miR-194 Promotes Burn-Induced Hyperglycemia via Attenuating IGF-IR Expression : Shock

Secondary Logo

Journal Logo

Basic Science Aspects

miR-194 Promotes Burn-Induced Hyperglycemia via Attenuating IGF-IR Expression

Yu, Yonghui; Chai, Jiake; Zhang, Haijun; Chu, Wanli; Liu, Lingying; Ma, Li; Duan, Hongjie; Li, Bailing; Li, Dawei

Author Information
Shock 42(6):p 578-584, December 2014. | DOI: 10.1097/SHK.0000000000000258

Abstract

Erratum

In the article beginning on page 578 of the December 2014 issue, a grant acknowledgment contained an error in the grant number. The grant information should appear as follows:

This work was supported by the National Science Foundation of China (grant no. NSFC81120108014 to J.C.), by the National Science Foundation of China (grant no. NSFC81471873), by the Beijing Natural Science Foundation (grant no. 7144250), and by the China Postdoctoral Science Foundation (grant no. 2013M532200 to Y.Y.).

The authors regret the error.

Shock. 43(4):425, April 2015.

INTRODUCTION

Burn injury is a complex trauma that could be caused by heat, electricity, chemicals, radiation, and so on (1). Patients with burn injury may have a wide range of clinical manifestations, including hyperglycemia, skeletal muscle wasting, inflammatory reaction. Inflammation is one of the host responses to burn. After burn injury, the inflammatory mediators such as interleukin-2 and interleukin-6 (2) and tumor necrosis factor-α (3) are increased. Burn-induced mitochondrial dysfunction results in promoting skeletal muscle wasting, which further decelerates wound healing and enhances the risk of infection (4). However, with the deepening of research, hyperglycemia has been considered as the pivotal clinical characteristic of burn patients, which is an important factor closely associated with mortality (5). A clinical study shows that topical insulin injection can accelerate wound healing in diabetes through activating Akt and Erk signal pathways (6). In addition, the latest report indicates that miRNA expression is affected after burn injury, about 66 miRNAs are significantly altered in denatured dermis of burn patients compared with that in normal skin (7), which provides us a novel insight in the therapy of hyperglycemia for patients with burn injury.

miRNA, a small noncoding RNA consisting of 19 to 23 nucleotides, is first characterized in 1993 from Caenorhabditis elegans (8). Now there are more than 1,000 miRNAs found in humans, which might regulate about 60% of mammalian gene expression (9). The main function of miRNA focuses on regulating gene expression at the translational level. It can bind to the 3′-UTR of target mRNA and suppress its translation (8). Recent studies indicate that miRNA plays an essential role in regulating glucose metabolism. In a mouse model of obesity, miR-143 and miR-802 impair glucose metabolism through inactivating Akt or hepatocyte nuclear factor 1b function (10, 11). Overexpressed miR-29a-c or miR-33b decreases blood glucose concentration through inhibiting hepatic gluconeogenesis (12, 13). miR-223 and miR-195-5p are also involved in regulating glucose uptake via mediating glucose transporter protein expression (14, 15). miR-133 can directly bind to the 3′-UTR of IGF-IR mRNA and inhibit its translation, overexpression of miR-133 results in impairing IGF-IR expression and Akt activation (16), and miR-133 deficiency enhances insulin sensitivity and glucose tolerance (17).

Insulin-like growth factor 1 receptor, one of the tyrosine kinase transmembrane receptors, has a similar structure and highly homologous to insulin receptor (18). It can transfer biological signal via binding with hormones IGF-1, IGF-2, or insulin. Activated IGF-IR can bind with phosphatidylinositol 3-kinase (PI3K) regulatory subunit p85 and enhance the function of catalytic subunit p110 (19). Activation of PI3K is essential for glucose metabolism; impaired PI3K/Akt activation is responsible for glucose metabolic disorders (20). Insulin-like growth factor 1 receptor is usually used as an anticancer target, and the use of an inhibitor or antibodies against IGF-IR has been proven to be able to repress IGF-IR function. However, one of the common adverse effects of this therapy is hyperglycemia (21). VHL-depleted mice developed severe hypoglycemia in an IGF-IR–dependent manner, whereas using an antagonist of IGF-IR reversed the hypoglycemic process and sustained a euglycemic state (22). These researches imply that the IGF-IR/Akt signaling pathway might play an essential role in regulating glucose metabolism.

Our current study demonstrated the marked increase in miR-194 expression as well as the dramatic impairment in IGF-IR/Akt signaling pathway in the skeletal muscle of burn rats in comparison with those in sham rats. Further study found that miR-194 was a potential regulator of IGF-IR expression, and overexpression of miR-194 attenuated the IGF-IR/Akt activation and subsequently induced hyperglycemia. Collectively, miR-194 promoted burn-induced hyperglycemia via suppressing IGF-IR expression.

MATERIALS AND METHODS

Animals

All studies adhered to procedures consistent with the International Guiding Principles for Biomedical Research Involving Animals issued by the Council for the International Organizations of Medical Sciences and were approved by the Animal Care and Use Committee of the First Affiliated Hospital to PLA General Hospital. Six-week-old male Wistar rats (180 – 220 g), which were bought from Peking University Laboratory Animal Center, were housed in single cage, at room temperature (22°C to 24°C) with 12-h day/night cycles, and were anesthetized by intraperitoneal injection of 300 mg/kg body weight Avertin (20 mg/mL; 2,2,2-tribromoethanol; Sigma, USA). At the end of the experiment, all rats were killed with an overdose of 10% chloral hydrate.

Animal model

Thirty-six rats were randomly divided into sham and burn groups (18 rats in each group). After being anesthetized, 30% total body surface area (TBSA) and full-thickness burn model was conducted as previously described (23). The dorsal hair of all rats was shaved. Then the back skin of rats in the burn group was placed in hot water (94°C) for 12 s. An immediate injection of balanced salt solution (40 mL/kg body weight) was administered to prevent shock. Then back wounds were treated with 1% tincture of iodine and kept dry. The same skin area of the rats in the sham group was placed in water at 37°C (23), and the other processes were the same as those applied in the burn rats.

Another 30 rats were anesthetized and randomly divided into miR-194 (20 rats) or vehicle control (10 rats) groups and then were injected through the tail veil with 0.5 mL miR-194 plasmid (250 μg/kg body weight) or vehicle control (250 μg/kg body weight), respectively.

Fasting blood glucose test

Indicated periods after burn injury or injection, all the rats were fasting solids and liquids for 12 h. Blood from the tail vein was collected for fasting blood glucose test using a digital glucometer (ACCU-CHEK Active, Roche, Germany) following the manufacturer’s instruction.

Sample collection

After modeling for 1 day, 3 days, or 7 days, blood and anterior tibial muscle and liver of six rats in each group were collected. Blood was obtained from aorta ventralis using a 10-mL syringe. After centrifugation at 1,000 rpm for 15 min, the serum was collected. Serum and tissue samples were frozen at −80°C refrigerator.

Plasmids and antibodies

Mature rat miR-194 (TGTAACAGCAACTCCATGTGGA) was cloned into pcDNA6.2-GW/EmGFP-miR (GenePharma Co., Ltd., Shanghai, China) using BLOCK-iT Pol II miR RNAi Expression Vector Kit (Life Technologies, Grand Island, NY). A small-interfering RNA specific to rat IGF-IR (siIGF-IR) (sense: 5′-CCUGUGAAAGUGAUGUUCUCCGUUU-3′, antisense: 5′-AAACGGAGAACAUCACUUUCACAGG-3′) and nonsense (sense: 5′-UUCUCCGAACGUGUCACGUTT-3′, antisense: 5′-ACGUGACACGUUCGGAGAATT-3′) were synthesized (GenePharma Co., Ltd., Shanghai, China). Antibodies against IGF-IR (no. 9750), insulin receptor β (no. 3025), Akt (no. 4685), p-Akt S473 (no. 4060), glycogen synthase kinase 3β (GSK3β) (no. 12456), p-GSK3β (no. 5558), and GAPDH (no. 5174) were purchased from Cell Signaling Technology (Beverly, Mass).

Cell culture and transfection

Rat myoblast L6 cells were cultured in Dulbecco modified Eagle medium containing 10% fetal bovine serum, 1% penicillin/streptomycin, and 2 mM l-glutamine (Life Technologies) in 37°C incubator with 5% CO2. Cells were seeded into 6-well plates; after 80% cell confluence, miR-194 plasmid and vehicle control (pcDNA6.2-GW/EmGFP-miR) or siIGF-IR and nonsense plasmid were transiently transfected into L6 cells by lipofectamine 2000 (Life Technologies) following the manufacturer’s instructions. The transfectants were collected for further analysis at indicated times.

Cell fluorescence

Myoblast L6 cells transfected with miR-194 or vehicle control were cultured for 48 h, then green fluorescence was observed and images were taken by inverted fluorescence microscope (Leica, Germany).

miRNA array

Anterior tibial muscle from sham and burn rats was used for miRNA array by KangChen Bio-tech (Shanghai, China). Total RNA was harvested using TRIzol (Invitrogen, Grand Island, NY) and miRNeasy mini kit (QIAGEN, Valencia, Calif) according to the manufacturer’s instructions. After having RNA quantity measured using the NanoDrop 1000, the samples were labeled using the miRCURY Hy3/Hy5 Power labeling kit and hybridized on the miRCURY LNA Array (version 18.0). The slides were scanned using the Axon GenePix 4000B microarray scanner (Axon Instruments, Foster City, Calif).

Real-time PCR for miRNA

Samples of anterior tibial muscle from sham and burn rats or rats injected with miR-194 and vehicle control, L6 cells treated by 10% serum from sham or burn rats, and L6 cells transfected with miR-194, vehicle control, siIGF-IR, or nonsense were subjected to real-time PCR assay. Total RNA was extracted using TRIzol reagent (Invitrogen), and miRNeasy mini kit (QIAGEN) was used for first-strand cDNA synthesis. Analysis of miR-194 expression was done using miScript SYBR Green PCR system (QIAGEN) by 7900HT Fast Real-time PCR system (Applied Biosystems, Foster City, Calif). The primers used for amplification were miR-194 (forward: 5′-GGGGGTGTAACAGCAACTCC-3′; reverse: 5′-GTGCGTGTCGTGGAGTCG -3′) and U6 (forward: 5′-GCTTCGGCAGCACATATACTAAAAT-3′; reverse: 5′-CGCTTCACGAATTTGCGTGTCAT-3′). The initial activation was performed at 95°C for 15 min, followed by 40 cycles (denaturation at 95°C for 15 s, annealing at 55°C for 30 s and extension at 70°C for 30 s).

Real-time PCR for IGF-IR

Total RNA was extracted from samples of the anterior tibial muscle from sham and burn rats or rats injected with miR-194 or vehicle control and L6 cells transfected with miR-194, vehicle control, siIGF-IR, or nonsense. First-strand cDNA was synthesized with oligdT(20) primer by SuperScript III First-Strand Synthesis system (Invitrogen). The primers (Sangon Biotech Co., Ltd., Shanghai, China) used in this study were IGF-IR (forward: 5′-ATCAGGCTTCATCCGCAACA-3′, reverse: 5′-AATGTTATTGCCTCGCCGGA-3′) and GAPDH (forward: 5′-ATGGAGAAGGCGGGGCC-3′, reverse: 5′-CCTTCCACGATGCCAAAGTT-3′). The data were analyzed using 2-△△T method.

Western blot

Protein was extracted from tissues or cell samples using RIPA buffer (MACGENE Biotech, Beijing, China), and the concentration was detected with BCA Protein Assay Kit (Pierce, Rockford, Ill) following the manufacturer’s instructions. Approximately 30 to 60 μg extracted protein was subjected to SDS-PAGE gel, and Western blotting was carried out as described in our previous publication (23).

Frozen-section analysis

Anterior tibial muscle and liver from rats injected with miR-194 or vehicle control were collected and immediately embedded into optimum cutting temperature compound in a suitable tissue mold. The optimum cutting temperature containing the tissue was frozen using the specialized metal grids that fit onto the cryostat. About 5-μm-thick section was cut in cryostat at -20°C. Section was transferred into microscope slide through directly touching the section to slide. Green fluorescence was observed, and images were obtained using the inverted fluorescent microscope (Leica, Germany).

Statistical method

The Student t test was used for determining the significant difference, and the differences were considered to be significant at a P ≤ 0.05.

RESULTS

miR-194 was increased in the skeletal muscle of burn rats

Hyperglycemia closely associated with mortality was one of the common clinical features of severe burn patients. So we established a 30% TBSA rat model, and the fasting blood glucose of sham and burn rats was measured at indicated times. As shown in Figure 1A, after burn injury for 1, 2, 3, or 7 days, the fasting blood glucose was significantly increased in burn rats in comparison with that in sham rats. Previous reports showed that skeletal muscle was an essential organ for glucose metabolism, and this function was repressed after burn injury (24). Moreover, miRNA had been considered to play an important role in regulating glucose metabolism. Therefore, the anterior tibial muscle of the rat model at day 3 was collected for miRNA assay. The results indicated that miR-194 was upregulated in burn rats compared with that in sham rats (Fig. 1B), and further real-time PCR also verified that the miR-194 expression in the anterior tibial muscle of burn rats was about 1.5 times higher than that in sham rats (Fig. 1C), suggesting that miR-194 might be a potential mediator of burn-induced hyperglycemia in skeletal muscle.

F1-13
Fig. 1:
Burn injury induced an increase of fasting blood glucose and miR-194 expression. The rat model of 30% TBSA was established as described in Materials and Methods. After fasting solids and liquids for 12 h, the blood glucose was detected in sham or burn rats in indicated periods (A). Anterior tibial muscle of sham and burn rats was collected at day 3 after injury, and miRNA array was done using miRCURY LNA Array (version 18.0) system (B). Green means low expression and red indicates a high expression level. Real-time PCR was used to confirm the expression of miR-194 in the anterior tibial muscle of sham and burn rats (C). The asterisk (*) indicates a significant increase (P < 0.05).

IGF-IR expression was restricted in anterior tibial muscle of burn rats

Insulin, as the key hormone for glucose homeostasis, can bind with IR or IGF-IR and activate PI3K/Akt signal pathway, which is the pivotal mediator of glucose metabolism (25). Thus, Western blot was used to detect the expression of IR and IGF-IR in the anterior tibial muscle of sham and burn rats at day 3. The IR β subunit expression was comparable in sham and burn rats; however, the IGF-IR protein level was significantly attenuated in burn rats than that in sham rats (Fig. 2A). Quantitative analysis of IGF-IR expression indicated that the expression of IGF-IR in burn rats was only 70% of that in sham rats (Fig. 2B). Phosphorylated Akt and GSK3β were detected for indicating PI3K/Akt signal pathway activation. As shown in Figure 2A, the phosphorylated levels of Akt at Ser473 and GSK3β at Ser9 were decreased in burn rats. Glycogen synthase kinase 3β functioned as the negative regulator of glycogen synthesis through phosphorylating and inactivating glycogen synthase; GSK3β phosphorylation at Ser9 lost the capacity of phosphorylating GS and enhancing glycogen synthesis (26). The result revealed that burn injury impaired the phosphorylation level of GSK3β at Ser9, which might be responsible for inhibiting the glycogen synthesis activity of skeletal muscle and resulting in hyperglycemia.

F2-13
Fig. 2:
Burn injury impaired IGF-IR protein expression. Protein was extracted from the anterior tibial muscle of sham (n = 6) or burn rats (n = 6) at day 3 after injury, and the essential proteins for glucose homeostasis were detected using Western blot assay. Receptors of insulin or IGF-1 involved in regulating glucose metabolism were analyzed, respectively (A). Their downstream proteins, Akt, phosphor-Akt at Ser473, GSK3β, and phosphor-GSK3β at Ser9 were also detected (A). Quantitative analysis of IGF-IR protein expression in sham and burn rats was done, and GAPDH was used as loading control (B). The asterisk (*) indicates a significant increase (P < 0.05).

miR-194 might repress IGF-IR expression via targeting IGF-IR mRNA 3′-UTR

To further uncover the mechanism of burn-induced downregulation of IGF-IR protein expression, we first determined the mRNA level of IGF-IR in skeletal tissues of sham and burn rats using real-time PCR. And the result showed that, although the protein level of IGF-IR was significantly repressed in burn rats, the IGF-IR mRNA level was comparable between sham and burn rats (Fig. 3A), implying that posttranscriptional regulation might result in the depletion of IGF-IR protein in burn rats. Because miRNA was the critical regulator of inhibiting target mRNA translation (8) and results of the miRNA array indicated that miR-194 was increased in burn rats, TargetScan software was used to analyze whether IGF-IR mRNA was the potential target of miR-194. As shown in Figure 3B, miR-194 had perfect binding sites with IGF-IR mRNA 3′-UTR, which suggested that upregulated miR-194 in anterior tibial muscle of burn rats might suppress IGF-IR protein translation via directly binding to IGF-IR mRNA 3′-UTR sequence.

F3-13
Fig. 3:
The potential mechanism of burn-induced suppression of IGF-IR protein expression. Total RNA was extracted from the anterior tibial muscle of sham and burn rats, respectively. And first-strand cDNA was synthesized using oligdT(20) primer by SuperScript III First-Strand Synthesis system. Real-time PCR was performed to detect the IGF-IR mRNA level in sham and burn rats (A). To determine the potential effect of miR-194 on regulating IGF-IR protein expression, TargetScan software was used to analyze the binding site of miR-194 in 3′-UTR of IGF-IR mRNA (B).

Overexpression of miR-194 in L6 cells inhibited IGF-IR expression

To further clarify the relationship of miR-194 and IGF-IR protein expression, the plasmid pcDNA6.2-GW/EmGFP-miR-194 (miR-194) and its parental vehicle control pcDNA6.2-GW/EmGFP (vehicle) were constructed. And the plasmids were used to transfect rat skeletal muscle L6 cells. After 48 h of transfection, the fluorescence was observed, and images were taken using the inverted fluorescence microscope. The results indicated that miR-194 or vehicle control was successfully transfected into L6 cells (Fig. 4A). Real-time PCR was used to further identify the expression of miR-194 in transfected L6 cells, and the results showed that miR-194 expression level in L6 cells transfected with miR-194 plasmid was about 350 times than that in L6 cells transfected with vehicle control (Fig. 4B). The IGF-IR mRNA level in L6 cells transfected with miR-194 or vehicle control was also compared. As shown in Figure 4C, the mRNA level of IGF-IR in L6 cells transfected with miR-194 was slightly increased in comparison with that in L6 cells transfected with vehicle control, and there was no significant difference. So miR-194 overexpression had no effect on IGF-IR mRNA expression. The protein level of IGF-IR in L6 transfectants was also detected using Western blot assay. The results demonstrated that IGF-IR expression was attenuated after miR-194 transfection (Fig. 4D), and the phosphorylations of Akt at Ser473 and GSK3β at Ser9 were also downregulated in L6 cells transfected with miR-194 compared with those in L6 cells transfected with vehicle control (Fig. 4D). So overexpressed miR-194 could inhibit IGF-IR protein expression and subsequently inactivate PI3K/Akt signal pathway, which was involved in regulating glucose homeostasis.

F4-13
Fig. 4:
IGF-IR expression in L6 cells transfected with miR-194. miR-194 plasmid was constructed through inserting the matured miR-194 sequence into pcDNA6.2-GW/EmGFP. And L6 cells were transfected with vehicle control or miR-194 using lipofectamine 2000. After 48-h transfection, the fluorescence was observed under the inverted fluorescence microscope (A). Total RNA was extracted and first-strand cDNA was synthesized, and then real-time PCR was performed to analyze the expression of miR-194 (B) and IGF-IR mRNA (C) level in L6 cell transfectants, respectively. Protein extracted from L6 cell transfectants was used to detect the expression of IGF-IR, IR, Akt, phosphor-Akt at Ser473, GSK3β, and phosphor-GSK3β at Ser9 (D). All the experiments were repeated at least three times. The asterisk (*) indicates a significant increase (P < 0.05).

Exposure to burn serum or siIGF-IR impaired PI3K/Akt signal pathway via downregulating IGF-IR expression

Burn patients have complicated microenvironment in vivo, and cells exposed to burn serum are usually used to mimic the microenvironment for mechanism research (27). In this study, serum from burn and sham rats at day 3 was collected and used to treat L6 cells. After 48-h treatment, miR-194 and IGF-IR mRNA level were analyzed using real-time PCR assay. As shown in Figure 5A, miR-194 expression in L6 cells exposed to burn serum was increased compared with that in L6 cells treated with sham serum; however, IGF-IR mRNA level was still comparable in L6 cells after burn or sham serum treatment, although it was slightly increased in burn serum–treated L6 cells (Fig. 5B). And the slight increase of IGF-IR mRNA level after burn serum exposure might be a negative feedback for enhancing miR-194 expression. Further study for protein expression showed that burn serum treatment inhibited IGF-IR protein expression (Fig. 5C), and phosphorylated Akt at Ser473 and GSK3β at Ser9 were impaired in L6 cells exposed to burn serum (Fig. 5C). So burn serum exposure could promote miR-194 expression, which was responsible for attenuating IGF-IR protein expression and inactivating the PI3K/Akt signal pathway. Oligonucleotides specific to knockdown IGF-IR were used to transfect to L6 cells. In comparison with L6 cells transfected with nonsense, the IGF-IR mRNA and protein level were significantly decreased in L6 cells transfected with siIGF-IR (Fig. 5, D and E). And phosphorylations of Akt Ser473 and GSK3β Ser9 were subsequently downregulated (Fig. 5E). It suggested that overexpressed miR-194 or knockdown of IGF-IR expression resulted in impairing the PI3K/Akt signal pathway, which might attenuate the capacity of glucose metabolism.

F5-13
Fig. 5:
L6 cells were treated with burn serum or siIGF-IR. Serum from sham or burn rats after 3 days from injury was collected. Oligonucleotides of nonsense or siIGF-IR were synthesized. After 48-h treatment by sham or burn serum (10%), L6 cells were collected and total RNA was extracted, then first-strand cDNA was synthesized and real-time PCR was done to detect the expression of miR-194 (A) or IGF-IR mRNA level (B). After treatment with 10% sham or burn serum for 48 h, cell samples were used to analyze the protein level of IGF-IR, IR, Akt, phosphor-Akt at Ser473, GSK3β, and phosphor-GSK3β at Ser9 (C). After transfection with nonsense or siIGF-IR for 48 h, IGF-IR mRNA level was measured using real-time PCR assay (D), and the protein level of IGF-IR, IR, Akt, phosphor-Akt at Ser473, GSK3β, and phosphor-GSK3β at Ser9 was also detected (E). All the experiments were repeated at least three times. The asterisk (*) indicates a significant increase (P < 0.05).

Overexpressed miR-194 elevated rat fasting blood glucose in vivo

To further clarify the function of miR-194 in regulating fasting blood glucose, miR-194 plasmid or vehicle control was injected into rats through the tail vein. Three or 7 days after injection, the fasting blood glucose was measured, and samples of anterior tibial muscle and liver were collected. Three days after injection, tissue samples from normal or vehicle control– or miR-194–injected rats were used for frozen-section analysis, and fluorescence was observed under the inverted fluorescence microscope. No fluorescence was observed in tissues from normal rats, and obvious fluorescence was observed in tissues from rats injected with vehicle control or miR-194 (Fig. 6A). It indicated that plasmids were successfully injected and expressed in the anterior tibial muscle and liver. In vivo plasmid intake after tail vein injection was nonspecific; they could be detected both in the anterior tibial muscle (Fig. 6A, upper panel) and the liver (Fig. 6A, low panel). Real-time PCR assay also indicated that the expression of miR-194 in the anterior tibial muscle from rats injected miR-194 was about five times than that in rats injected vehicle control (Fig. 6B). Three or 7 days after injection, the fasting blood glucose in rats injected miR-194 was significantly increased than that in rats injected vehicle control (Fig. 6C). Western blot assay also demonstrated that in vivo miR-194 overexpression inhibited IGF-IR expression and impaired the activation of the PI3K/Akt signal pathway (Fig. 6D). It meant that overexpressed miR-194 was responsible for hyperglycemia via suppressing IGF-IR expression and impairing the PI3K/Akt signal pathway.

F6-13
Fig. 6:
Vehicle control or miR-194 plasmid was injected into rats. As described in Materials and Methods, vehicle control or miR-194 was injected into rats via the tail vein. Three days after injection, the samples of anterior tibial muscle and liver from normal rats (n = 3) or rats injected with vehicle control (n = 6) or miR-194 (n = 6) were collected and frozen-section analysis was done, the fluorescence was observed and images were taken using an inverted fluorescence microscope (A). Fasting blood glucose was detected at the indicated periods (B). Three days after injection, miR-194 expression in the anterior tibial muscle of rats injected with vehicle control or miR-194 was analyzed using real-time PCR (C). And the protein level of IGF-IR, Akt, phosphor-Akt at Ser473, GSK3β, and phosphor-GSK3β at Ser9 in the anterior tibial muscle of rats injected with vehicle control or miR-194 was also detected, respectively (D). The asterisk (*) indicates a significant increase (P < 0.05).

DISCUSSION

Hyperglycemia is a common clinical feature in patients with diabetes, obesity, or burn injury. Burn-induced hyperglycemia has been shown as the critical factor of mortality (5, 28) because of its effects on suppression of wound healing of burn patients via promoting inflammation and muscle protein catabolism (29, 30). Insulin and IGF-I are important hormones to regulate glucose metabolism through binding with insulin receptor and IGF-IR. Liver-specific IGF-1 gene–depleted mice are more sensitive to streptozotocin-induced diabetes (31). Insulin-like growth factor 1 also can enhance GLUT1-mediated glucose transportation (32). Reduced IGF-1 level in burn patients has been observed, and recombinant IGF-1 treatment alleviates burn-induced hypermetabolic response and improves wound healing (33). The PI3K/Akt signal pathway has been proven as an essential downstream mediator for regulating glucose transport and glycogen synthesis (20, 25). Our results demonstrated that IGF-IR protein level and phosphorylated Akt at Ser473 and GSK3β at Ser9 were significantly decreased in burn rats compared with those in sham rats, which suggested that burn-induced hyperglycemia was correlated with impaired IGF-IR/PI3K-Akt signal pathway.

The GSK3β is a direct regulator of glucose metabolism through phosphorylating and inactivating GS, whereas phosphorylated GSK3β at Ser9 inhibits this function and enhances glycogen synthesis (26). Glycogen synthase kinase 3β also plays an important role in regulating glucose uptake via influencing GLUT expression (34). A study indicates that repression of PI3K or GSK3β activation using a specific inhibitor significantly attenuates glucose transportation (20). Therefore, PI3K and GSK3β were critical factors for glucose metabolism.

Previous reports have demonstrated that miRNAs are involved in regulating obesity-induced hyperglycemia (35). miR-93 is a mediator of glucose uptake through directly targeting with 3′-UTR of GLUT1 or GLUT4 (15). miR-195-5p functions as the inhibitor of GLUT3 expression and suppresses glucose transportation (14). Furthermore, miR-29a-c reduces fasting blood glucose through inhibition of hepatic gluconeogenesis (12). Both skeletal muscle and liver are important organs for glucose metabolism, and the PI3K/Akt-GSK3β signal pathway plays a pivotal role in glucose intake and glycogen synthesis (20, 25). Liver-specific IGF-I deficiency impaired the IGF-I/IGF-IR signal pathway and accelerated the disorder of glycometabolism (31). Overexpression of hepatic IGF-IR increased glucose uptake in hepatocytes (22). So IGF-I/IGF-IR plays pivotal role in regulating glucose metabolism of the liver. In this study, injected miR-194 could be detected in the anterior tibial muscle and liver tissues (Fig. 6A). And the results showed that the liver was more sensitive to miR-194 uptake; it implied that miR-194 might also attenuate hepatic IGF-IR expression and further impair glucose uptake and glycogen synthesis. The expression of miR-194 in the liver after burn injury should be measured in our subsequent study, and the overexpressed miR-194 in the liver might be another critical factor in mediating burn-induced hyperglycemia.

In conclusion, our research has demonstrated that burn injury induced miR-194 expression in the anterior tibial muscle, and overexpressed miR-194 suppressed IGF-IR expression and subsequently attenuated the activation of the PI3K/Akt signal pathway, the pivotal mediator of glucose uptake and glycogen synthesis. Our study provided a possible novel function of miR-194 in regulating burn-induced hyperglycemia and a potential target for clinical therapy of burn patients.

ACKNOWLEDGMENTS

The authors thank Yiduo Jin for technical assistance on frozen-section analysis.

REFERENCES

1. Evers LH, Bhavsar D, Mailander P: The biology of burn injury. Exp Dermatol 19 (9): 777–783, 2010.
2. Kowal-Vern A, Walenga JM, Hoppensteadt D, Sharp-Pucci M, Gamelli RL: Interleukin-2 and interleukin-6 in relation to burn wound size in the acute phase of thermal injury. J Am Coll Surg 178 (4): 357–362, 1994.
3. Duan H, Chai J, Sheng Z, Yao Y, Yin H, Liang L, Shen C, Lin J: Effect of burn injury on apoptosis and expression of apoptosis-related genes/proteins in skeletal muscles of rats. Apoptosis 14 (1): 52–65, 2009.
4. Schwacha MG, Nickel E, Daniel T: Burn injury-induced alterations in wound inflammation and healing are associated with suppressed hypoxia inducible factor-1alpha expression. Mol Med 14 (9–10): 628–633, 2008.
5. Gore DC, Chinkes D, Heggers J, Herndon DN, Wolf SE, Desai M: Association of hyperglycemia with increased mortality after severe burn injury. J Trauma 51 (3): 540–544, 2001.
6. Lima MH, Caricilli AM, de Abreu LL, Araujo EP, Pelegrinelli FF, Thirone AC, Tsukumo DM, Pessoa AF, dos Santos MF, de Moraes MA, et al.: Topical insulin accelerates wound healing in diabetes by enhancing the AKT and ERK pathways: a double-blind placebo-controlled clinical trial. PLoS One 7 (5): e36974, 2012.
7. Liang P, Lv C, Jiang B, Long X, Zhang P, Zhang M, Xie T, Huang X: MicroRNA profiling in denatured dermis of deep burn patients. Burns 38 (4): 534–540, 2012.
8. Lee RC, Feinbaum RL, Ambros V: The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75 (5): 843– 854, 1993.
9. Lewis BP, Burge CB, Bartel DP: Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 120 (1): 15–20, 2005.
10. Ono K: MicroRNA links obesity and impaired glucose metabolism. Cell Res 21 (6): 864–866, 2011.
11. Kornfeld JW, Baitzel C, Konner AC, Nicholls HT, Vogt MC, Herrmanns K, Scheja L, Haumaitre C, Wolf AM, Knippschild U, et al.: Obesity-induced overexpression of miR-802 impairs glucose metabolism through silencing of Hnf1b. Nature 494 (7435): 111–115, 2013.
12. Liang J, Liu C, Qiao A, Cui Y, Zhang H, Cui A, Zhang S, Yang Y, Xiao X, Chen Y, et al.: MicroRNA-29a-c decrease fasting blood glucose levels by negatively regulating hepatic gluconeogenesis. J Hepatol 58 (3): 535–542, 2012.
13. Ramirez CM, Goedeke L, Rotllan N, Yoon JH, Cirera-Salinas D, Mattison JA, Suarez Y, de Cabo R, Gorospe M, Fernandez-Hernando C: MicroRNA 33 regulates glucose metabolism. Mol Cell Biol 33 (15): 2891–2902, 2013.
14. Fei X, Qi M, Wu B, Song Y, Wang Y, Li T: MicroRNA-195-5p suppresses glucose uptake and proliferation of human bladder cancer T24 cells by regulating GLUT3 expression. FEBS Lett 586 (4): 392–397, 2012.
15. Lu H, Buchan RJ, Cook SA: MicroRNA-223 regulates Glut4 expression and cardiomyocyte glucose metabolism. Cardiovasc Res 86 (3): 410–420, 2010.
16. Huang MB, Xu H, Xie SJ, Zhou H, Qu LH: Insulin-like growth factor-1 receptor is regulated by microRNA-133 during skeletal myogenesis. PLoS One 6 (12): e29173, 2013.
17. Liu W, Bi P, Shan T, Yang X, Yin H, Wang YX, Liu N, Rudnicki MA, Kuang S: miR-133a regulates adipocyte browning in vivo. PLoS Genet 9 (7): e1003626, 2013.
18. Gallagher EJ, Fierz Y, Ferguson RD, LeRoith D: The pathway from diabetes and obesity to cancer, on the route to targeted therapy. Endocr Pract 16 (5): 864–873, 2010.
19. Dilly AK, Rajala RV: Insulin growth factor 1 receptor/PI3K/AKT survival pathway in outer segment membranes of rod photoreceptors. Invest Ophthalmol Vis Sci 49 (11): 4765–4773, 2008.
20. Smith GC, Ong WK, Rewcastle GW, Kendall JD, Han W, Shepherd PR: Effects of acutely inhibiting PI3K isoforms and mTOR on regulation of glucose metabolism in vivo. Biochem J 442 (1): 161–169, 2012.
21. Weroha SJ, Haluska P: IGF-1 receptor inhibitors in clinical trials—early lessons. J Mammary Gland Biol Neoplasia 13 (4): 471–483, 2008.
22. Kurabayashi A, Kakinuma Y, Morita T, Inoue K, Sato T, Furihata M: Conditional VHL gene deletion causes hypoglycemic death associated with disproportionately increased glucose uptake by hepatocytes through an upregulated IGF-I receptor. PLoS One 8 (7): e69139, 2013.
23. Liu L, Yu Y, Hou Y, Chai J, Duan H, Chu W, Zhang H, Hu Q, Du J: Human umbilical cord mesenchymal stem cells transplantation promotes cutaneous wound healing of severe burned rats. PLoS One 9 (2): e88348, 2014.
24. Padfield KE, Astrakas LG, Zhang Q, Gopalan S, Dai G, Mindrinos MN, Tompkins RG, Rahme LG, Tzika AA: Burn injury causes mitochondrial dysfunction in skeletal muscle. Proc Natl Acad Sci U S A 102 (15): 5368–5373, 2005.
25. Riley JK, Carayannopoulos MO, Wyman AH, Chi M, Moley KH: Phosphatidylinositol 3-kinase activity is critical for glucose metabolism and embryo survival in murine blastocysts. J Biol Chem 281 (9): 6010–6019, 2006.
26. Stambolic V, Woodgett JR: Mitogen inactivation of glycogen synthase kinase-3 beta in intact cells via serine 9 phosphorylation. Biochem J 303 (Pt 3): 701–704, 1994.
27. Liu LY, Hou YS, Chai JK, Hu Q, Duan HJ, Yu YH, Yin HN, Hao DF, Feng G, Li T, et al.: Basic fibroblast growth factor/vascular endothelial growth factor in the serum from severe burn patients stimulates the proliferation of cultured human umbilical cord mesenchymal stem cells via activation of Notch signaling pathways. J Trauma Acute Care Surg 75 (5): 789–797, 2013.
28. Mecott GA, Al-Mousawi AM, Gauglitz GG, Herndon DN, Jeschke MG: The role of hyperglycemia in burned patients: evidence-based studies. Shock 33 (1): 5–13, 2010.
29. Kulp GA, Tilton RG, Herndon DN, Jeschke MG: Hyperglycemia exacerbates burn-induced liver inflammation via noncanonical nuclear factor-kappaB pathway activation. Mol Med 18948–18956, 2012.
30. Gore DC, Chinkes DL, Hart DW, Wolf SE, Herndon DN, Sanford AP: Hyperglycemia exacerbates muscle protein catabolism in burn-injured patients. Crit Care Med 30 (11): 2438–2442, 2002.
31. Yu R, Yakar S, Liu YL, Lu Y, LeRoith D, Miao D, Liu JL: Liver-specific IGF-I gene deficient mice exhibit accelerated diabetes in response to streptozotocin, associated with early onset of insulin resistance. Mol Cell Endocrinol 204 (1–2): 31–42, 2003.
32. Fladeby C, Bjonness B, Serck-Hanssen G: GLUT1-mediated glucose transport and its regulation by IGF-I in cultured bovine chromaffin cells. J Cell Physiol 169 (2): 242–247, 1996.
33. Spies M, Nesic O, Barrow RE, Perez-Polo JR, Herndon DN: Liposomal IGF-1 gene transfer modulates pro- and anti-inflammatory cytokine mRNA expression in the burn wound. Gene Ther 8 (18): 1409–1415, 2001.
34. Buller CL, Loberg RD, Fan MH, Zhu Q, Park JL, Vesely E, Inoki K, Guan KL, Brosius FC 3rd: A GSK-3/TSC2/mTOR pathway regulates glucose uptake and GLUT1 glucose transporter expression. Am J Physiol Cell Physiol 295 (3): C836–C843, 2008.
35. Ono K: MicroRNA links obesity and impaired glucose metabolism. Cell Res 21 (6): 864–866, 2013.
Keywords:

miR-194; hyperglycemia; IGF-IR; Akt; burn injury

© 2014 by the Shock Society