). These beneficial effects were demonstrated to be dependent on the presence of an intact vagus-nerve to spleen neuronal circuit (14, 15). Moreover, vagal nerve stimulation has been shown to protect gut injury and thereby limit further organ damage by Levy et al. (4); this study however raised doubts as to whether the spleen was involved. As immunohistochemistry demonstrated the presence of α7nAChR on the cell surface of macrophages in the GI wall, this cell population represents an interesting therapeutic target.

Given that GTS-21 improves survival in different animal models of sepsis, such as the cecal ligation and puncture (CLP) model, burn injury (16), and endotoxemia (17), we aimed to investigate the effects of GTS-21 on motility and permeability disturbances and inflammation in the GI tract in an animal model of polymicrobial abdominal sepsis, as well as the role of the α7nAChR in these effects by studying α7nAChR-KO animals. As the role of the spleen in septic ileus currently remains to be fully elucidated, we investigated the effect of GTS-21 in animals that underwent splenectomy prior to the induction of sepsis.

Back to Top | Article Outline

MATERIALS AND METHODS

Mice

Eight-week-old male OF-1 mice were obtained from Charles River (France) and housed in groups of six to eight animals in standardized conditions (12-h light–dark cycle, 21 ± 2°C, 40%–60% humidity) with unlimited access to regular chow and tapwater. Mice were allowed to acclimatize 1 week before the experiments. All experiments were approved by the Committee for Medical Ethics and the use of Experimental Animals at the University of Antwerp (file number 2012-42).

Back to Top | Article Outline

Products purchased

The following products were used: Xylazine 2% (Rompun, Bayer, Diegem, Belgium); ketamine 50 mg/mL (Ketalar, Pfizer, Elsene, Belgium); buprenorphin 0.3 mg/mL (Temgesic, Schering-Plough, Heist-op-den-Berg, Belgium); GTS-21 dihydrochloride (DMBX-A, Abcam (ab120560), Cambridge, UK); diethyl ether (Chem-lab NV, Belgium); saline (0.9% NaCl; Braun); Cytometric Bead Array (CBA) Mouse Th1/Th2/Th17 Cytokine Kit (BD Biosciences, Erembodegem, Belgium); IL-1β mouse ELISA (Life Technologies, Merelbeke, Belgium); Evans blue (dye content >75%) (EB) and SIGMAFAST protease inhibitor tablets (Sigma-Aldrich, Diegem, Belgium); sodium pyruvate (Life Technologies); GM-CSF (Peprotech); IFN-γ (ImmunoTools); Polymyxin B (Sigma-Aldrich, Diegem, Belgium); Dulbecco's Phosphate Buffered Saline (PBS; Gibco, Life Technologies, Merelbeke, Belgium), RPMI medium 1640 (Gibco), Fetal Bovine Serum (FBS; Gibco), penicillin/streptomycin (Gibco), L-glutamin and LPS (Gibco); antibodies for flow cytometry: anti-mouse F4/80 antigen APC (Biolegend, London, UK); anti-mouse CD11c PE-CF594, anti-mouse MHCII PerCPCy5.5 antigen and anti-mouse CD11b BB515 antigen (BD, Erembodegem, Belgium).

Back to Top | Article Outline

Cecal ligation and puncture model

To induce sepsis, mice underwent the cecal ligation and puncture procedure (CLP) (18). Mice were anesthetized with a mixture of ketamine (60 mg/kg i.p.) plus xylazine (6.67 mg/kg i.p.) and placed on a heating pad in the supine position. A midline laparotomy was performed following abdominal shaving and disinfection with a polyvidon-iodine solution. The caecum was exteriorized and positioned onto moist sterile cottons. Based upon previous survival analysis and monitoring of disease status in our laboratory (data not shown), 50% of the caecum was ligated with a 4/0 silk thread and punctured once through-and-through with a 25G needle, in order to obtain a mild sepsis without significant mortality up to 10 days post-CLP for the following experiments (Fig. 1). The ligated caecum was repositioned into the abdominal cavity, and the abdomen was closed in layers with 5/0 Ethilon sutures. Mice received 1 mL of 37°C saline (0.9% NaCl) subcutaneously (s.c.) for fluid resuscitation, and 0.05 mg/kg of buprenorphine s.c. for pain relief. Mice were allowed to recover in a heated cage (28°C) with free access to water. Sham-operated mice received a midline incision without ligation or puncturing of the caecum. The experiments as described below were initiated 48 h following the CLP or sham procedure (Fig. 2A). Animals were prematurely sacrificed when they lost over 15% of their baseline body weight or when they appeared to be moribund or had a clinical disease score (CDS) >8 (19) (Table 1).

Fig. 1

Fig. 1

Fig. 2

Fig. 2

Table 1

Table 1

Back to Top | Article Outline

Experimental design

Five sets of experiments were designed. In a first set of experiments, CLP- or sham-operated mice were administered GTS-21 (8 mg/kg) or its vehicle (sterile saline 0.9%) i.p. 1 h before the surgical procedure, and 24 h and 48 h after CLP (Fig. 2A). In preliminary experiments, we determined 8 mg/kg as the optimal dose (doses tested: 2, 4, 8, and 12 mg/kg; data not shown) in our CLP model. The same protocol was applied for all the following experiments. Sickness behavior was quantified based upon a clinical disease score (CDS) (Table 1), and GI motility was assessed. Following terminal anaesthesia, animals were sacrificed with cardiac puncture while obtaining blood samples (Multivette 600 capillary blood collection, Sarstedt). Blood samples were centrifuged (10,000 g, 5 min, 20°C) and supernatants were stored at −80°C until further analysis. Inflammation was furthermore assessed locally at the colonic level. In order to calculate the number of animals needed per group, power analysis was performed using G*Power version 3.1.7 based upon results obtained from preliminary experiments.

In a second set of experiments, colonic permeability was assessed in septic and control animals under terminal anaesthesia 48 h following the procedure, and blood and mesenteric lymph nodes were obtained for culture.

In a third set of experiments, septic ileus was induced by CLP in locally bred Chrna7−/− (α7nAChR-KO) and Chrna7+/+ mice on a C57Bl/6 background after receiving GTS-21 (8 mg/kg) or vehicle. The absence of the Chrna7 gene was confirmed by RT-PCR on 5 mm tail clips before the experiment using the MyTaq Extract-PCR Kit and following primers: mChrna7 forward CCTGGTCCTGCTGTGTTAAACTGCTTC, mChrna7 reverse wild-type CTGCTGGGAAATCCTAGGCACACTTGAG, mChrna7 reverse mutated GACAAGACCGGCTTCCATCC, with following amplification parameters: 3 min at 94°C, followed by 35 cycles of 70°C for 1 min and 72°C for 1 min.

In a fourth set of experiments, we studied the role of the spleen in GTS-21-mediated effects by including mice that underwent a splenectomy (SPLX) 7 days before CLP (Fig. 2B). Briefly, mice were anesthetized with a mixture of ketamine and xylazine, placed supine on their right flank, and received a midaxillary incision below the costal arch. The spleen was mobilized and the splenic hilum was ligated with two 5/0 Ethilon sutures for hemostasis, after which the spleen was dissected free from the surrounding tissues. After controlling for bleeding, the abdomen was closed in layers and mice were allowed to recover with fluid resuscitation (1 mL of saline s.c.) and pain relief (buprenorphine 0.05 mg/kg s.c.).

In a fifth experiment, the in vitro effect of GTS-21 was studied on cytokine release from bone-marrow-derived macrophages and dendritic cells (DCs).

Back to Top | Article Outline

In vivo measurement of gastrointestinal transit: the solid beads method

Mice were overnight deprived of food with unlimited access to tap water. A gavage was given 48 h following sham or CLP with 0.5 mL of tapwater containing 25 glass green-colored beads (diameter 0.3 mm) through a 20G flexible catheter (Terumo; outer diameter 1.10 mm, inner diameter 0.80 mm) 1 h following the final GTS-21 or vehicle injection. Mice were sacrificed 2 h following gavage and the GI tract was resected and divided into 10 parts (stomach, five small bowel segments, caecum, proximal colon, distal colon, and faeces). The number of beads in every segment was counted under a stereomicroscope for calculation of percentage gastric emptying (%GE) and the geometric center of intestinal transit (GC) as a marker for overall GI transit (20).

Back to Top | Article Outline

Systemic cytokines

The concentration of IL-6, TNF-α, IL-2, IL-10, IL-17, and IFN-γ in serum (pg/mL) was determined using the BD CBA Mouse Cytokine Kit on an Accuri C6 flow cytometer (Becton Dickinson Biosciences, Erembodegem, Belgium) according to the manufacturer's instructions. Data were processed using FCAP Array (BD).

Back to Top | Article Outline

Local colonic cytokine concentrations and cell adhesion proteins

Colonic cytokine levels were determined at the protein as well as the mRNA level. For the protein concentrations, whole colons were rinsed with phosphate-buffered saline, blotted dry, weighed, and placed in ice-cold Tris-EDTA buffer (PBS with 10 mM Tris and 1 mM EDTA) containing a protease inhibitor cocktail (100 mg colon per milliliter). Tissues were minced, homogenized, and centrifuged (11,000 g, 4°C, 10 min) and supernatants were collected and assessed for levels of IL-6, TNF-α, and IL-10 (pg/g colon) using the BD CBA Mouse Cytokine Kit.

To determine cytokine content at the mRNA level, total RNA was isolated from a snap-frozen piece of colonic tissue using the Qiagen RNeasy Mini Kit and purity confirmed using the Nanodrop ND-1000 Spectrophotometer. Total RNA was treated with DNase to obtain DNA-free RNA (Turbu DNase-free, Life Technologies) and converted to cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche Applied Science). Quantitative real-time PCR was performed using the TaqMan Universal PCR Master Mix (Life Technologies) and primers as mentioned in Table, Supplemental Digital Content 1, at http://links.lww.com/SHK/A343. GAPDH was determined to be the optimal housekeeping gene to which the expression of genes were normalized against. The PCR reaction was performed in a 25 μL reaction (21), with the following amplification parameters: 50°C for 2 min, 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Furthermore, we performed real-time RT-PCR for different tight junctions (occludin, zonulin-1, claudin-1), desmosome (desmoglein-2), and adherens junction proteins (E-cadherin).

Back to Top | Article Outline

Colonic permeability

Colonic permeability was quantified by means of the Evans blue (EB) method, a dye that crosses epithelia via the paracellular route (22). Briefly, septic and control animals were terminally anaesthetized and placed in the supine position on a heating pad to undergo an abdominal incision. Following abdominal disinfection and using sterile utensils and gloves, the colon was visualized and ligated distally of the ileocecal valve. 100 μL of a 9% EB solution (w/v) dissolved in PBS was injected into the colon with a Myjector U-100 insulin syringe, and the abdomen was closed in layers. One hour following the injection mice were sacrificed, colons resected and rinsed with PBS containing 6 mM of acetylcysteine to flush out residual EB. Colons were blotted dry, weighed, and incubated for 24 h in formamide (50°C, 95% O2, 5% CO2) to extract the EB absorbed by the GI wall as a measure for colonic permeability. The extracted amount of EB from the colon was determined spectrophotometrically by measuring emission at 610 nm and expressed as μg EB/100 mg colonic tissue.

Back to Top | Article Outline

Quantification of bacterial translocation

To estimate bacterial translocation into the bloodstream, one drop of EDTA-treated full blood was obtained by cardiac puncture from the animals in which colonic permeability was studied, and plated onto a blood agar culture plate following enrichment and incubated at 37°C for 24 h in ambient air supplied with 5% CO2. Additionally, mesenteric lymph nodes (MLN) resected aseptically and suspended in RPMI 1640 medium were mashed manually using a 10-mL syringe plunger through a 40-μm nylon cell strainer. Homogenized MLN were plated onto a blood agar culture following enrichment.

Back to Top | Article Outline

In vitro culture of bone-marrow-derived macrophages and conventional dendritic cells

The release of proinflammatory cytokines by macrophages in vitro was quantified in the presence of GTS-21. From three OF-1 mice, 0.5 × 106 bone-marrow-derived stem cells were plated in triplicate in full RPMI medium supplied with 5% FBS, 1% pen/strep, 1% L-glutamine, 1 mM sodium pyruvate, and 20 U/mL Polymyxin B for 7 days (37°C, 95% O2, 5% CO2) with M-CSF (obtained from L-cell conditioned medium) to obtain macrophages, or GM-CSF to obtain immature conventional dendritic cells (cDC). At day 7, cultures were stimulated with 100 ng/mL LPS and 100 U/mL IFN-γ to polarize the macrophages toward a proinflammatory state, or 1 μg/mL LPS and 1,000 U/mL IFN-γ to obtain mature cDC. GTS-21 was simultaneously added (10 μM or 100 μM). After 24 h, supernatants were collected and stored at −80°C until analysis with CBA for IL-6, TNF-α, and IL-10. The purity of bone-marrow-derived macrophages and cDCs in culture was verified using a BD Accuri C6 flow cytometer (CD11b+F4/80+ cells and CD11c+MHCII+ cells respectively).

Back to Top | Article Outline

Histology

A full thickness segment (0.5 × 0.5 cm) was taken from the proximal colon immediately adjacent to the caecum. The segment was fixed for 24 h in 4% formaldehyde and subsequently embedded in paraffin. Transverse sections (5 μm) were stained with haematoxylin and eosin. Inflammation was scored by assessing the presence and degree of inflammatory infiltrates, presence of goblet cells, architecture of the crypts, and presence of mucosal erosion as previously published (19), resulting in a cumulative score ranging from 0 (minimum) to 13 (maximum).

Back to Top | Article Outline

Statistical analysis

Data are presented as mean ± SEM, with “n” representing the number of mice. Two-way ANOVA followed by one-way ANOVA with post hoc Student–Newman–Keuls (SNK) analysis was applied to compare the results of CDS, rectal temperature, motility parameters, cytokine levels, PCR, and other data. Data were analyzed using SPSS version 20.0 (IBM, Chicago, IL) and visualized using GraphPad Prism version 5.00.

Back to Top | Article Outline

RESULTS

Effect of GTS-21 on CLP-induced septic ileus

The CLP procedure resulted in a reproducible occurrence of sepsis without mortality up until 48 h post-procedure. Sepsis resulted in a marked increase in CDS from 0.1 ± 0.1 in control animals to 4.2 ± 0.3 48 h following CLP (P < 0.001, Fig. 3A). GTS-21 favorably affected the CDS at day 2 following the induction of sepsis, with CDS declining to 2.9 ± 0.4 (P < 0.05) in the GTS-21-treated septic group. GTS-21-treated sham animals did not demonstrate any signs of toxicity.

Fig. 3

Fig. 3

CLP-induced sepsis resulted in an impairment of GI transit as represented by a significant drop in %GE and GC. Administration of GTS-21, however, protected mice from developing an impaired GI transit, as demonstrated by a normalization of %GE and GC (Fig. 3, B and C).

Sepsis resulted in a marked rise in the serum levels of the proinflammatory IL-6 and TNF-α and of the anti-inflammatory IL-10. The same was true for the proinflammatory IL-2 and IFN-γ, with control values below the limit of detection. In septic mice, GTS-21 caused a significant decrease in the concentration of IL-6 and IL-2, whereas TNF-α- and IFN-γ-levels remained unaltered compared with vehicle-treated septic mice (Table 2A). IL-10 levels significantly increased following administration of GTS-21 in both sham and septic mice.

Table 2

Table 2

Similar to the serum results, the IL-6 concentration in the colonic wall rose significantly during sepsis. This rise in IL-6 concentration was significantly inhibited by GTS-21. In septic conditions, a significant drop in colonic IL-10 and IL-17 was observed, without an additional effect of GTS-21. GTS-21 treatment tended to increase colonic TNF-α levels slightly in septic and control animals, but not significantly (P = 0.072) (Table 2B). The aforementioned results were largely confirmed by the RT-PCR results on colonic tissue (Table 2C), except for IL-10 and IL-17.

CLP-induced sepsis increased the permeability of the colonic wall to Evans blue and GTS-21 normalized this disturbed permeability of the GI tract (Fig. 3D) without any effect on the sham-operated mice. Cultures from sham mice were consistently negative following 24-h incubation, whereas 67% of blood cultures and 100% of MLN cultures were positive in septic mice (Table 3). GTS-21 significantly reduced the number of positive cultures. The mRNA levels of different cell adhesion proteins were all significantly upregulated during sepsis, and administration of GTS-21 resulted in an additional significant rise in the mRNA level of claudin-1 (Table 4).

Table 3

Table 3

Table 4

Table 4

No obvious differences were observed on haematoxylin-eosin staining between sham- and CLP-operated mice, nor did treatment with GTS-21 result in any histological changes (score for all four groups: 0.0 ± 0.0, P = NS). Therefore, the beneficial GI motility changes we observed following GTS-21 treatment in the septic animals were not associated with an amelioration of the GI histology (Fig. 4).

Fig. 4

Fig. 4

Back to Top | Article Outline

CLP and GTS-21 in Chrna7−/− mice

In Chrna7−/− mice mortality was significantly increased 48 h following CLP, in contrast to their wild-type littermates of which all survived (Fig. 1). Administration of GTS-21 was not able to impede this increased mortality. GTS-21 still significantly decreased CDS in Chrna7−/− mice and also prevented the development of impaired gastric emptying in septic Chrna7−/− mice (Table 5). Furthermore, GTS-21 treatment numerically decreased the major proinflammatory cytokines (IL-6, TNF-α, and IL-17A) as well as the anti-inflammatory IL-10, in serum and colon. This effect was not confirmed at colonic mRNA levels, with near-identical values for animals that received GTS-21 in comparison with vehicle-treated septic Chrna7−/− mice.

Table 5

Table 5

Back to Top | Article Outline

Effects of splenectomy on CLP-induced septic ileus

Performing SPLX 1 week prior to CLP protected mice from developing reduced GI transit. We noted a significant drop in CDS as animals were protected from developing ileus, with GI transit measurements showing a near-normal %GE and GC (Table 6). Serum levels of the proinflammatory IL-6 and TNF-α were significantly reduced in comparison with septic animals with an intact spleen. The same effects could be observed at the colonic level. SPLX had no effects on sham-operated (i.e., non-septic) animals. The administration of GTS-21 to splenectomized animals did not result in an additional benefit on CDS, GI motility, or cytokine levels (Table 6), suggesting that the main effect of GTS-21 in this animal model was mediated via splenic macrophages in the preventative setting.

Table 6

Table 6

Back to Top | Article Outline

In vitro culture of bone-marrow-derived macrophages and dendritic cells

Over 90% of macrophages cultured were determined to be CD11b+F4/80+ macrophages. Incubating proinflammatory macrophages with 10 and 100 μM GTS-21 dose-dependently reduced the release of TNF-α with 59% and 92% respectively (P < 0.001) compared with vehicle, and reduced the release of IL-6 with respectively 26% and 59% (P < 0.001). The release of IL-10 was not altered. For the cDC cultures similar results were obtained with a dose-dependent reduction in the release of TNF-α (47% and 57%, P < 0.001), IL-6 (13% and 37%, P < 0.001), and IL-12p70 (55% and 32% respectively, P < 0.001).

Due to surprising effects of GTS-21 on GI motility and serum levels of proinflammatory cytokines in Chrna7−/− mice, the same protocol was applied to bone marrow derived from Chrna7−/− mice. Surprisingly, the release of TNF-α from macrophages was also reduced following incubation with GTS-21 (14% and 87% reduction respectively, P < 0.001), and the same was observed for the release of IL-6 (58% decrease following incubation with 100 μM GTS-21, P = 0.001). Similar results were obtained for cDC cultures (IL-6: decrease with 12% and 80%, P < 0.001; TNF-α: decrease with 75% and 95%, P < 0.001).

Back to Top | Article Outline

DISCUSSION

In this study, we provide evidence for the beneficial effects of GTS-21, an α7nAChR agonist, on GI motility disturbances, inflammation, and colonic permeability during polymicrobial abdominal sepsis. Sepsis was induced by cecal ligation and puncture, a widely accepted animal model in sepsis research (18). CLP has been demonstrated to impair in vitro colonic peristalsis and muscle contractions (23). Our data show the occurrence of impaired GI motility 48 h following CLP-induced sepsis in OF-1 mice. Serum levels of the proinflammatory cytokines IL-6, TNF-α, and IL-2 were upregulated following CLP while serum IL-10 levels, an anti-inflammatory cytokine, were also markedly elevated during CLP-induced sepsis at this time point of investigation. This reflects a simultaneously increased synthesis of anti-inflammatory markers counteracting the proinflammatory cytokines and their tissue damaging effects (24). GTS-21, an α7nAChR agonist, was able to protect animals from developing CLP-induced septic ileus and caused a significant decrease in serum level of IL-6 and CDS in septic mice. Serum TNF-α levels also increased significantly during sepsis, but levels were not reduced by GTS-21-treatment. Others have demonstrated that TNF-α serum levels already peak during the first 5 to 12 h following CLP, with a second peak at 24 h and a rapid decline thereafter (25), making it plausible that we missed a possible beneficial effect of GTS-21 on TNF-α-secretion. Furthermore, as several other cytokines peak during the initial 6 to 12 h after CLP, we could have overlooked significant effects on other cytokines at the 48 h time point that play a pivotal role in the ensuing septic cascade. Strikingly, Levy et al. (4) also showed that TNF-α levels remained unaltered following VNS in a mouse model of trauma and hemorrhagic shock.

We studied sepsis-induced changes on colonic permeability by means of the dye Evans blue, and found a clear impairment of the GI barrier function during sepsis. We demonstrated that GTS-21 was able to counteract the sepsis-induced deleterious effects on GI permeability as reflected by a significant decrease of bacterial translocation to MLN and blood. As it has been demonstrated that the draining lymphatics play an important role in the occurrence of subsequent multi-organ failure (26), results obtained from MLN analysis could be of clinical relevance.

These results suggest a link between inflammation and colonic permeability (and thus bacterial translocation). In this regard, the proinflammatory cytokine IL-6 is an interesting player accountable for numerous deleterious effects. Others demonstrated that GI permeability was preserved in an IL-6 knockout (IL-6−/−) mouse model, whereas IL-6+/+ mice displayed a profound increase in GI permeability as was determined using Ussing chambers (27). As suggested in other studies, TNF-α and HMGB1 are also known to have a detrimental impact on gut permeability (28), but the importance of TNF-α was not very pronounced at this time point in the current study whereas the strong decrease in IL-6 coincided with a normalization of colonic permeability as determined by the Evans blue method. As bacterial translocation may occur paracellularly when tight junction proteins are broken down (29), we studied the expression of different adhesion proteins in the colon and found that mRNA expression of different cell adhesion proteins was upregulated 48 h post-CLP coinciding with increased colonic permeability. Eadon et al. (30) demonstrated increased mRNA expression of various tight junctional proteins in the kidney following LPS-induced endotoxemia, with a reduced protein expression and their impaired localization in the intestinal epithelial barrier complex. The increase in mRNA thus could represent an attempted repair response. Our finding of increased claudin mRNA expression following various proinflammatory insults was also communicated by others (31).

In order to study whether immune cells residing in the spleen or GI tract wall were the main target population mediating the effects of GTS-21, we performed preventive splenectomy prior to CLP. Splenectomized mice appear to be protected: they displayed a normal GI transit and lower serum levels of the proinflammatory cytokines studied in comparison to their non-splenectomized counterparts following CLP. Recent papers highlight the role of the spleen as the predominant source of immune cells: preventive splenectomy protected against the development of DSS-colitis in mice (32) and against lethal sepsis (14). As GTS-21 did not lead to an additional benefit on serum cytokine levels in splenectomized animals, the main effects of GTS-21 observed during sepsis could be attributed to splenic immune cells. In vitro experiments attribute an important role to macrophages and dendritic cells. The absence of inflammation and decreased GI transit in splenectomized animals following CLP however could point toward the prevention of further activation of GI immune cells, which might explain why we did not observe an additional effect of GTS-21 on our outcome parameters.

The observation that GTS-21 still generated beneficial effects in septic Chrna7−/− mice that lack the α7nAChR needs further explanation. Mortality was increased in septic vehicle-treated Chrna7−/− mice, allocating a protective role to the α7nAChR during sepsis. Preventive administration of GTS-21 to Chrna7−/− mice did not improve survival following CLP. However, a clear numerical amelioration of GI transit and serum levels of proinflammatory cytokines was observed. This could be explained by the pharmacological properties of this compound, as GTS-21 can also bind onto the α4β2 nAChR (33). Van der Zanden et al. (34) demonstrated that activation of α4β2nAChR also inhibits secretion of proinflammatory cytokines from intestinal and peritoneal macrophages, with an increase in bacterial phagocytosis. Others demonstrated that activation of stomach macrophages could be attenuated via the nicotinic β2 receptor (35). The weak agonist activity of GTS-21 on the α4β2nAChR could very well explain some of the beneficial effects of GTS-21.

In summary, in an animal model of polymicrobial abdominal sepsis, we observed that inflammation at the GI tract level coincides with the occurrence of GI motility disturbances and translocation of bacteria from the GI tract into the bloodstream and lymphatics. Beneficial effects of GTS-21 were observed, such as a reduction in inflammation at the level of the GI tract, an amelioration of the colonic barrier function and a decrease in the number of positive blood cultures, a relevant clinical endpoint. These results, however, cannot be solely attributed to α7 nAChR activation. Limitations of this study include the simultaneous prophylactic and curative administration of the compound, reducing clinical applicability, and the fixed time point studied (48 h). The results, however, justify the need to further study possible therapeutic agents targeting the impaired GI mucosal barrier function and mucosal inflammation, as these drugs may prove to be advantageous in a subpopulation of septic patients.

Back to Top | Article Outline

Acknowledgments

The authors would like to thank Petra Aerts, Marleen Vinckx, Angelika Jürgens, and Lieve Vits for their excellent technical assistance, Christine Lammens and Mandy Andriessens for their indispensable help with the bacterial cultures, and Rita Van Den Bossche for meticulously preparing the histology slides.

Back to Top | Article Outline

REFERENCES

1. Angus DC, van der Poll T. Severe sepsis and septic shock. N Engl J Med 2013; 369 9:840–851.
2. Hassoun HT, Kone BC, Mercer DW, Moody FG, Weisbrodt NW, Moore FA. Post-injury multiple organ failure: the role of the gut. Shock 2001; 15 1:1–10.
3. Deitch EA. Gut-origin sepsis: evolution of a concept. Surgeon 2012; 10 6:350–356.
4. Levy G, Fishman JE, Xu D, Chandler BT, Feketova E, Dong W, Qin Y, Alli V, Ulloa L, Deitch EA. Parasympathetic stimulation via the vagus nerve prevents systemic organ dysfunction by abrogating gut injury and lymph toxicity in trauma and hemorrhagic shock. Shock 2013; 39 1:39–44.
5. Deitch EA, Xu D, Kaise VL. Role of the gut in the development of injury- and shock induced SIRS and MODS: the gut-lymph hypothesis, a review. Front Biosci 2006; 11:520–528.
6. Dellinger RP, Levy MM, Rhodes A, Annane D, Gerlach H, Opal SM, Sevransky JE, Sprung CL, Douglass IS, Jaeschke R, et al. Surviving sepsis campaign: international guidelines for management of severe sepsis and septic shock, 2012. Intensive Care Med 2013; 39 2:165–228.
7. Wang H, Yu M, Ochani M, Amella CA, Tanovic M, Susarla S, Li JH, Wang H, Yang H, Ulloa L, et al. Nicotinic acetylcholine receptor alpha7 subunit is an essential regulator of inflammation. Nature 2003; 421 6921:384–388.
8. Rosas-Ballina M, Olofsson PS, Ochani M, Valdes-Ferrer SI, Levine YA, Reardon C, Tusche MW, Pavlov VA, Andersson U, Chavan S, et al. Acetylcholine-synthesizing T cells relay neural signals in a vagus nerve circuit. Science 2011; 334 6052:98–101.
9. Chatterjee PK, Yeboah MM, Dowling O, Xue X, Powell SR, Al-Abed Y, Metz CN. Nicotinic acetylcholine receptor agonists attenuate septic acute kidney injury in mice by suppressing inflammation and proteasome activity. PLoS One 2012; 7 5:e35361.
10. van Westerloo DJ, Giebelen IA, Florquin S, Bruno MJ, Larosa GJ, Ulloa L, Tracey KJ, van der Poll T. The vagus nerve and nicotinic receptors modulate experimental pancreatitis severity in mice. Gastroenterology 2006; 130 6:1822–1830.
11. Kox M, Pompe JC, Peters E, Vaneker M, van der Laak JW, van der Hoeven JG, Scheffer GJ, Hoedemaekers CW, Pickkers P. alpha7 nicotinic acetylcholine receptor agonist GTS-21 attenuates ventilator-induced tumour necrosis factor-alpha production and lung injury. Br J Anaesth 2011; 107 4:559–566.
12. Huston JM, Gallowitsch-Puerta M, Ochani M, Ochani K, Yuan R, Rosas-Ballina M, Ashok M, Goldstein RS, Chavan S, Pavlov VA, et al. Transcutaneous vagus nerve stimulation reduces serum high mobility group box 1 levels and improves survival in murine sepsis. Crit Care Med 2007; 35 12:2762–2768.
13. Kessler W, Diedrich S, Menges P, Ebker T, Nielson M, Partecke LI, Traeger T, Cziupka K, Van der Linde J, Puls R, et al. The role of the vagus nerve: modulation of the inflammatory reaction in murine polymicrobial sepsis. Mediators Inflamm 2012; 2012:467620.
14. Huston JM, Ochani M, Rosas-Ballina M, Liao H, Ochani K, Pavlov VA, Gallowitsch-Puerta M, Ashok M, Czura CJ, Foxwell B, et al. Splenectomy inactivates the cholinergic antiinflammatory pathway during lethal endotoxemia and polymicrobial sepsis. J Exp Med 2006; 203 7:1623–1628.
15. Ji H, Rabbi MF, Labis B, Pavlov VA, Tracey KJ, Ghia JE. Central cholinergic activation of a vagus nerve-to-spleen circuit alleviates experimental colitis. Mucosal Immunol 2014; 7 2:335–347.
16. Khan MA, Farkhondeh M, Crombie J, Jacobson L, Kaneki M, Martyn JA. Lipopolysaccharide upregulates alpha7 acetylcholine receptors: stimulation with GTS-21 mitigates growth arrest of macrophages and improves survival in burned mice. Shock 2012; 38 2:213–219.
17. Pavlov VA, Ochani M, Yang LH, Gallowitsch-Puerta M, Ochani K, Lin X, Levi J, Parrish WR, Rosas-Ballina M, Czura CJ, et al. Selective alpha7-nicotinic acetylcholine receptor agonist GTS-21 improves survival in murine endotoxemia and severe sepsis. Crit Care Med 2007; 35 4:1139–1144.
18. Buras JA, Holzmann B, Sitkovsky M. Animal models of sepsis: setting the stage. Nat Rev Drug Discov 2005; 4 10:854–865.
19. Heylen M, Deleye S, De Man JG, Ruyssers NE, Vermeulen W, Stroobants S, Pelckmans PA, Moreels TG, Staelens S, De Winter BY. Colonoscopy and microPET/CT are Valid Techniques to Monitor Inflammation in the Adoptive Transfer Colitis Model in Mice. Inflamm Bowel Dis 2013; 19 5:967–976.
20. Seerden TC, De Man JG, Holzer P, Van den Bossche RM, Herman AG, Pelckmans PA, De Winter BY. Experimental pancreatitis disturbs gastrointestinal and colonic motility in mice: effect of the prokinetic agent tegaserod. Neurogastroenterol Motil 2007; 19 10:856–864.
21. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 2009; 55 4:611–622.
22. Lange S, Delbro DS, Jennische E. Evans blue permeation of intestinal mucosa in the rat. Scand J Gastroenterol 1994; 29 1:38–46.
23. Overhaus M, Togel S, Pezzone MA, Bauer AJ. Mechanisms of polymicrobial sepsis-induced ileus. Am J Physiol Gastrointest Liver Physiol 2004; 287 3:G685–G694.
24. Rivers EP, Jaehne AK, Nguyen HB, Papamatheakis DG, Singer D, Yang JJ, Brown S, Klausner H. Early biomarker activity in severe sepsis and septic shock and a contemporary review of immunotherapy trials: not a time to give up, but to give it earlier. Shock 2013; 39 2:127–137.
25. Wintersteller S, Hahnhaussen J, Kofler B, Emmanuel K. Molecular mediators of polymicrobial sepsis. Front Biosci (Elite Ed) 2012; 4:2584–2604.
26. Deitch EA. Gut lymph and lymphatics: a source of factors leading to organ injury and dysfunction. Ann N Y Acad Sci 2010; 1207 (suppl 1):E103–E111.
27. Wang Q, Fang CH, Hasselgren PO. Intestinal permeability is reduced and IL-10 levels are increased in septic IL-6 knockout mice. Am J Physiol Regul Integr Comp Physiol 2001; 281 3:R1013–R1023.
28. Fink MP. Sepsis, ghrelin, the cholinergic anti-inflammatory pathway, gut mucosal hyperpermeability, and high-mobility group box 1. Crit Care Med 2009; 37 8:2483–2485.
29. MacFie J, O’Boyle C, Mitchell CJ, Buckley PM, Johnstone D, Sudworth P. Gut origin of sepsis: a prospective study investigating associations between bacterial translocation, gastric microflora, and septic morbidity. Gut 1999; 45 2:223–228.
30. Eadon MT, Hack BK, Xu C, Ko B, Toback FG, Cunningham PN. Endotoxemia alters tight junction gene and protein expression in the kidney. Am J Physiol Renal Physiol 2012; 303 6:F821–F830.
31. Van Itallie CM, Anderson JM. Claudins and epithelial paracellular transport. Annu Rev Physiol 2006; 68:403–429.
32. Munyaka P, Rabbi MF, Pavlov VA, Tracey KJ, Khafipour E, Ghia JE. Central muscarinic cholinergic activation alters interaction between splenic dendritic cell and CD4+CD25- T cells in experimental colitis. PLoS One 2014; 9 10:e109272.
33. Briggs CA, Anderson DJ, Brioni JD, Buccafusco JJ, Buckley MJ, Campbell JE, Decker MW, Donnelly-Roberts D, Elliott RL, Gopalakrishnan M, et al. Functional characterization of the novel neuronal nicotinic acetylcholine receptor ligand GTS-21 in vitro and in vivo. Pharmacol Biochem Behav 1997; 57 (1–2):231–241.
34. van der Zanden EP, Snoek SA, Heinsbroek SE, Stanisor OI, Verseijden C, Boeckxstaens GE, Peppelenbosch MP, Greaves DR, Gordon S, de Jonge WJ. Vagus nerve activity augments intestinal macrophage phagocytosis via nicotinic acetylcholine receptor alpha4beta2. Gastroenterology 2009; 137 3:1029–1039.
35. Nemethova A, Michel K, Gomez-Pinilla PJ, Boeckxstaens GE, Schemann M. Nicotine attenuates activation of tissue resident macrophages in the mouse stomach through the beta2 nicotinic acetylcholine receptor. PLoS One 2013; 8 11:e79264.
Keywords:

Bacterial translocation; gastrointestinal immune system; GTS-21; polymicrobial abdominal sepsis; septic ileus; vagal anti-inflammatory pathway; α7nAChR; alpha7 nicotinic acetylcholine receptor; cDC; conventional dendritic cells; CDS; clinical disease score; Chrna7; gene for the alpha7 nicotinic acetylcholine receptor; CLP; cecal ligation and puncture; EB; Evans blue; GI; gastrointestinal; IFN; interferon; IL; interleukin; i.p.; intraperitoneally; LPS; lipopolysaccharide; MLN; mesenteric lymph node; PBS; phosphate-buffered saline; s.c.; subcutaneously; SPLX; splenectomy; TNF; tumor necrosis factor; VNS; vagal nerve stimulation

Supplemental Digital Content

Back to Top | Article Outline
© 2016 by the Shock Society