Secondary Logo

Journal Logo

Basic Science Aspects

THE EFFECT OF HIGH-MOBILITY GROUP BOX 1 PROTEIN ON ACTIVITY OF REGULATORY T CELLS AFTER THERMAL INJURY IN RATS

Huang, Li-feng; Yao, Yong-ming; Zhang, Li-tian; Dong, Ning; Yu, Yan; Sheng, Zhi-yong

Author Information
doi: 10.1097/SHK.0b013e3181834070
  • Free

Abstract

INTRODUCTION

Accumulating evidence has demonstrated that regulatory T cells (Tregs) play important roles in the maintenance of immunologic self-tolerance and in down-regulation of various immune responses (1). Regulatory T cells have been shown to be important in regulating the immune responses in transplant rejection, tumor immunity, infectious diseases, and allergy. Thus, there has recently been an increasing interest in investigating the biology of Tregs and their potential application in treating immune diseases. Many types of Treg subsets have been reported in a variety of disease models. It is now clear that immune regulatory cells consist of many distinct T-cell subsets (2). Among them, CD4+ Tregs have been demonstrated in a wide range of animal models and in humans (3, 4), and the forkhead/winged helix transcription factor p3 (Foxp3) has been suggested to represent a reliable intracellular marker for naturally occurring Tregs (5). Most studies on CD4+ Tregs use a combination of CD25, cytotoxic T-lymphocyte-associated antigen 4 (CTLA-4), Foxp3, IL-10, and/or transforming growth factor β to define Treg populations (6).

Severe infections can result in the suppression of one or more functions of the host immune system. Multiple mechanisms have been proposed to explain infection-induced immunosuppression, including an imbalance in the cellular helper T-cell (TH1/TH2) or cytokine profile, induction of anergy, depletion of effector cells, and, most recently, the activation of CD4+CD25+Tregs (7). The role of both naturally occurring CD4+CD25+Tregs and IL-10-secreting Tregs in infection has been the subject of several excellent recent reviews (8, 9). However, it seems that its response to trauma, burns, hemorrhagic shock, and microbial infection is associated with only a transient proinflammatory period, followed by a more prolonged period of immune suppression (10). Thus, it is speculated that there are some other factors involved in this process.

High-mobility group box 1 protein (HMGB1) is a nonhistone, DNA-binding protein that plays a critical role in regulating gene transcription (11). Recently, HMGB1 has been identified as a late proinflammatory cytokine when extracellularly released, and it may result in endotoxins such as lethality, local inflammation, and macrophage activation (12). High-mobility group box 1 protein, which is found as a late mediator of endotoxin challenge, has triggered the subsequent investigation of the extrachromosomal activities and functions of HMGB1 released by activated macrophages and also released from necrotic tissue, dendritic cells, or natural killer cells (13, 14). Extracellular HMGB1 has been shown to be able to provoke inflammation, regulate the migration of monocytes, and contribute to maturation of many antigen-presenting cells (APCs) via the receptor for advanced glycation end products (RAGE) and induction of immune responses in vitro (15). In addition, HMGB1 regulates neurite outgrowth by binding to RAGE (16). Ethyl pyruvate (EP) was recently identified as an experimental anti-inflammatory agent during endotoxemia and sepsis (17), and these findings suggest a potential use for EP in the treatment of severe sepsis and septic shock. Administration of EP can also markedly inhibit HMGB1 release and improve the splenocyte proliferative response in thermally injured rats (18).

High-mobility group box 1 protein acts as a late mediator of lethal endotoxemia and sepsis, implying that its release at sites of cell injury or damage might be involved in the initiation and/or perpetuation of an immune response secondary to acute insults. The recent discovery of HMGB1 as a critical mediator of inflammatory diseases has stimulated tremendous interest in the field of inflammation. However, it is not clear whether HMGB1 can induce the activation of Tregs and, subsequently, effector T cells after the burn injury in vivo. The present study was performed to illustrate the potential role of HMGB1 in regulating Tregs and the influence on T-cell-mediated immunity after major burns.

MATERIALS AND METHODS

Reagents and kits

Ethyl pyruvate and collagenase D from Clostridium histolyticum were purchased from Sigma (St. Louis, Mo). RPMI 1640, fetal calf serum (FCS), glutamine, penicillin, streptomycin, and HEPES were purchased from TianRunShanda Biotech Co. Ltd. (Beijing, China). Antiphycoerythrin (PE) multisort kit (immunoglobulin G (IgG)1, clone PE4-14D10) and rat CD4 microbeads (IgG2a, κ. clone OX-38) were purchased from Miltenyi Biotec GmbH, Bergisch Gladbach, Germany. Concanavalin A (conA), thiazolyl blue and Triton X-100 were purchased from Sigma. The antibodies against RAGE (no. bs-0177R) were obtained from Biosynthesis Biotechnology Co., Ltd. (Beijing, China). Antibodies used for flow cytometry analysis, including PE-conjugated antirat CD152 (CTLA-4, IgG1, clone WKH203) and PE-conjugated mouse antirat Foxp3 (IgG2a, κ. clone FJK-16s set), were purchased from eBioscience (San Diego, Calif). Fluorescein isothiocyanate (FITC)-conjugated mouse antirat CD4 (IgG2a, κ. clone OX-35), PE-conjugated mouse antirat CD25 (IgG1, κ. clone OX-39), FITC-conjugated mouse antirat CD3 (IgM, κ. clone 1F4), and mouse antirat CD16/CD32 (Fcγ III/II-R; IgG.1b, κ. clone D34-485) were purchased from BD/PharMingen (San Diego, Calif). Mouse antirat RAGE monoclonal antibody (IgG2A, clone 175410) was purchased from R&D Systems (Minneapolis, Minn). Fluorescein isothiocyanate-conjugated goat antimouse IgG2A was purchased from Biosynthesis Biotechnology Co. Total RNA isolation system and reverse transcription-polymerase chain reaction (RT-PCR) system were purchased from Promega (Madison, Wis). SYBR Green PCR Master MIX was purchased from Applied Biosystems (Foster City, Calif). High-mobility group box 1 protein enzyme-linked immunosorbent assay (ELISA) kit was purchased from Shino-Test Corporation (Kanagawa, Japan). Enzyme-linked immunosorbent assay kits of rat IL-10, IL-2, IL-4, and interferon (IFN) γ were purchased from Biosource (Worcester, Mass). Nuclear extract and nuclear factor-κB (NF-κB) p65 assay kits were purchased from Active Motif (Carlsbad, Calif).

Animal thermal injury model

A widely used technique for producing full-thickness scald injury was used in the experiment. Wistar rats (weight range, 250-300 g) purchased from the Laboratory Animal Center (Beijing, China) were housed in separate cages in a temperature-controlled room with 12-h light and 12-h darkness to acclimatize for at least 7 days before being used. All animals had free access to water but were fasted overnight before the experiment. Rats with burn injuries were anesthetized, and the dorsal and lateral surfaces of the rats were shaved. Rats were placed on their backs and secured in a protective template with an opening corresponding to 30% of the total body surface area, and the exposed skin was immersed in 99°C water for 12 s. Sham-injured rats were subjected to all of the procedures except the temperature of the bath was at room temperature (18). Lactated Ringer solution (40 mL/kg) was administered intraperitoneally for delayed resuscitation 6 h after the injury and 4 mL at 12, 24, 36, and 48 h after the burn injury. All experimental manipulations were undertaken in accordance with the National Institutes of Health's Guide for the Care and Use of Laboratory Animals, with the approval of the scientific investigation board of the Burns Institute, Postgraduate Medical College of PLA, Beijing, China.

Experimental design

One hundred twenty-eight rats were randomly divided into four groups as follows: sham group (32 rats), burn group (32 rats), burn with EP treatment group (32 rats), and burn with anti-RAGE antibody treatment group (32 rats), and all of these groups were further divided into four subgroups of eight rats each, and they were killed on postburn days (PBDs) 1, 3, 5, and 7 respectively. In addition, eight rats were taken to serve as normal controls (the main parameters determined in the current study were found to be highly consistent with those in sham-injured animals, so the results were not shown.). Ethyl pyruvate was added to lactated Ringer solution (EP, 28 mM) in the EP treatment group. Anti-RAGE antibody at a dose of 2 mg/kg was given via dorsal penile vein at 6 and 24 h after burn injury in the anti-RAGE antibody treatment group. Animals of all groups were killed at designated time points, and blood and spleen samples were harvested aseptically to determine levels of various cytokines. Spleen samples were divided into two parts, one of which was used to procure Tregs and T cells immediately, and the other was snap-frozen in liquid nitrogen and stored at −80°C until use for measurement of cytokine levels and total RNA extraction.

Isolation of splenic Tregs

Spleens were digested by collagenase D, then the tissue was cut into tiny pieces. The digested material was passed through a 30-μm stainless steel mesh using a syringe, and the petri dish and the mesh were washed with buffer solution. Preenrichment of splenocytes was performed by Ficoll-Paque density gradient centrifugation. Regulatory T cells were isolated from the splenic tissue using anti-PE multisort kit (PE4-14D10), rat CD4 microbeads (OX-38), and a mini magnetic cell sorting (MACS) separator with a positive selection MS/LD column according to the manufacturer's instructions. Regulatory T cells were then cultured in RPMI 1640 FCS (10%) overnight for recovery. The supernatants were collected to determine IL-10 levels.

Isolation of splenic T cells

Spleens were teased in 5 mL RPMI 1640. Cells were dissociated through a 30-μm stainless steel mesh and collected after centrifugation at 300 × g for 10 min. They were resuspended in 4 mL RPMI 1640. Mononuclear cells were then obtained using Ficoll-Paque density gradient centrifugation and incubated with nylon wool-packed columns for 2 h at 37°C. T Cells were obtained by eluting the columns with 30 to 40 mL of RPMI 1640 at a flow rate of one drop per second. Thus, the cells obtained were 90%-95% CD3-positive T cells (data not shown). T Cells with conA stimulation were cultured for 18 h at 37°C. Supernatants were collected to determine cytokines, and cells were divided into two portions. One portion (5 × 107/mL) was used to extract total RNA, and the other (5 × 105/mL) was used to detect expression levels of IL-2 receptor α (IL-2Rα).

Flow cytometric analysis

Regulatory T cells (1 × 105) were reacted for 15 min at 4°C in 100 μL of phosphate-buffered saline (PBS) 5% FCS 0.1% sodium azide (staining buffer) with PE-conjugated IgG specific for CD152 or with PE-conjugated IgG specific for Foxp3 (pretreated by fixation/permeabilization and permeabilization buffers). In some experiments, Tregs were treated with anti-RAGE monoclonal antibody, followed by FITC-conjugated goat antimouse IgG. In all experiments, isotype controls were included using an appropriate PE- or FITC-conjugated irrelevant monoclonal antibody of the same Ig class. T Cells (1 × 105) were blocked with 1 μg of Fc blocker for 15 min at 4°C in 100 μL of PBS 5% FCS 0.1%, and then reacted for 20 min in darkness with PE-conjugated CD25 and FITC-conjugated CD3. Cells were then washed twice with PBS 5% FCS, fixed in 10% formaldehyde in PBS (pH 7.2-7.4), and examined by flow cytometry using a FACScan (BD Biosciences, Mountain View, Calif).

T-cell proliferation assay

T cells were suspended in RPMI 1640 culture medium supplemented with 10% FCS, 100 U/mL penicillin, and 100 μg/mL streptomycin, and placed in 96-well round bottom plates in sextuplet for proliferation, giving the final cell density of 5×106/mL. Cells were treated with or without 5 μg/mL conA for 68 h at 37°C in 5% CO2/ 100% humidified air. Thiazolyl blue (5 mg/mL; 10 μL per well) was then added, and incubation was continued for 4 h, and 100 μg acid isopropanol was added to dissolve the thiazolyl blue crystals. When all the crystals had been dissolved through repeated blowing with a pipet, the optical density was measured by the use of a microplate reader (Spectra MR, Dynex, Richfield, Minn) at a wavelength of 540 nm.

Assay of NF-κB activity

A nuclear extract kit was used, and the protocol was based on samples of approximately 107 cells, avoiding freeze/thaw cycles. First, the cells were collected in ice-cold PBS in the presence of phosphatase inhibitors to limit further protein modifications (expression, proteolysis, dephosphorylation, etc.). Then, the cells were resuspended in hypotonic buffer to make the cell membrane swollen and fragile. A detergent was added to produce leakage of the cytoplasmic proteins into the supernatant. After collection of the cytoplasmic fraction, the nuclei were lysed, and the nuclear proteins were dissolved in the lysis buffer in the presence of the protease inhibitor cocktail. Once the nuclear cell extract was prepared, the active form of NF-κB contained in the nuclei was then quantified by TransAM NF-κB p65 kits. Procedures were performed according to the manufacturer's instructions briefly in the following four steps: binding of NF-κB to its consensus sequence, binding of primary antibody, binding of secondary antibody, and colorimetric reaction.

SYBR green real-time RT-PCR

Total RNA was extracted from the splenic tissue or T cells using the single-step technique of acid guanidinium thiocyanate-chloroform extraction according to the manufacturer's instruction. The concentration of purified total RNA was determined spectrophotometrically at 260 nm. mRNA for IL-10 in splenic tissue and IL-2 and IL-2Rα in splenic T cells and glyceraldehyde-3-phosphate dehydrogenase were quantified in duplicate by SYBR Green two-step, real-time RT-PCR. After the removal of potentially contaminating DNA with DNase I, 1 μg of total RNA from each sample was used for RT with an oligo dT and a Superscript II to generate first-strand cDNA. Polymerase chain reaction mixture was prepared using SYBR Green PCR Master Mix and also the primers as shown in Table 1. Thermal cycling conditions were 10 min at 95°C, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min on a sequence detection system (Applied Biosystems). Each gene expression was normalized with GAPDH mRNA content. Primer software was provided to design the primers for IL-2Rα (NM_000417) and IL-10 (NM_012854). Sequences of rat primer for SYBR Green PCR were shown in the succeeding sentences: IL-10 (73 bp), GCATTTGAATTCCCTGGGAGA (sense) and TGCTCCACTGCCTTGCTTT (antisense); IL-2 (75 bp), CCATGATGCTCACGTTTAAATTTT (sense) and TTGCCCAAGCAGGCCACAGAATTG (antisense) (19); IL-2Rα (61 bp), CCTCCTCCTGAGTGGGCTC (sense) and TCCCGGCTTCTTACCAAGAAA (antisense); and GAPDH (177 bp), TGCACCACCAACTGCTTA (sense) and GGATGCAGGGATGATGTT (antisense) (20).

T1-16
Table 1:
Enzyme-linked immunosorbent assay analysis of the HMGB1 levels in serum after injury (n = 5, ng/mL)

Cytokine measurements by ELISA

High-mobility group box 1 protein, IL-10, IL-2, IL-4, and IFN-γ levels were determined by ELISA, strictly following the protocols provided by the manufacturer. The color reaction was terminated by adding 100 µL of orthophosphoric acid. Plates were read in a microplate reader (Spectra MR, Dynex). The standard concentration curve was linear from 0 to 116.8 ng/mL for HMGB1, from 0 to 1,000 pg/mL for IL-10, from 0 to 1,500 pg/mL for IL-2, from 0 to 62.5 pg/mL for IL-4, and from 0 to 1,400 pg/ml for IFN-γ.

Statistical analysis

Data were expressed as mean ± SD and analyzed with a one-way ANOVA. An unpaired Student t test was used to evaluate significant differences between groups. A P value of 0.05 or less was considered to indicate statistical significance.

RESULTS

Changes in serum HMGB1 levels after burn injury

As shown in Table 1, serum HMGB1 levels were significantly elevated during PBDs 1 to 7 (all P < 0.01), peaking on PBD 3, and they were markedly lowered by treatment with EP during the observation period (all P < 0.01) but not by anti-RAGE antibody.

Isolation of CD4+CD25+ Tregs

CD4+CD25+ Tregs were isolated from the rat splenic cells in two steps by MACS system. As shown in Figure 1, the purity of positively sorted CD4+CD25+Tregs was 90.4% ± 1.6%, with a survival rate of 92.6% ± 2.4%. The purity of negatively sorted CD4+CD25 T cells was 88.6% ± 2.2%.

F1-16
Fig. 1:
Isolation of CD4+CD25+ Tregs from the splenic cells. CD4+CD25+ Tregs were isolated from the rat splenic cells in two steps by MACS system according to the manufacturer's instructions. The purity of negatively sorted CD4+CD25 T cells were 88.6% ± 2.2% (A). The purity of positively sorted CD4+CD25+ Tregs was 90.4% ± 1.6%, with a survival rate of 92.6% ± 2.4% (B).

Effects of HMGB1 on phenotypic and functional changes in Tregs

To investigate the effects of HMGB1 on splenic Tregs and underlying receptor mechanism, these cells were analyzed at different time points in animals with sham burn, EP, or anti-RAGE antibody treatment. As shown in Figure 2, expression levels of CD152 (CTLA-4) and Foxp3 in the burn group were strongly enhanced on splenic Tregs during PBDs 1 to 7 compared with the sham-injured group (P < 0.05 or P < 0.01). Treatment with EP or anti-RAGE antibody to inhibit HMGB1 could significantly decrease the expression levels of CD152 and Foxp3 on Tregs (P < 0.05 or P < 0.01).

F2-16
Fig. 2:
Flow cytometric analysis of phenotypes of Tregs. In burn group, splenic Tregs showed strongly enhanced levels of CD152 and Foxp3 during PBDs 1 to 7 compared with those in the sham-injured group. Treatment with EP or anti-RAGE antibody to inhibit HMGB1 could significantly decrease the expression of CD152 and Foxp3. *P < 0.05, P < 0.01 as burn group versus sham group; P < 0.05, § P < 0.01 as "burn + EP" or "burn + anti-RAGE" group versus burn group.

Effect of HMGB1 on IL-10 levels in Tregs supernatants

The capacity of Tregs to produce IL-10, which is one of the markers of function of mature Tregs, was analyzed in the present experiment. As shown in Figure 3, the expression levels of IL-10 mRNA in spleen tissue were markedly up-regulated in burn-injured rats in comparison to the sham-injured group during PBDs 1 to 7 (P < 0.05 or P < 0.01). IL-10 protein levels in supernatants of Tregs were also elevated after burn injury. Treatment with EP or anti-RAGE antibody could significantly decrease the expression levels of IL-10 mRNA in spleen tissue and IL-10 production in culture supernatants of Tregs (P < 0.05 or P < 0.01).

F3-16
Fig. 3:
SYBR green real-time RT-PCR analysis and ELISA of mRNA expression levels of splenic IL-10 (A), IL-10 levels in Tregs supernatant (B), and gene expression of spleen tissue were in values of relative quantification. IL-10 mRNA expression in spleen tissue and levels of IL-10 production in culture supernatant of Tregs were significantly enhanced after burn injury, which could be restored by using EP or anti-RAGE antibody to block HMGB1. Statistical significance: *P < 0.05, P < 0.01 as burn group versus sham group; P < 0.05, § P < 0.01 as "burn + EP" or "burn + anti-RAGE" group versus burn group.

Expressions of RAGE on splenic Tregs

High-mobility group box 1 protein is a ligand for RAGE, which is a membrane protein that transduces intracellular signaling. Using flow cytometry techniques, the expression of RAGE on Tregs surface was detected. As shown in Figure 4, A and B, enhanced expression of RAGE on the surface of Tregs from burned rats was found during PBDs 1 to 7 compared with sham-injured rats (all P < 0.01), and the elevated expressions were slightly influenced by treatment of EP on PBDs 3, 5 and 7 but were blocked by treatment with anti-RAGE antibody during PBDs 1 to 5 (P < 0.01 or P < 0.05).

F4-16
Fig. 4:
Changes in RAGE expression on the surface of splenic Tregs by flow cytometric analysis. Using flow cytometric techniques, RAGE was detected on the surface of splenic Tregs (Fig. 4, A and B). Markedly increased expression of RAGE on the surface of Tregs from burned rats was found in burn group during PBDs 1 to 7 compared with sham-injured group, which was slightly influenced by treatment with EP but blocked by treatment with anti-RAGE antibody. Statistical significance: P < 0.01 as burn group versus sham group; P < 0.05, § P < 0.01 as "burn + EP" or "burn + anti-RAGE" group versus burn group.

T-cell activation after injury

To understand the mechanism concerning the involvement of Tregs in the effect of HMGB1 on T-cell immune function, T-cell proliferative activity and production of cytokines were analyzed. The T-cell proliferative activities in response to conA in the burn-injured group were significantly suppressed during PBDs 1 to 7 as compared with the sham-injured group, lowest on PBD 3 (P < 0.05), which could be restored by treatment with EP or anti-RAGE antibody (all P < 0.01). Expressions of IL-2 by T cells and IL-2Rα on the surface of Tcells were simultaneously suppressed to a certain extent after burn injury (P < 0.05), lowest on PBD 3 (P < 0.01), and EP or anti-RAGE antibody treatment could restore their expressions (all P < 0.01; Fig. 5, Table 2).

F5-16
Fig. 5:
Flow cytometric analysis of IL-2Rα on splenic T cell on PBDs 1 and 7. T Cells reacted with PE-conjugated CD25 and FITC-conjugated CD3, and then were examined by flow cytometry. IL-2Rα on surface of T cells was simultaneously suppressed to certain extent after burn injury, and treatment with EP or anti-RAGE antibody could restore their expressions (P<0.01). A, sham group; B, burn group; C, "burn + EP" group; D, "burn + anti-RAGE" group.
T2-16
Table 2:
Changes in indexes reflecting T-cell immune function among various groups on PBD 3 (n = 5)

Polarization of T cell after injury

It is well known that TH1 cells produce IFN-γ, and TH2 cells produce IL-4. Thus, using ELISA, we detected the two cytokines produced by T cells to identify polarization of naive T cells. After burn injury, the levels of IL-4 produced by T cells in response to conA were markedly increased (P < 0.05), peaking on PBD 3 (P < 0.01; Table 2), whereas the levels of IFN-γ markedly reduced (P < 0.01), indicating that naive T cells had developed into TH2 cells. Ethyl pyruvate or anti-RAGE antibody treatment could significantly inhibit increased levels of IL-4 (P < 0.01) and reduced levels of IFN-γ (P < 0.01) after thermal injury, indicating that EP or anti-RAGE antibody treatment might influence the polarization of T cells in animals subjected to thermal injury and induced naive T cells to shift to TH1 cells.

NF-κB activation after burn injury

To investigate a potential signal pathway with regard to T-cell activation, NF-κB activity of splenic T cells was determined after injury. Nuclear factor-κB activities of splenic T cells were significantly down-regulated during PBDs 1 to 7, lowest on PBD 3 (all P < 0.05). Treatment with EP or anti-RAGE antibody could completely restore the NF-κB activity of splenic T cells after burn injury (all P < 0.01; Table 2).

DISCUSSION

It has been proposed that Tregs play a central role in the maintenance of immunological tolerance in the peripheral lymphatic system (1), and studies in many animal models have demonstrated their capacity to inhibit inflammatory pathologies in vivo (3, 21). It is well known that sepsis causes marked immunosuppression. Regulatory T cells are also essential for an effective immunosuppression response to burn injury or sepsis (22). Therefore, we would expect that there would be an activation of immune activity of Tregs derived from burn-injured rats. Regulatory T cells isolated from mice or humans are able to suppress the in vitro proliferative response of conventional CD4+ and CD8+ T cells (7). Evidence is also emerging to suggest that Tregs can suppress the proliferation and function of other cell types such as dendritic cells and B cells (7, 11). In the present study in vivo, we have showed that expression levels of CD152 (CTLA-4) and Foxp3 were strongly enhanced on splenic Tregs during PBDs 1 to 7 in comparison to Tregs from sham-injured rats. It seems that burn injury induced production of splenic Tregs with high expressions of certain phenotypes, and enhanced Treg activity might be an important linkage to modulate cell-mediated immunity of T lymphocytes.

Depending on the different settings, cytokines (including transforming growth factor β and IL-10) and direct cell killing of conventional T cells and APCs by the Tregs have been proposed as the mechanism of immunosuppression (23). IL-10 is expressed by various immune cells, including T cells, B cells, and macrophages. Its wide range of immunosuppressive effects include decreased T-cell cytokine production, inhibited antigen presentation, down-regulated expression of costimulatory molecules on APCs, and direction of T-cell differentiation into TH2 (24). In this study, the cytokine secretion pattern of these Tregs was detected, and it was found that these Tregs produced higher levels of IL-10 after burn injury. The ability of splenic Tregs to produce cytokines such as IL-10 implied that there existed immunodepression after acute insults. A similar phenomenon was also noted in cecal ligation and puncture-induced sepsis in rats (25) and patients with septic shock (12).

The immune response to infection represents a complex balance between the successful induction of proinflammatory antipathogen responses and anti-inflammatory responses required to limit damage to host tissues. Tregs undoubtedly play an important role in controlling this balance during infection, and the results can range from highly detrimental to the host to highly beneficial to both the host and pathogen. In our current observations, significant suppression of T-cell proliferation during PBDs 1 to 7 was found, and expression levels of IL-2 in T-cell supernatant and IL-2Rα on the T-cell surface were simultaneously suppressed to a certain extent. It was also revealed that T cells were polarized to TH2 cells after burn injury. The previously discussed data indicate that there is a marked suppression of T cells after major burns (25). To collaborate with other findings, it has been reported that Tregs in mice can inhibit the proliferation of T cells and release of cytokine for polarization to antigen-specific TH1 cells after burn injury (22). A classic characteristic of CD4+CD25+ Tregs is their lack of proliferative response upon TCR activation or stimulation with mitogenic antibodies. Thus, an anergic phenotype is attributed to these cells. CD4+CD25+ Tregs depend on exogenous IL-2 but inhibit the transcription of IL-2 and IL-2Rα in conventional CD25 T cells (9).

Excessive induction of HMGB1 might result in an inflammatory response producing tissue injury and organ failure (26). Our results showed that serum HMGB1 levels were significantly elevated during PBDs 1 to 7, indicating that the kinetics of excessive formation of HMGB1 is a delayed and prolonged process. To verify whether the activation of Tregs was associated with excessive release of HMGB1 after burn injury, EP was used to inhibit the effect of HMGB1 (27). It was shown that administration of EP could dramatically decrease the expression of CD152, Foxp3 on Tregs, and IL-10 production after burn injury. However, T-cell proliferative activity and expression levels of IL-2 and IL-2Rα were markedly restored, and T cells were shifted to TH1. These data confirmed that with delayed treatment with EP after burn injury to inhibit HMGB1, the function of mature Tregs was impaired. T-Cell activity was restored, and T cells differentiated to TH1. Therefore, the result suggests that excessive release of HMGB1 might stimulate splenic Tregs to a high activity and further induce suppression of immune function of T lymphocyte. Our previous study, however, had showed that in vitro HMGB1 stimulation in a lower concentration could result in marked down-regulation of expression of costimulatory molecules in a dose-dependent manner, including CD152 and Foxp3 on mice splenic Tregs (28). Nevertheless, experiments in our laboratory had demonstrated that the TH1 subset could shift to the TH2 subset in immune reaction mediated by human T lymphocytes with a high dosage and prolonged treatment of HMGB1 in vitro (29). Recently, similar findings have been reported by others (15). We therefore speculated that HMGB1 might have a dual regulatory effect on immune functions of Tregs with the different concentrations and stimulation times. The possible reasons with regard to the seemingly conflicting functions may depend on differences in protein structure and concentration and its location (30). In the present experiments, the peak serum levels of HMGB1 were on PBD 3, which might be the result of HMGB1 released from burned necrotic skin. Because the structure of HMGB1 that is passively released by necrotic cells is different from that secreted by inflammatory cells (31), HMGB1 released by burned necrotic skin might be involved in the activated expressions of Tregs phenotype.

To further clarify the potential receptor mechanism of HMGB1 binding to mature Tregs in vivo, we used the anti-RAGE antibody to block RAGE in this experiment. The results revealed that the markedly up-regulated expression of RAGE on the surface of Tregs from burned rats was blocked by treatment with anti-RAGE antibody, resulting in a significant lowering of expression of CD152, Foxp3 of Tregs, and levels of IL-10 production. These results suggested that the effect of HMGB1 on Tregs was inhibited by antibody against RAGE, and the influence of HMGB1 in inducing mature Tregs could be mediated through manipulation of RAGE signaling, thus linking this pathway to the control of Tregs function. In addition, the capacity of HMGB1 to activate macrophages and to mediate septic shock can be inhibited by blockade of RAGE (32), suggesting that RAGE also participates in the cell-activating effect of HMGB1. Nonetheless, there are many key questions that remain to be answered. It is not clear how RAGE signaling controls the activity of Tregs. Is RAGE signaling unique in regulating Tregs function? What is the identity of molecules responsible for immunosuppression? Recent studies have shown physical interaction between HMGB1 and Toll-like receptors 2 and 4 on the cell membrane of macrophages, transfected HEK293 cells, neutrophils, or monocytes (33), indicating that other receptor(s) are also involved in cellular activation by HMGB1. Some results have demonstrated that Toll pathway-dependent blockades could alter Treg-cell-mediated suppression (34). Thus, activation of Tregs as induced by HMGB1 might involve multiple receptors, including RAGE and Toll-like receptors. In addition, we also found that administration of anti-RAGE antibody remarkably restored T-cell proliferative activity and expression levels of IL-2 and IL-2Rα after burn injury, and could significantly initiate T-cell shift to TH1 cell. Taken together, it seems that after severe injury, excessive HMGB1 release may result in the maturation of Tregs by interacting with RAGE and further induced immune depression of T cells with polarization to TH2 cells.

Our data revealed that the NF-κB activation of splenic T cell was significantly down-regulated during PBDs 1 to 7 after severe burns. In agreement with this finding, no marked change in NF-κB rel A was evident in splenic T cells after burn injury, and down-regulation of NF-κB activity was associated with the alteration of the proliferative response in the spleen after burn injury (35). Nuclear factor-κB has been known to have proliferative and antiapoptotic properties (36). One may speculate that the reduction in NF-κB contributes to loss of proliferative and/or antiapoptotic signaling, leading to the changes observed in the splenic T cells after injury. In this in vivo study, treatment with EP or anti-RAGE antibody could completely restore the NF-κB activity of splenic T cell after major burns, implying that NF-κB signaling might be involved in the mature Tregs mediating suppression of T lymphocyte due to excessive release of HMGB1. Thus, mature Tregs associated with excessive HMGB1 formation might induce suppression of T cells through down-regulating NF-κB activation.

CONCLUSIONS

In summary, the excessively released HMGB1 might stimulate splenic Tregs enhanced probably by binding RAGE on the surface of Tregs and further induces suppression of immune function of T lymphocyte with shifting of TH1 to TH2 after burn injury. Nuclear factor-κB signaling seems to be involved in depression of T lymphocyte and polarization to TH2 associated with HMGB1 formation via the mediation of enhanced Treg activity.

REFERENCES

1. Sakaguchi S: Naturally arising CD4+ regulatory T cells for immunologic self-tolerance and negative control of immune responses. Annu Rev Immunol 22:531-562, 2004.
2. Roncarolo MG, Bacchetta R, Bordignon C, Narula S, Levings MK: Type 1 T regulatory cells. Immunol Rev 182:68-79, 2001.
3. Zhai Y, Kupiec-Weglinski JW: What is the role of regulatory T cells in transplantation tolerance? Curr Opin Immunol 11:497-503, 1999.
4. Shevach EM: CD4+CD25+ suppressor T cells: more questions than answers. Nat Rev Immunol 2:389-400, 2002.
5. Ramsdell F: Foxp3 and natural regulatory T cells: key to a cell lineage? Immunity 19:165-168, 2003.
6. Morgan ME, van Bilsen JH, Bakker AM, Heemskerk B, Schilham MW, Hartgers FC, Elferink BG, van der Zanden L, de Vries RR, Huizinga TW, et al:Expression of FOXP3 mRNA is not confined to CD4+CD25+ T regulatory cells in humans. Hum Immunol 66:13-20, 2005.
7. O'Garra A, Vieira PL, Vieira P, Goldfeld AE: IL-10-producing and naturally occurring CD4+ Tregs: limiting collateral damage. J Clin Invest 114:1372-1378, 2004.
8. Mills KH: Regulatory T cells: friend or foe in immunity to infection? Nat Rev Immunol 4:841-855, 2004.
9. Belkaid Y, Rouse BT: Natural regulatory T cells in infectious disease. Nature Immunol 6:353-360, 2005.
10. Efron P, Moldawer LL: Sepsis and the dendritic cell. Shock 20:386-401, 2003.
11. Thomas JO, Travers AA: HMG1 and 2, and related 'architectural' DNA-binding proteins. Trends Biochem Sci 26:167-174, 2001.
12. Sunden-Cullberg J, Norrby-Teglund A, Treutiger CJ: The role of high mobility group box-1 protein in severe sepsis. Curr Opin Infect Dis 19:231-236, 2006.
13. Chen G, Li J, Ochani M, Rendon-Mitchell B, Qiang X, Susarla S, Ulloa L, Yang H, Fan S, Goyert SM, et al: Bacterial endotoxin stimulates macrophages to release HMGB1 partly through CD14- and TNF-dependent mechanisms. J Leukoc Biol 76:994-1001, 2004.
14. Semino C, Angelini G, Poggi A, Rubartelli A: NK/iDC interaction results in IL-18 secretion by DCs at the synaptic cleft followed by NK cell activation and release of the DC maturation factor HMGB1. Blood 106:609-616, 2005.
15. Yang D, Chen Q, Yang H, Tracey KJ, Bustin M, Oppenheim JJ: High mobility group box-1 protein induces the migration and activation of human dendritic cells and acts as an alarmin. J Leukoc Biol 81:59-66, 2007.
16. Huttunen HJ, Fages C, Rauvala H: Receptor for advanced glycation end products (RAGE)-mediated neurite outgrowth and activation of NF-kappaB require the cytoplasmic domain of the receptor but different downstream signaling pathways. J Biol Chem 274:19919-19924, 1999.
17. Das UN: Is pyruvate an endogenous anti-inflammatory molecule? Nutrition 22:965-972, 2006.
18. Zhang LT, Yao YM, Dong YQ, Dong N, Yu Y, Sheng ZY: Relationship between high mobility group box-1 protein release and T cell suppression in rats after thermal injury. Shock 30:449-455, 2008.
19. Krook H, Hagberg A, Song Z, Landegren U, Wennberg L, Korsgren O: A distinct TH1 immune response precedes the described TH2 response in islet xenograft rejection. Diabetes 51:79-86, 2002.
20. Kim HY, Kim HJ, Min HS, Kim S, Park WS, Park SH, Chung DH: NKT cells promote antibody-induced joint inflammation by suppressing transforming growth factor beta1 production. J Exp Med 201:41-47, 2005.
21. Maizels RM: Infections and allergy - helminths, hygiene and host immune regulation. Curr Opin Immunol 17:656-661, 2005.
22. Murphy TJ, Ni Choileain N, Zang Y, Mannick JA, Lederer JA: CD4+CD25+ regulatory T cells control innate immune reactivity after injury. J Immunol 174:2957-2963, 2005.
23. Marie JC, Letterio JJ, Gavin M, Rudensky AY: TGF-β1 maintains suppressor function and Foxp3 expression in CD4+CD25+ regulatory T cells. J Exp Med 201:1061-1067, 2005.
24. Pestka S, Krause CD, Sarkar D, Walter MR, Shi Y, Fisher PB: Interleukin-10 and related cytokines and receptors. Annu Rev Immunol 22:929-979, 2004.
25. Patenaude J, D'Elia M, Hamelin C, Garrel D, Bernier J: Burn injury induces a change in T cell homeostasis affecting preferentially CD4+ T cells. J Leukoc Biol 77:141-150, 2005.
26. Mantell LL, Parrish WR, Ulloa L: HMGB-1 as a therapeutic target for infectious and inflammatory disorders. Shock 25:4-11, 2006.
27. Ulloa L, Ochani M, Yang H, Tanovic M, Halperin D, Yang R, Czura CJ, Fink MP, Tracey KJ: Ethyl pyruvate prevents lethality in mice with established lethal sepsis and systemic inflammation. Proc Natl Acad Sci U S A 99:12351-12356, 2002.
28. Zhang Y, Yao YM, Dong N, Yu Y, Sheng ZY: Influence of high mobility group box-1 protein on immunosuppression molecules expression of splenic regulatory T cells in mice. Chin J Exp Surg 24:616-618, 2007.
29. Huang LF, Yao YM, Meng HD, Zhao XD, Dong N, Yu Y, Sheng ZY: The effects of high mobility group box-1 protein on immune function of human T lymphocytes in vitro. Chin Crit Care Med 20:7-13, 2008.
30. Yamada S, Maruyama I: HMGB1, a novel inflammatory cytokine. Clin Chim Acta 375:36-42, 2007.
31. Bonaldi T, Talamo F, Scaffidi P, Ferrera D, Porto A, Bachi A, Rubartelli A, Agresti A, Bianchi ME: Monocytic cells hyperacetylate chromatin protein HMGB1 to redirect it towards secretion. EMBO J 22:5551-5560, 2003.
32. Kokkola R, Andersson A, Mullins G, Ostberg T, Treutiger CJ, Arnold B, Nawroth P, Andersson U, Harris RA, Harris HE: RAGE is the major receptor for the proinflammatory activity of HMGB1 in rodent macrophages. Scand J Immunol 61:1-9, 2005.
33. Park JS, Svetkauskaite D, He Q, Kim JY, Strassheim D, Ishizaka A, Abraham E: Involvement of Toll-like receptors 2 and 4 in cellular activation by high mobility group box 1 protein. J Biol Chem 279:7370-7377, 2004.
34. Pasare C, Medzhitov R: Toll pathway-dependent blockade of CD4+CD25+ T cell-mediated suppression by dendritic cells. Science 299:1033-1036, 2003.
35. Phan HH, Cho K, Nelson HA, Shin S, Jeong J, Greenhalgh DG: Downregulation of NF-kappaB activity associated with alteration in proliferative response in the spleen after burn injury. Shock 23:73-79, 2005.
36. Sun Z, Andersson R: NF-kappaB activation and inhibition: a review. Shock 18:99-106, 2002.
Keywords:

Cytotoxic T-lymphocyte-associated antigen 4; forkhead/winged helix transcription factor p3; cytokines; proliferation; cell polarization

©2009The Shock Society