Secondary Logo

Journal Logo

DIFFERENTIAL SUSCEPTIBILITY OF HUMAN SP-B GENETIC VARIANTS ON LUNG INJURY CAUSED BY BACTERIAL PNEUMONIA AND THE EFFECT OF A CHEMICALLY MODIFIED CURCUMIN

Xu, Yongan; Ge, Lin; Abdel-Razek, Osama; Jain, Sumeet; Liu, Zhiyong; Hong, Yucai; Nieman, Gary; Johnson, Francis; Golub, Lorne M.; Cooney, Robert N.; Wang, Guirong

doi: 10.1097/SHK.0000000000000535
2015 New Investigator Award Competition
Free

ABSTRACT Staphylococcus aureus is a common cause of nosocomial pneumonia frequently resulting in acute respiratory distress syndrome (ARDS). Surfactant protein B (SP-B) gene expresses two proteins involved in lowering surface tension and host defense. Genotyping studies demonstrate a significant association between human SP-B genetic variants and ARDS. Curcumins have been shown to attenuate host inflammation in many sepsis models. Our hypothesis is that functional differences of SP-B variants and treatment with curcumin (CMC2.24) modulate lung injury in bacterial pneumonia. Humanized transgenic mice, expressing either SP-B T or C allele without mouse SP-B gene, were used. Bioluminescent labeled S. aureus Xen 36 (50 μL) was injected intratracheally to cause pneumonia. Infected mice received daily CMC2.24 (40 mg/kg) or vehicle alone by oral gavage. Dynamic changes of bacteria were monitored using in vivo imaging system. Histological, cellular, and molecular indices of lung injury were studied in infected mice 48 h after infection. In vivo imaging analysis revealed total flux (bacterial number) was higher in the lung of infected SP-B-C mice compared with infected SP-B-T mice (P < 0.05). Infected SP-B-C mice demonstrated increased mortality, lung injury, apoptosis, and NF-κB expression compared with infected SP-B-T mice. Compared with controls, CMC2.24 treatment significantly reduced the following: mortality, total bacterial flux and lung tissue apoptosis, inflammatory cells, NF-κB expression (P < 0.05), and MMPs-2, -9, -12 activities (P < 0.05). We conclude that mice with SP-B-C allele are more susceptible to S. aureus pneumonia than mice with SP-B-T allele, and that CMC2.24 attenuates lung injury thus reducing mortality.

*Department of Surgery, SUNY Upstate Medical University, Syracuse, New York

Department of Emergency Medicine, Second Affiliated Hospital Zhejiang University School of Medicine, Hangzhou, People's Republic of China

Department of Biochemistry and Molecular Biology, Tianjin Medical University, Tianjin, People's Republic of China

§Department of Pharmacological Sciences

||Department of Oral Biology and Pathology, State University of New York at Stony Brook, Stony Brook, New York

Address reprint requests to Guirong Wang, PhD, (Dr. rer. Nat.), Department of Surgery, UH Room 8715, SUNY Upstate Medical University, 750 E Adams St, Syracuse, NY 13210. E-mail: wangg@upstate.edu.

Received 18 May, 2015

Revised 8 June, 2015

Accepted 4 November, 2015

This study is supported in part by NIH (HL096007), Hendricks foundation and the Natural Science Foundation of China (Grant No. 81201478), The Specialized Research Fund of Doctoral Program of Higher Education (Grant No. 20120101120035).

This study was selected as one of the New Investigator Nominees at the 38th Annual Conference on Shock, held in Denver, Colorado, June 6–9, 2015.

Conflict of interests: list patent applications on this compound; LMG patent fully assigned to SUB; FJ patent assigned to Chem-Master Ins. Inc; YX, OA-R, GW patent fully assigned to the research foundation for SUNY. The other authors have no relevant conflicts of interest.

Back to Top | Article Outline

INTRODUCTION

Bacterial pneumonia is one of the major causes of acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) (1). ALI and ARDS are life-threatening conditions with an incidence of 79 per 100,000 in the United States (2). Staphylococcus aureus is a common gram-positive and opportunistic pathogen, which causes half a million infections a year including pneumonia and approximately 20,000 deaths per year in the United States (2, 3).

Surfactant deactivation has been shown to be an important mechanism for mediating lung injury. Alveolar Type II epithelial cells in the lung secrete four surfactant proteins that are distributed on the surface of the alveoli. The hydrophobic surfactant protein B (SP-B) is of particular importance (4). The SP-B gene expresses two protein products, SP-BM and SP-BN, involved in lowering surface tension and promoting host defense, respectively (5). The main function of SP-BM protein is to form the monolayer of phospholipids on the surface of alveoli and reduce the surface tension, thus preventing the collapse of alveoli and maintaining respiration. SP-BN protein functions as a host defense molecule and plays a role in pulmonary bacterial clearance (5). Human SP-B gene has an important single nucleotide polymorphism (SNP rs1130866, i.e., SP-B C/T1580) in the N-terminal sapolin-like domain that produces SP-BN protein. The SP-B C/T1580 polymorphism forms two common genetic alleles, SP-B C and T alleles, with differing ability to maintain respiratory homeostasis and optimal host defense. Wang et al. have shown in an in vitro study that proteins from SP-B C and T alleles contain different post-translational modifications, in particular the SP-B C allele has one additional glycosylation site compared with the T allele (6). This altered glycosylation may impact SP-B protein processing and function (6).

Humanized transgenic (hTG) mouse models provide a powerful tool for studying the pathophysiological function of human genetic gene/variants (alleles) in clinically important diseases (7, 8). The hTG model can elucidate subtle differences in phenotypes caused by human genetic variants and overcome study limitations in infectious diseases in vivo(9). We recently generated hTG SP-A mice and showed that the formation of the tubular myelin (TM) in vivo requires both SP-A1 and SP-A2 gene products (10). Thus, hTG mice are an ideal in vivo system to study functional differences between SP-B C and T alleles in bacterial pneumonia. Additionally, to monitor the changes of bacterial dynamic growth we have used bioluminescent labeled S. aureus and an in vivo imaging system (11). The advanced hTG mouse model provides us with a unique opportunity to investigate functional differences of SP-B genetic variants in vivo and to monitor dynamic changes in bacterial growth in our pneumonia model.

During infection, increased neutrophil infiltration, lung tissue apoptosis, cytokine synthesis, and degradation of lung matrix result in severe lung injury. Curcumin [1,7-bis-(4-hydroxy-3-methoxy phenyl)-1,6-heptadiene-3,5-dione], a component of turmeric, is extracted from the rhizomes of the plant curcuma longa, which possesses several pharmacological properties including anti-inflammatory and anti-oxidant effects. Curcumin also selectively inhibits the activities of inducible matrix metalloproteinases (MMPs), and down-regulates expression of pro-inflammatory cytokines through modulation of NF-κB and related signaling pathways (12, 13). We have found that a novel chemically modified curcumin, CMC2.24, is more potent than natural curcumins in the inhibition of apoptosis, inflammation, and inducible MMPs, all of which contribute to tissue injury; and CMC2.24 displays enhanced bioactivity and bioavailability with decreased toxicity (14, 15). In the present study, we investigated the differential effects of human SP-B C and T alleles in the presence or absence CMC2.24 by bacterial pneumonia model in humanized SP-B transgenic mice. We have observed differential susceptibility to bacterial pneumonia between hTG SP-B-C and SP-B-T mice and the protective roles of CMC2.24 in the lung injury of infected mice.

Back to Top | Article Outline

MATERIALS AND METHODS

Mice

hTG SP-B mice (FVB/N strain background) carrying either human SP-B C or T allele without mouse SP-B gene were used in this project. The hTG SP-B-C and SP-B-T mice were recently generated by our laboratory (generation and characterization of these hTG SP-B mice are described in a subsequent paper (16) and maintained in the Department of Laboratory Animal Resources of SUNY Upstate Medical University. The hTG SP-B mice were bred at least 10 generations to stabilize the transgenic SP-B expression. Human SP-B expression of hTG SP-B mice was examined by Western blot analyses and immunohistochemistry. The presence of human SP-B (hSP-B) gene and the absence of mouse SP-B (mSP-B) gene in hTG SP-B-C and SP-B-T mice were confirmed by genotyping PCR analysis with primer pair 1458/189 (sense: GGAGGGCCAGGAACAAACAGG; antsense: CATACAGATGCCGTTTGAGTC) for hSP-B gene and primer pair 75/76 (sense: ATCCTCCCTTCTCTGCTCTCC; antisense; TGTGCTTATTGCGTCTGTGG) for mSP-B gene, respectively. To further examine whether there is mouse SP-B mRNA expression in hTG SP-B-C and SP-B-T mice, total RNAs from lung tissue were isolated and reverse transcription PCR (RT-PCR) was performed with primer pair 739/614 (sense TACTCCGTCATCCTGCTCGA and antisense GCTGCTCCACAAATTGCTTG for hSP-B mRNA) and primer pair (sense CCTGCCCCTGGTTATTGACTACTT within mSP-B exon 4 and antisense GGACACAGCCACAGCCAGCACAC within mSP-B exon 7) for mSP-B mRNA. Both male and female mice, 8 to 12 weeks old, were distributed into three experimental groups: the pneumonia group (Pneu, S. aureus infection only), pneumonia plus CMC2.24 treatment group (Pneu + CMC2.24, S. aureus infection plus CMC2.24), and the control group (sham, treated with sterile vehicle). All protocols related to animal experiments were approved by the institutional animal care and use committee of SUNY Upstate Medical University. Experiments were performed according to the National Institutes of Health guidelines and ARRIVE guidelines on the use of laboratory animals.

Back to Top | Article Outline

Curcumin derivative

Tri-ketonic chemically modified curcumin (CMC2.24) having enhancing zinc-binding ability (vs. di-ketonic natural curcumin) was obtained from Dr Francis Johnson's laboratory. CMC2.24 (10 mg) was suspended in 3 mL of 2% carboxymethyl cellulose vehicle, and then each mouse was administrated 0.3 mL of the CMC2.24 solution daily (equal to 40 mg of CMC2.24/kg mouse weight) or the same volume of vehicle alone (control group) by oral gavage (17).

Back to Top | Article Outline

S. aureus-induced pneumonia model

Pilot experiments were performed to establish the S. aureus Xen36 pneumonia model using different doses of bacteria to infect mouse lung. The results indicated that a dose of 5 × 108 CFU/mouse in 50 μL of bacterial solution was optimal, because mice infected at this level of bacteria produced enough bioluminescent signal in the lung to be detected by the in vivo imaging system and had a reasonable survival rate at 48 h after infection. Therefore, direct intratracheal inoculation of bioluminescent S. aureus Xen36 at a dose of 5 × 108 CFU/50 μL per mouse was used to infect mice in all subsequent experiments (18). In brief, hTG SP-B mice were anesthetized using intraperitoneal ketamine/xylazine (90 mg/kg ketamine, 10 mg/kg xylazine) injection. A 0.5-cm mid-line neck incision was made to expose the trachea. In the sham group, 50 μL of sterile vehicle was injected into the trachea by the same method. After infection, bioluminescence signal was monitored and quantified by an in vivo imaging system (Xenogen-200 series, Caliper Life Sciences, Hopkinton, MA). Buprenorphine (0.05 mg/kg body weight) was injected for postoperative analgesia every 8 to 12 h. Mice were returned to their cages in a temperature-controlled room (22°C) with 12-h light and dark cycles, and monitored every 4 h. Mice were anesthetized with isoflurane (2%) at several time points after infection (0, 12, 24, 28, 32, and 48 h) (11). At 48 h after S. aureus infection, mice were sacrificed under anesthesia. Blood and bronchoalveolar lavage fluid (BALF), lung tissue were harvested or fixed for further study. In the CMC2.24-treated group, the mice were administered a dose of CMC2.24 (40 mg/kg) by oral gavage 30 min before bacterial infection, and then received second dose of CMC2.24 at 24 h after infection. In addition, to identify whether the outcomes of CMC2.24 treatment result from the effect of bacterial infection and induced inflammation, we performed a noninfectious lung injury model in hTG SP-B-C and SP-B-T mice by means of intranasal treatment with 50 μL/mouse hydrochloric acid (HCl, 0.1 N) in saline, in which the mice were administered a dose of CMC2.24 (40 mg/kg) or vehicle by oral gavage 30 min before HCl treatment (n = 8 mice per group). The mice were then sacrificed 6 h post-treatment for further analysis.

Back to Top | Article Outline

In vivo imaging analysis

The mice were monitored for 48 h after infection. Photographs were captured with a cooled CCD camera (Xenogen-200 series, Caliper Life Sciences, Hopkinton, MA). Pseudo-colored images of photon emissions were covered on gray scale images of the mouse to obtain spatial localization of the bioluminescent signals. For each in vivo imaging experiment: five mice were placed in the induction chamber at one time and anesthetized with isoflurane (2% in oxygen), and then placed into the IVIS-200 imaging chamber with continuous anesthesia. Images were performed for an initial exposure (5 min) by an in vivo imaging system (19).

Back to Top | Article Outline

Inflammatory cell analysis in BALF

After harvest, the BALF was centrifuged at 250 × g. The supernatants were saved in −20°C freezer for further analysis. The pellets were resuspended and wash with 1 mL of sterile saline, and then the cells were mounted on a slide by cytospin centrifuge at 1000 rpm for 3 min (Hettich ROTOFIX 32A). Slides were stained by using the Hema-3 Stain Kit. Cells were examined by Nikon Eclipse TE2000-U research microscope (Nikon, Melville, NY).

Back to Top | Article Outline

Histopathological analysis

After sacrifice, the lungs were fixed in 10% neutral formalin for at least 24 h, and embedded in paraffin. Approximately 5-μm slides of lung tissues from eight mice for each group were prepared and stained with Hematoxylin and Eosin (H&E). Digital photos were taken with a light research microscope (Nikon, Melville, NY) and used for quantitative analysis according to the histological lung injury score system described previously (20). All slides were examined blindly by two experienced investigators. In brief, lung slides were evaluated using a 0-2 scale. The presence of alveolar (A) and interstitial neutrophils (B), alveolar hyaline membranes (C), proteinaceous debris (D) filling the air spaces, and alveolar septal thickening (E) were scored in 20 high power fields for each slide. The resulting scores were calculated by the following formula: Score = [(20 × A) + (14 × B) + (7 × C) + (7 × D) + (2 × E)]/(20 × 100).

Back to Top | Article Outline

Immunohistochemistry (IHC)

To identify human SP-B expression in the lung tissues of hTG SP-B mice, tissue sections on the slides from sham group were examined by the IHC method. In brief, the sections were dewaxed, and blocked endogenous peroxidase activity in 3% H2O2 for 10 min. After incubating with 10% goat serum for 40 min at room temperature, the sections were incubated with anti-SP-B antibody (1:400, Hycult biotech, Plymouth Meeting, PA) at 4°C overnight. Subsequently, biotinylated secondary antibody (Vector Laboratories, Burlingame, CA) at 1:2,000 dilution was used for hybridization at 37°C for 30 min. DAB was used as a chromogenic substrate to develop color in the section for 3 to 10 min. Finally, the sections were counterstained for 1 to 3 min with hematoxylin.

Back to Top | Article Outline

Apoptotic cells by TUNEL assay

Lung tissue sections (∼5 μm) were incubated at 60°C for 20 min, and then deparaffinized in xylene twice every 10 min, treated with different concentration grades of alcohol [100%, 90%, 80%, and 70% ethanol/ddH2O], and then rinsed in phosphate buffer saline (PBS, pH7.5). Apoptotic cells were detected by means of a deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) kit (Roche, Indianapolis, IN) according to the manufacturer's instructions. Cell apoptosis was quantified by counting the number of TUNEL-positive cells in 20 random fields at ×400 magnification (21).

Back to Top | Article Outline

Western blotting analysis

Frozen lungs were homogenized in RIPA buffer containing a cocktail of protease- and phosphatase-inhibitors (Roche), and the supernatants were used for Western blot analysis (21). Total protein concentrations of samples (lungs and BALF) were determined using the BCA micro assay kit (Thermo Scientific, Rockford, IL). Total protein (40 μg) was resolved by reducing (for NF-κB, Caspase-3, Bcl-2) and non-reducing (for SP-B) 12% SDS-polyacrylamide gel electrophoresis, and then transferred onto PVDF membranes at 4°C (Bio-Rad, Hercules, Calif). After that, the blot was blocked in 5% non-fat milk of Tris-buffered saline, and detected using a primary antibody against NF-κB (1:400, Santa Cruz Biotechnology, Dallas, Tex), Caspase-3 (1:400, Santa Cruz Biotechnology), and Bcl-2 (1:400, Santa Cruz Biotechnology), as well as an anti-SP-B antibody (1:2000, Hycult biotech, Plymouth Meeting, PA). Thereafter, an anti-rabbit secondary antibody conjugated with horseradish peroxidase was applied (21). To standardize each protein in the blot, the blot was stripped and reprobed with β-Actin anti-body (1:400, Santa Cruz Biotechnology). Immuno-products were detected using Pierce ECL Western Blotting Substrate (Thermo Scientific, Rockford, IL) and the blots were exposed to X-film (ThermoFisher Scientific, Waltham, Mass). Human BALF and proteins from sham mouse lung tissue were used as controls. The bands on films were quantified by Image J software version 1.48 (Wayne Rasband, NIH, Bethesda, MA).

Back to Top | Article Outline

MMPs activity by zymography

Aliquots of BALF containing 10 μg total protein were loaded onto a 10% polyacrylamide gel containing 0.1% (wt/vol) gelatin (from denatured type I collagen) under reducing conditions to determine different molecular levels of MMP-2 and MMP-9. After electrophoresis, the gel was washed with renaturing buffer (2.5% Triton X-100) for 30 min, and incubated with 100 mL of developing buffer (40 mM Tris, 200 mM NaCl, and 10 mM CaCl2; pH 7.5) at room temperature for 30 min and then at 37°C for 24 h with gentle agitation. The gel was then stained in 0.05% (wt/vol) Coomassie Brilliant Blue, 30% (vol/vol) methanol, and destained in 10% (vol/vol) acetic acid for 1 h and repeatedly for additional 3 h. For MMP-12 analysis, BALF containing 10 μg of total proteins was used on a 12% polyacrylamide gel containing 0.05% (wt/vol) casein following the same above protocol. PageRuler prestained protein ladders (10–170 kDa) were used as molecular weight markers (Thermo Scientific, Rocklord, IL). Densitometry determinations were carried out using Image J software version 1.48 (Wayne Rasband, National Institutes of Health, Bethesda, MA).

Back to Top | Article Outline

Statistical analysis

All data are presented as means ± SEM. Data were compared using Student t test or ANOVA by SigmaStat software (version 3.5). Animal survival analysis was performed by the Kaplan–Meier survival method. For all comparisons, P < 0.05 was considered statistically significant.

Back to Top | Article Outline

RESULTS

Human SP-B expression in hTG SP-B mice

To examine human SP-B protein expression in the lung tissues of hTG SP-B-C and SP-B-T mice, BALF and lung tissues from Sham SP-B-C and SP-B-T mice (n = 5 for each) were analyzed by Western blot and IHC. The results showed that the levels of SP-B protein are similar in the lung of hTG SP-B-C and SP-B-T mice compared with that of human lung (Fig. 1A). The results from IHC analysis indicate human SP-B protein expression in alveolar epithelial type II cells in the lung of hTG SP-B-C and SP-B-T mice (Fig. 1, B and C). Genotyping analysis of the DNA from mouse lung showed mouse SP-B gene deficiency in hTG SP-B-C and SP-B-T mice but human SP-B DNA (Fig. 1D). Furthermore, mRNA expression of mouse and human SP-B gene was analyzed by RT-PCR with appropriate controls. The results indicate that no mouse SP-B mRNA but only human SP-B mRNA was expressed in the lung of hTG SP-B-C and SP-B-T mice (Fig. 1E). These data demonstrate that only human SP-B gene but not mouse SP-B was expressed in the lung of hTG SP-B-C and SP-B-T mice.

Fig. 1

Fig. 1

Back to Top | Article Outline

In vivo measurement to S. aureus infection in hTG SP-B-C and SP-B-T mice using bioluminescence analysis

To study functional differences of human SP-B genetic variants in the bacterial pneumonia, we measured bacterial dynamic changes in the lungs of hTG SP-B-C and SP-B-T mice after intratracheal infection of bioluminescent labeled S. aureus at six time points, i.e., 0, 12, 24, 28, 32, 48 h after infection. The results from in vivo image analysis showed the level of bioluminescence was significantly higher (P < 0.01) in the infected SP-B-C mice from 24 to 48 h after infection, compared with infected SP-B-T mice (Fig. 2). For infected SP-B-C mice, the levels of bioluminescence increased rapidly from 0 to 24 h after infection, remained high between 24 and 32 h, and then decreased (Fig. 2B). In infected SP-B-T mice, the peak time of bioluminescence was at 12 h after infection, and then the level decreased slowly (Fig. 2B). In addition, there are different mortality rates between infected SP-B-C and SP-B-T mice (62.8% vs. 33.3%, P < 0.01) by 48 h after infection (Fig. 2C). These results indicate that greater resistance to S. aureus Xen36 bacterial infection exists in SP-B-T mice compared with SP-B-C mice.

Fig. 2

Fig. 2

Back to Top | Article Outline

The effect of CMC2.24 on S. aureus resistance in hTG SP-B-C and SP-B-T mice using in vivo bioluminescence analysis

To study the effect of CMC2.24 in bacterial pneumonia, infected SP-B-C and SP-B-T mice were administered a daily dose of CMC2.24 (40 mg/kg) or vehicle (control). The results showed significantly decreased bacterial load in the CMC2.24-treated group compared with the control (Fig. 3). For SP-B-C mice, the bioluminescence levels were significantly lower (P < 0.01) in the CMC2.24-treated group from 24 to 48 h after infection, compared with the control (Fig. 3B). Similar effects were observed in SP-B-T mice (Fig. 3C). Furthermore, we observed lower mortality rate in the CMC2.24-treated SP-B-C mice compared with the untreated SP-B-C mice (50% vs. 76%, P < 0.05) (Fig. 3D), but no difference was observed between CMC2.24 treated and untreated SP-B-T mice (32% vs. 33%).

Fig. 3

Fig. 3

Back to Top | Article Outline

Lung histology

To assess the effects of human SP-B genetic variants and CMC2.24 on lung injury in pneumonia, we examined lung histopathology of the three groups (Sham, Pneu, Pneu + CMC) at 48 h after infection. The results showed obvious pathological changes in lung histology 48 h after infection with or without CMC2.24 treatment (Pneu, Pneu + CMC) but not in Sham mice (Fig. 4A). CMC2.24-treated mice showed decreased lung injury by histology and scores compared with control mice 48 h after infection, including fewer neutrophils in the alveolar space and interstitial membrane, decreased accumulation of proteinaceous debris, and thinner alveolar walls in the lung (Fig. 4A). Furthermore, quantitative analysis indicates the lung injury scores of both CMC2.24-treated SP-B-C and SP-B-T mice (Pneu + CMC) are lower (P < 0.01) compared with the Pneu mice, but larger than that of Sham mice (Fig. 4B). The lung injury scores of infected SP-B-C mice with and without CMC2.24 are larger (P < 0.01) than those of infected SP-B-T mice with and without CMC2.24, respectively (Fig. 4B).

Fig. 4

Fig. 4

Back to Top | Article Outline

Lung apoptosis

We examined apoptotic cells and apoptosis-related protein (biomarker) expression in the lung tissues of three experimental groups (Sham, Pneu, Pneu + CMC) by TUNEL assay. As shown in Figure 5A, apoptotic cells exhibit brown nucleus in infected mice but not for Sham mice. Lung tissues from infected SP-B-C mice (Pneu) showed more apoptotic cells compared with infected SP-B-T mice (Pneu) (P < 0.01) (Fig. 5, A and B). CMC2.24-treated mice showed decreased apoptotic cells (P < 0.01) when compared with their respective controls (Pneu).

Fig. 5

Fig. 5

We also examined the expression of two apoptosis-related proteins in the lung tissues by Western blot analysis. Representative Western blots are shown for each experimental group (Fig. 6, A and B). Caspase-3 (Cap-3), as one biomarker of cell apoptosis, correlated positively with apoptosis. The results showed significant increase of Cap-3 expression in the lungs of infected SP-B-C and SP-B-T mice compared with Sham mice (Fig. 6A, P < 0.01). CMC2.24-treated SP-B-C and SP-B-T mice showed decreased levels of Cap-3 expression compared with their respective control mice (Fig. 6A, P < 0.01). We further examined another biomarker of apoptosis, Bcl-2 as an inhibitor of apoptosis. The expression of Bcl-2 decreased in infected SP-B-C and SP-B-T mice compared with Sham mice (Fig. 6B, P < 0.01). CMC2.24 treatment caused increased levels of Bcl-2 expression in the lung tissues from infected SP-B-C and SP-B-T mice compared with SP-B-C (P < 0.01) and SP-B-T (P < 0.05) controls, respectively (Fig. 6B).

Fig. 6

Fig. 6

Back to Top | Article Outline

Inflammatory cells in BALF

We assessed number of inflammatory cells in the BALF from three experimental groups: Pneu, Pneu + CMC, and Sham mice. As shown in Fig. 7A, the BALF from Sham mice consisted of 98% alveolar macrophages without neutrophils. On the other hand, a larger increase in inflammatory cells (neutrophils and macrophages/monocytes) was observed in the BALF of Pneu mice, along with decreased neutrophils and macrophages in the BALF of Pneu + CMC treated mice. Quantitative analysis showed the number of neutrophils in the BALF of infected SP-B-C and SP-B-T mice with or without CMC2.24 was larger than that of Sham mice (Fig. 7B, P < 0.01). The number of neutrophils decreased significantly in the BALF of both SP-B-C (P < 0.01) and SP-B-T (P < 0.05) after CMC2.24 treatment compared with their respective untreated groups (Fig. 7B). Similar results were observed for macrophages/monocytes in the BALF from infected SP-B-C and SP-B-T mice (Fig. 7C).

Fig. 7

Fig. 7

Back to Top | Article Outline

Lung NF-κB activation

Previous studies have shown that one of two SP-B gene products is involved in host defense and curcumins can regulate host inflammation induced by sepsis through attenuating NF-κB activation (12, 13). We therefore examined the levels of NF-κB p65 and phosphorylated-IκB-α (p-IκB-α) in the lung using Western blotting analysis with antibodies against NF-κB p65 and p-IκB-α. The results showed increased levels of NF-κB p65 and p-IκB-α in the lung of infected groups (Pneu and Pneu + CMC) compared with Sham mice (Fig. 8, P < 0.01). Differences in the levels of NF-κB p65 and p-IκB-α expression were observed between infected SP-B-C and SP-B-T mice (Fig. 8, P < 0.05). The levels of NF-κB p65 and p-IκB-α in the lungs of infected SP-B-C mice were higher than those observed in CMC2.24 treated mice (Fig. 8, P < 0.01). The levels of NF-κB of p-IκB-α in infected P-B-C were significantly higher than that of infected SP-B-T mice (P < 0.05).

Fig. 8

Fig. 8

Back to Top | Article Outline

SP-B levels in BALF

We determined the levels of SP-B protein in the BALF from SP-B-C and SP-B-T mice at 48 h in the Pneu, Pneu + CMC, and Sham mice. The level of SP-B protein in BAL fluids from sham mice was higher than those observed in infected mice (Fig. 9A, P < 0.01). SP-B levels in BALF from CMC2.24-treated SP-B-C and SP-B-T mice were higher than their respective untreated groups (Fig. 9B, P < 0.05).

Fig. 9

Fig. 9

Back to Top | Article Outline

MMPs activity in BALF

Previous studies have shown CMC2.24 can inhibit MMP activity (14). Therefore, we examined MMP-2, -9, and -12 activities in the BALF using zymographic analysis. The results demonstrate that the BALF from sham mice has minimal activity of MMP-2, -9,and -12, but infected SP-B-C and SP-B-T mice exhibit increased MMP-2, -9, and -12 activities (Fig. 10, P < 0.01). CMC2.24-treated SP-B-C and SP-B-T mice had decreased MMP-2, -9, and -12 activities compared with their respective untreated groups (Fig. 10, B–D, P < 0.05).

Fig. 10

Fig. 10

Furthermore, to determine whether the effects of CMC2.24 and the differences between the two SP-B genetic variants result from an effect on bacterial infection or altered inflammation itself, a noninfectious lung injury model was employed by means of intranasal treatment of 50 μL of hydrochloric acid (HCl, 0.1 N) per mouse, with and without CMC2.24 in hTG SP-B-C and SP-B-T mice. The results showed that the scores of lung injury decreased in the CMC2.24-treated mice compared with vehicle-treated mice 6 h after HCl treatment (CMC2.24-treated vs. vehicle-treated, SP-B-C: 0.22 + 0.03 vs. 0.38 + 0.03, P < 0.05, n = 10; SP-B-T: 0.15 + 0.02 vs. 0.31 + 0.03, respectively, P < 0.05 n = 10). The injury scores of CMC2.24-treated and vehicle-treated SP-B-T mice were lower than that of CMC2.24-treated and vehicle-treated SP-B-C mice (P < 0.05), respectively. Analysis of inflammatory cells in the BALF indicated decreased inflammatory cells in the CMC2.24-treated mice compared with vehicle-treated mice 6 h after HCl treatment (CMC2.24-treated vs. vehicle-treated, SP-B-C: 1.8 + 0.4 × 107 vs. 5.2 + 0.6 × 107, P < 0.05, n = 10; SP-B-T: 1.1 + 0.3 × 107 vs. 4.1 + 0.5 × 107, respectively, P < 0.05 n = 10). The number of inflammatory cells in BALF of CMC2.24-treated and vehicle-treated SP-B-T mice was lower than that of CMC2.24-treated and vehicle-treated SP-B-C mice (P < 0.05), respectively. These results suggest that CMC2.24 attenuates lung injury in a noninfectious model and SP-B-C mice are more susceptible to noninfectious injury than SP-B-T mice.

Back to Top | Article Outline

DISCUSSION

Pneumonia is the leading cause of infectious morbidity and mortality in the United States. It is a major cause of ALI and ARDS which have very high associated mortality (40%–60%). It is currently unclear why some individuals are more susceptible to bacterial pneumonia compared with others; however, genetic variations of SP-B with subsequent loss of surfactant activity appear to be critical in ARDS progression (22–24) and may explain clinically observed differences in morbidity and mortality in patients with pneumonia-induced ARDS. In the present study, we investigated the functional differences of hTG SP-B-C and SP-B-T mice in response to S. aureus infection with or without CMC 2.24 treatment. We found significantly different resistance profiles of hTG SP-B-C and SP-B-T mice to bacteria using our in vivo imaging method, as well as differing lung injury patterns as evidenced by histopathology, cell, and molecular analyses. We also found that CMC2.24 attenuates lung injury after bacterial infection by diminishing lung inflammation, apoptosis, and MMP activation.

SP-B, a key component of pulmonary surfactant, is essential for normal lung function (25). In fact, an acute reduction in SP-B by 75% to 80% causes lethal respiratory failure in animals (26). Likewise, SP-B levels are decreased by up to 60% in patients with acute lung injury and ARDS due to enhanced SP-B turnover and degradation, contributing to their prolonged respiratory failure (23). The SP-B gene expresses two protein products, SP-BM and SP-BN, which are involved in lowering surface tension and innate host defense respectively (5). Although a number of hSP-B polymorphisms and mutations have been identified, the SNP rs1130866, i.e., SP-BC/T1580 is functionally one of the most important (27, 28). This SP-BC/T1580 polymorphism is not only associated with pneumonia and pneumonia-induced ARDS (22, 29, 30), but also with neonatal respiratory distress syndrome (RDS) (31), and interstitial lung disease (ILD) (32). The detailed mechanisms for the increased susceptibility of SP-B C allele to these pulmonary diseases are unknown (6, 28, 33). The results of this study indicate SP-B-C mice are more susceptible to bacterial infection with increased lung injury severity and lung inflammation compared with SP-B-T mice. Because the only difference between SP-B-C and SP-B-T mice is the SP-B gene, the products of SP-B C and T alleles cause the differential response to bacterial pneumonia in these two mouse lines. We also observed the SP-B level in the BAL fluid of infected SP-B-C mice decreased more than that of infected SP-B-T mice despite similar SP-B levels between normal SP-B-C and SP-B-T mice, suggesting that the key difference is in SP-B processing and/or degradation during S. aureus pneumonia.

Our results demonstrate that CMC2.24 has a protective effect on lung injury in this model of bacterial pneumonia, including better survival rate from 28 to 48 h after infection in CMC-treated mice. Previous studies demonstrate that curcumins are involved in the modulation of inflammatory signaling pathways and mediators, including reduction in NF-κB activation and lipid-derived inflammatory mediators, inhibition of reactive oxygen species (ROS) and reactive nitrogen species (RNS) (34), and increased expression of histonedeacetylase (HDAC) (35). The protective mechanisms of CMC2.24 demonstrated in the current study are its ability to reduce inflammatory cell infiltration at the site of lung infection and to prevent lung tissue apoptosis, as well as decreased activity of the pro-inflammatory signaling pathways NF-kB p65 and p-Ikb in lung tissue after CMC2.24 treatment. These results are consistent with the previous observations regarding curcumin's effects in the regulation of inflammation (12, 13, 17, 34).

The data from our noninfectious model demonstrated that hTG SP-B-C mice were more susceptible to noninfectious injury compared with SP-B-T mice, and CMC2.24 decreased lung injury and inflammatory cell infiltration in the lung of noninfectious model. By comparisons of the data from bacterial infection and noninfectious models in this study, one possible mechanism of CMC2.24 effects may alter the host inflammatory response, but do not for host–bacterial interaction.

MMPs, a group of complex zinc-containing neutral proteolytic enzymes, are essential for the degradation and turnover of the extracellular matrix (ECM). In particular, inducible MMPs are activated by pulmonary infection, accelerating connective tissue degradation and exacerbating lung (36). MMP-2 is secreted from macrophages as a 72-kDa pro-form that is cleaved into a 64-kDa active form; the corresponding pro- and active forms of MMP-9 have masses of 92 kDa and 83 kDa, respectively. In the present study, the activity of MMP-2, -9, and -12 was induced in the BALF of infected mice and attenuated by CMC2.24 treatment. Collectively, these results indicate CMC2.24 may have therapeutic potential in bacterial pneumonia.

In summary, functional differences of human SP-B genetic variants, i.e., the SP-B C and T alleles were found in the bacterial pneumonia, SP-B-C mice showed increased susceptibility to S. aureus infection compared with SP-B-T mice. Differing dynamic loads of bacteria between SP-B-C and SP-B-T mice were also observed by the in vivo imaging method. CMC2.24 improves mortality and attenuates lung injury in this model of S. aureus pneumonia. But the limitation of the study is to focus on the comparison of two human SP-B genetic variants without the comparison to wild-type animals, which will warrant to be studied in the future.

Back to Top | Article Outline

Acknowledgments

The authors thank Dr Jennifer F. Moffat of the Department of Microbiology and Immunology, SUNY Upstate Medical University, Syracuse NY for kindly providing in vivo imaging system with use, Dr Jeffrey Whitsett of Cincinnati Children's Hospital Medical Center, Cincinnati OH for kindly providing SP-B (+/−) transgenic mice, and Dr Yongzheng Wu of the Institute of Pasteur, France for providing the bacterial strain Staphylococcus aureus-Xen 36. They also thank Dr Q. Meng and all members of Prof Gary Nieman's laboratory for their kind support of this project.

Back to Top | Article Outline

REFERENCES

1. Matthay MA, Zimmerman GA. Acute lung injury and the acute respiratory distress syndrome: four decades of inquiry into pathogenesis and rational management. Am J Respir Cell Mol Biol 2005; 33 4:319–327.
2. Otto M. Basis of virulence in community-associated methicillin-resistant Staphylococcus aureus. Annu Rev Microbiol 2010; 64:143–162.
3. Bai AD, Showler A, Burry L, Steinberg M, Ricciuto DR, Fernandes T, Chiu A, Raybardhan S, Science M, Fernando E, et al. Impact of infectious disease consultation on quality of care, mortality, and length of stay in staphylococcus aureus bacteremia: results from a large multicenter cohort study. Clin Infect Dis 2015; 60 10:1451–1461.
4. Whitsett JA, Weaver TE. Hydrophobic surfactant proteins in lung function and disease. N Engl J Med 2002; 347 26:2141–2148.
5. Yang L, Johansson J, Ridsdale R, Willander H, Fitzen M, Akinbi HT, Weaver TE. Surfactant protein B propeptide contains a saposin-like protein domain with antimicrobial activity at low pH. J Immunol 2010; 184 2:975–983.
6. Wang G, Christensen ND, Wigdahl B, Guttentag SH, Floros J. Differences in N-linked glycosylation between human surfactant protein-B variants of the C or T allele at the single-nucleotide polymorphism at position 1580: implications for disease. Biochem J 2003; 369 ((Pt 1)):179–184.
7. Gonzalez FJ, Yu AM. Cytochrome P450 and xenobiotic receptor humanized mice. Annu Rev Pharmacol Toxicol 2006; 46:41–64.
8. Shultz LD, Brehm MA, Bavari S, Greiner DL. Humanized mice as a preclinical tool for infectious disease and biomedical research. Ann N Y Acad Sci 2011; 1245:50–54.
9. Zhang L, Kovalev GI, Su L. HIV-1 infection and pathogenesis in a novel humanized mouse model. Blood 2007; 109 7:2978–2981.
10. Wang G, Guo X, Diangelo S, Thomas NJ, Floros J. Humanized SFTPA1 and SFTPA2 transgenic mice reveal functional divergence of SP-A1 and SP-A2: formation of tubular myelin in vivo requires both gene products. J Biol Chem 2010; 285 16:11998–12010.
11. Guo Y, Ramos RI, Cho JS, Donegan NP, Cheung AL, Miller LS. In vivo bioluminescence imaging to evaluate systemic and topical antibiotics against community-acquired methicillin-resistant Staphylococcus aureus-infected skin wounds in mice. Antimicrob Agents Chemother 2013; 57 2:855–863.
12. Jobin C, Bradham CA, Russo MP, Juma B, Narula AS, Brenner DA, Sartor RB. Curcumin blocks cytokine-mediated NF-kappa B activation and proinflammatory gene expression by inhibiting inhibitory factor I-kappa B kinase activity. J Immunol 1999; 163 6:3474–3483.
13. Xiao X, Yang M, Sun D, Sun S. Curcumin protects against sepsis-induced acute lung injury in rats. J Surg Res 2012; 176 1:e31–e39.
14. Zhang Y, Gu Y, Lee HM, Hambardjieva E, Vrankova K, Golub LM, Johnson F. Design, synthesis and biological activity of new polyenolic inhibitors of matrix metalloproteinases: a focus on chemically-modified curcumins. Curr Med Chem 2012; 19 25:4348–4358.
15. Elburki MS, Rossa C, Guimaraes MR, Goodenough M, Lee HM, Curylofo FA, Zhang Y, Johnson F, Golub LM. A novel chemically modified curcumin reduces severity of experimental periodontal disease in rats: initial observations. Mediators Inflamm 2014; 2014:959471.
16. Ge L, Liu X, Chen R, Xu Y, Zuo YY, Cooney RN, Wang G. Differential susceptibility of transgenic mice expressing human surfactant protein B genetic variants to Pseudomonas aeruginosa induced pneumonia. Biochem Biophys Res Commun 2016; 469:171–175.
17. Balasubramanyam M, Koteswari AA, Kumar RS, Monickaraj SF, Maheswari JU, Mohan V. Curcumin-induced inhibition of cellular reactive oxygen species generation: novel therapeutic implications. J Biosci 2003; 28 6:715–721.
18. Farnsworth CW, Shehatou CT, Maynard R, Nishitani K, Kates SL, Zuscik MJ, Schwarz EM, Daiss JL, Mooney RA. A humoral immune defect distinguishes the response to Staphylococcus aureus infections in mice with obesity and type 2 diabetes from that in mice with type 1 diabetes. Infect Immun 2015; 83 6:2264–2274.
19. Rowe J, Greenblatt RJ, Liu D, Moffat JF. Compounds that target host cell proteins prevent varicella-zoster virus replication in culture, ex vivo, and in SCID-Hu mice. Antiviral Res 2010; 86 3:276–285.
20. Matute-Bello G, Downey G, Moore BB, Groshong SD, Matthay MA, Slutsky AS, Kuebler WM. An official American Thoracic Society workshop report: features and measurements of experimental acute lung injury in animals. Am J Respir Cell Mol Biol 2011; 44 5:725–738.
21. Liu J, Abdel-Razek O, Liu Z, Hu F, Zhou Q, Cooney RN, Wang G. Role of surfactant proteins A and D in sepsis-induced acute kidney injury. Shock 2015; 43 1:31–38.
22. Quasney MW, Waterer GW, Dahmer MK, Kron GK, Zhang Q, Kessler LA, Wunderink RG. Association between surfactant protein B + 1580 polymorphism and the risk of respiratory failure in adults with community-acquired pneumonia. Crit Care Med 2004; 32 5:1115–1119.
23. Simonato M, Baritussio A, Ori C, Vedovelli L, Rossi S, Dalla Massara L, Rizzi S, Carnielli VP, Cogo PE. Disaturated-phosphatidylcholine and surfactant protein-B turnover in human acute lung injury and in control patients. Respir Res 2011; 12:36.
24. Schmidt R, Markart P, Ruppert C, Wygrecka M, Kuchenbuch T, Walmrath D, Seeger W, Guenther A. Time-dependent changes in pulmonary surfactant function and composition in acute respiratory distress syndrome due to pneumonia or aspiration. Respir Res 2007; 8:55.
25. Clark JC, Wert SE, Bachurski CJ, Stahlman MT, Stripp BR, Weaver TE, Whitsett JA. Targeted disruption of the surfactant protein B gene disrupts surfactant homeostasis, causing respiratory failure in newborn mice. Proc Natl Acad Sci U S A 1995; 92 17:7794–7798.
26. Melton KR, Nesslein LL, Ikegami M, Tichelaar JW, Clark JC, Whitsett JA, Weaver TE. SP-B deficiency causes respiratory failure in adult mice. Am J Physiol Lung Cell Mol Physiol 2003; 285 3:L543–L549.
27. Lin Z, deMello DE, Wallot M, Floros J. An SP-B gene mutation responsible for SP-B deficiency in fatal congenital alveolar proteinosis: evidence for a mutation hotspot in exon 4. Mol Genet Metab 1998; 64 1:25–35.
28. Hamvas A, Cole FS, Nogee LM. Genetic disorders of surfactant proteins. Neonatology 2007; 91 4:311–317.
29. Lin Z, Pearson C, Chinchilli V, Pietschmann SM, Luo J, Pison U, Floros J. Polymorphisms of human SP-A, SP-B, and SP-D genes: association of SP-B Thr131Ile with ARDS. Clin Genet 2000; 58 3:181–191.
30. Dahmer MK, O’Cain P, Patwari PP, Simpson P, Li SH, Halligan N, Quasney MW. The influence of genetic variation in surfactant protein B on severe lung injury in African American children. Crit Care Med 2011; 39 5:1138–1144.
31. Hamvas A, Heins HB, Guttentag SH, Wegner DJ, Trusgnich MA, Bennet KW, Yang P, Carlson CS, An P, Cole FS. Developmental and genetic regulation of human surfactant protein B in vivo. Neonatology 2009; 95 2:117–124.
32. Sumita Y, Sugiura T, Kawaguchi Y, Baba S, Soejima M, Murakawa Y, Hara M, Kamatani N. Genetic polymorphisms in the surfactant proteins in systemic sclerosis in Japanese: T/T genotype at 1580 C/T (Thr131Ile) in the SP-B gene reduces the risk of interstitial lung disease. Rheumatology (Oxford) 2008; 47 3:289–291.
33. Guttentag S. Posttranslational regulation of surfactant protein B expression. Semin Perinatol 2008; 32 5:367–370.
34. Biswas SK, McClure D, Jimenez LA, Megson IL, Rahman I. Curcumin induces glutathione biosynthesis and inhibits NF-kappaB activation and interleukin-8 release in alveolar epithelial cells: mechanism of free radical scavenging activity. Antioxid Redox Signal 2005; 7 (1–2):32–41.
35. Balasubramanyam K, Varier RA, Altaf M, Swaminathan V, Siddappa NB, Ranga U, Kundu TK. Curcumin, a novel p300/CREB-binding protein-specific inhibitor of acetyltransferase, represses the acetylation of histone/nonhistone proteins and histone acetyltransferase-dependent chromatin transcription. J Biol Chem 2004; 279 49:51163–51171.
36. Aschner Y, Zemans RL, Yamashita CM, Downey GP. Matrix metalloproteinases and protein tyrosine kinases: potential novel targets in acute lung injury and ARDS. Chest 2014; 146 4:1081–1091.
Keywords:

Allele; chemically modified curcumin; pneumonia; Staphylococcus aureus; surfactant protein B

© 2016 by the Shock Society