Secondary Logo

Journal Logo

CHRONIC ETHANOL SENSITIZES THE LIVER TO ENDOTOXIN VIA EFFECTS ON ENDOTHELIAL NITRIC OXIDE SYNTHASE REGULATION

Karaa, Amel; Kamoun, Walid S; Clemens, Mark G

doi: 10.1097/01.shk.0000180616.13941.7d
Basic Science Aspects
Free

In vivo studies have shown that chronic alcohol consumption sensitizes the liver to endotoxemic shock, leading to liver microcirculation disruption. In the present study, we investigated the molecular mechanisms involved, focusing on endothelial nitric oxide synthase (eNOS) activity and regulation, which represents one of the major vasodilatory pathways. Male Sprague-Dawley rats were fed an alcohol liquid diet or a control isocaloric diet for 5 weeks. Priming effects of ethanol were studied in a model with or without a 24-h LPS treatment (1 mg/kg body weight). At the end of the diet, liver tissue was harvested for western blot, reverse transcriptase-PCR, histological analysis, and immunostaining and blood for serum alanine aminotransferase analysis. Chronic ethanol and LPS alone induced a mild hepatitis and infiltration, respectively. Combined, LPS and chronic ethanol feeding showed a synergistic effect on the liver, leading to extensive steatohepatitis with extensive focal necrosis associated with significantly higher levels of serum ALT. Chronic ethanol and LPS significantly inhibited eNOS activity, but exerted their effects through different mechanisms. Caveolin-1, an eNOS inhibitory protein, was upregulated after LPS and chronic alcohol consumption. Additionally, chronic alcohol consumption down-regulated endothelin B receptor, eNOS protein levels, and eNOS phosphorylation. In conclusion, chronic ethanol consumption and LPS share a similar pathophysiology and both lead to the impairment of eNOS activity, but through distinct molecular mechanisms. The presence of focal necrosis in a mild stress model could provide a good animal study to investigate the advanced stages of alcoholic liver diseases.

Department of Biology, University of North Carolina, Charlotte, North Carolina

Received 30 Jun 2005; first review completed 14 Jul 2005; accepted in final form 26 Jul 2005

Address reprint requests to Mark G. Clemens, PhD, Department of Biology, University of North Carolina, 9201 University City Boulevard, Charlotte, NC 28223. E-mail: mgclemen@email.uncc.edu.

A.K and W.S.K. contributed equally to this work.

This work was supported by the National Institutes of Health (grant no. DK38201).

Back to Top | Article Outline

INTRODUCTION

Although the hepatotoxic effects of chronic alcohol consumption have been well characterized, mechanisms leading to advanced stages of alcoholic liver disease (ALD) remain uncertain. Susceptibility to ALD is very different among individuals, with only a small fraction of heavy drinkers developing hepatitis and cirrhosis (1). Understanding the mechanisms underlying this variability is a necessary step for better ALD management and treatment. Studies suggested that chronic alcohol consumption can sensitize the liver to several additional pathogens and stresses such as viral hepatitis (2, 3), hemorrhagic shock (4), ischemia-reperfusion (5), and endotoxemic stress (6). This sensitization is thought to play a major role in the progression of ALD to nonreversible advanced stages (7).

Over the past decade, several clinical and experimental studies demonstrated the significant contribution of lipopolysaccharide (LPS) to early as well as advanced stages of ALD (8-10). Chronic alcohol consumption has been shown to increase gut permeability to LPS, leading to chronic endotoxemia, which contributes to Kupffer cell (KC) hyperactivation (10-12). LPS-mediated activation of KC induces proinflammatory cytokine synthesis and release, which causes direct hepatocellular injury and increases recruitment of circulating immune cells (6, 13). In addition to alcohol-mediated chronic endotoxemia, chronic alcohol consumption sensitizes KC to the effects of LPS, which further exacerbates KC activation (6, 14, 15). The molecular mechanisms mediating the sensitization of KC are still unknown, however, studies using LPS-binding protein, TLR4, and CD14 knockout mice have demonstrated the key role of LPS signaling molecules in KC sensitization and in alcohol-induced liver injury (11, 16, 17).

Liver microcirculation disruption has been implicated in most chronic as well as acute hepatic pathological conditions (18, 19). Microcirculatory blood flow dysregulation induces an imbalance in the oxygen distribution through the liver parenchyma, causing hypoxic stress and subsequent hepatocellular damage (18, 19). It is well accepted that severe stages of ALD are associated with microcirculation dysfunction (20). In a rat model of ALD, chronic alcohol consumption led to hepatic microcirculation disruption characterized by decreased red blood cell velocity and sinusoidal shutdown (21). This study suggested that increased leukocyte adhesion seen after chronic alcohol consumption contributes to the microcirculation disruption (21). However, the relationship between leukocyte infiltration and microcirculation disruption is still controversial. Furthermore, considerable evidence has accumulated in support of the hypothesis that microcirculation disruption is mainly due to an imbalance in vasoconstrictors and vasodilators and less likely because of mechanical obstruction of the blood flow (18, 22-25). In addition to the deleterious effects of alcohol on the liver microcirculation, LPS has also been shown to disrupt the hepatic microcirculation regulation (18). The microcirculation disruption seen under both stress conditions is characterized by a hypersensitivity to the constrictor effects of endothelin-1 (ET-1), a potent vasoconstrictor expressed by LPS exposure as well as chronic alcohol consumption (26, 27). Intravital microscopic assessment of the liver microcirculation of alcohol fed rats treated with LPS or saline suggested that chronic alcohol consumption can sensitize the liver microcirculation to the effects of LPS, leading to synergistic exacerbation of the disruption (21, 27). A study conducted by Horie et al. (27) suggested that alcohol-mediated blood flow disruption and sensitization to LPS were dependent on the effects of ET-1.

ET-1 regulates the liver microcirculation through vasoconstrictor effects mediated by binding to the endothelin A receptor (ETA) on hepatic stellate cells and vasodilatory effects mediated by binding to the endothelin B receptor (ETB) receptor on sinusoidal endothelial cells (28). Binding of ET-1 to ETB results in phosphorylation-dependent activation of endothelial nitric oxide synthase (eNOS) and production of NO, a potent vasodilator (29). Stress-mediated inhibition of eNOS activity has been reported under mild stresses such as remote trauma and advanced liver diseases such as cirrhosis, and has been linked to upregulation of an eNOS inhibitor: caveolin-1 (CAV-1) (22, 30). Although alcohol-mediated disruption of the liver microcirculation has been well characterized, the molecular mechanisms leading to this disruption have not yet been investigated (21, 27).

In the present study, we investigated the molecular mechanisms involved in chronic ethanol feeding-induced liver microcirculation disruption. Our study focused on the analysis of eNOS regulatory pathways changes after chronic alcohol intake and analyzed their contribution to alcohol-induced hypersensitivity to LPS and to ET-1.

Back to Top | Article Outline

MATERIALs AND METHODS

Materials

All reverse transcriptase (RT)-PCR reagents were purchased from Invitrogen Corporation (Baltimore, MD). Mouse monoclonal antibodies for CAV-1, eNOS, and iNOS proteins as well as the ETB polyclonal rabbit antibody recognizing the C-terminal domain and the ETA polyclonal rabbit antibody recognizing the N-terminal domain of the protein were purchased from BD Transduction Laboratories (San Diego, CA). A polyclonal rabbit antibody that specifically recognizes the eNOS phosphorylation site (Serine 1177) was acquired from Signaling Technology (Beverly, MA). The β-actin (I-19) goat antibody from Santa Cruz Biotechnology (Santa Cruz, CA) was used as a housekeeping protein for all Western blot studies. The NO-sensitive dye, 4,5-diaminofluorescein (DAF 2) was purchased from Calbiochem (La Jolla, CA) and all other reagents used for the following experiments, including the [3H]L-arginine, were purchased from Sigma-Aldrich (St. Louis, MO) unless otherwise specified.

Back to Top | Article Outline

Chronic ethanol consumption: animal model

Male Sprague-Dawley rats (Charles River Laboratories, Wilmington, MA) were used for all experiments. Rats were housed in individual cages on a 12-h dark-light cycle. Experiments were performed in compliance with the University of North Carolina at Charlotte IACUC guidelines and in accordance with the National Institutes of Health criteria for the care and use of laboratory animals.

All animals were fed a Lieber-DeCarli liquid diet for 5 weeks (Dyets, Inc., Bethlehem, PA). The ethanol group rats received gradually increasing amounts of ethanol, reaching 36% of the total diet calories after 1 week. The amount of food given was increased according to the animals' consumption throughout the 5 weeks. The control groups received the same isocaloric liquid diet except that the ethanol was substituted with carbohydrates. All animals had free access to tap water. Food intake was monitored every day and body weight was taken twice a week. Twenty-four hours before the end of the diet, each experimental group was divided into two subgroups, and one-half of the rats received a sublethal (1 mg/kg) intraperitoneal (i.p.) LPS (Escherichia coli: serotype 026:B6; Sigma) injection. The other one-half received a saline injection. Therefore, animals received a control diet with a 24-h saline injection (control group [C], n = 5), a control diet and a 24-h LPS injection (control-LPS group [C-LPS], n = 6), an ethanol diet and the 24-h saline injection (ethanol group [E], n = 6), or an ethanol diet and a 24-h LPS injection (ethanol-LPS group [E-LPS], n = 6). To specifically examine the chronic effects of the alcohol diet but not the changes from the daily-induced alcoholemia, all animals received a control diet for the last 24 h of the experiment. At the end of the experiment, blood samples were taken for enzyme quantification; liver samples were fixed in formalin for histology or were snap-frozen in liquid nitrogen for protein and RNA studies.

Back to Top | Article Outline

Alanine aminotransferase (ALT) assays

Blood samples from all the rats were obtained from the inferior vena cava for determination of serum ALT, and plasma was obtained by centrifugation for 2 min at 5000 rpm. ALT measurements were made spectrophotometrically using an ALT diagnostic kit (Point Scientific, Lincoln Park, MI).

Back to Top | Article Outline

Histology and necrotic area evaluation

Whole liver tissue samples from each animal were harvested and immediately fixed in 10% buffered formalin. After dehydration and embedding in paraffin, 5- to 7-μm sections were stained with hematoxylin and eosin (H&E) or Trichrome and were analyzed by light microscopy at ×20 magnification. For necrotic area evaluation, five ×10 images were randomly selected from each animal, and the necrotic area was delineated. The necrotic surface area was quantified using Photoshop (Adobe Systems, San Jose, CA).

Back to Top | Article Outline

Immunohistochemistry

The standard avidin-biotin-peroxidase complex technique was used. Paraffin-embedded sections were deparaffinized, soaked in ethanol, and treated with 3% H2O2 to block endogenous peroxidases. Sections were blocked with blocking buffer (Roche Diagnostic Corporation, Indianapolis, IN) at room temperature, followed by incubation with the primary antibody against iNOS. Secondary biotinylated anti-mouse antibodies were then applied and reacted with streptavidin-biotinylated horseradish peroxidase complex (Dako Corp, Carpinteria, CA). The sections were finally stained with diaminobenzidine solution and counterstained with Mayer's hematoxylin. Proper negative controls were performed by replacing the primary antibody with nonrelevant antibody.

Back to Top | Article Outline

Western blotting analysis

Whole liver tissues were homogenized in lysis buffer (50 mM Tris-HCl, 0.1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 2% SDS, 1 mM EDTA, aprotinin, and protease inhibitor cocktail) as well as sodium vanadate to prevent protein dephosphorylation. Protein quantification of samples was performed using the Bradford assay (Bio-Rad Protein Assay; Bio-Rad Laboratories, Hercules, CA). After quantification, total protein (100 μg) samples were boiled for 5 min in Laemmli loading buffer and were separated by SDS-PAGE on a 10% acrylamide gel, and proteins were electroblotted onto nitrocellulose membranes. Membranes were stained with Ponceau S to confirm equal protein loading and transfer. Membranes were washed in Tris-buffered EDTA (TBE) with 0.1% Tween 20 (TBE-T), blocked in 1% blocking buffer (Roche Diagnostic Corporation) for 1 h, washed in TBE, and incubated overnight using primary antibodies against each specific protein at different dilutions in 0.5% blocking buffer. Membranes were then washed repeatedly in TBE-T and incubated for 1 h with a horseradish peroxidase-conjugated secondary antibody (Jackson ImmunoResearch, West Grove, PA). Membranes were then treated with enhanced chemiluminescence reagent (Roche Diagnostic Corporation) and exposed to Biomax film (Fisher Scientific, Pittsburgh, PA). Films were scanned and densitometric quantification of Western blot signal intensity was performed using a densitometric analysis program (Quantity One, Bio-Rad Laboratories). All signal intensities were normalized using β-actin.

Back to Top | Article Outline

RNA preparation and semiquantitative RT-PCR

Total RNA was isolated from frozen liver tissue (100 μg) using a one-step isolation method (RNA-STAT; TEL-TEST, Friendswood, TX). Final RNA was dissolved in deionized water, quantified, and stored at 80°C. RNA aliquots were run on a 1.5% agarose gel stained with ethidium bromide to check for RNA integrity, the presence of ribosomal RNA, and purity. Each RT reaction used 1 μg of RNA. A 1.5-μg cDNA sample was used in each PCR reaction. The following gene-specific primers were used (PreproET-1 sense, 5′TCTTCTCTCTGCTGTTTGTGGCTT3′; antisense, 5′TCTTTTACGCCTTTCTGCATGGTA3′ [407 bp] and GAPDH sense, 5′TCCCTCAAGATTGTCAGCAA3′; antisense, 5′AGATCCACAACGGATACATT3′ [309 bp]). Amplified products were resolved by electrophoresis in 1.5% agarose gel and stained with ethidium bromide. The level of each PCR product was semiquantitatively evaluated using a digital camera and densitometric analysis program (Bio-Rad Laboratories). All signal intensities were normalized over GAPDH.

Back to Top | Article Outline

NOS activity

The conversion of [3H]L-arginine to [3H]L-citrulline was used to assess NOS activity. Protein samples (100 μg) were incubated for 30 min at 37°C in a buffer containing 1 μCi/μL [3H]L-arginine, 1 mM NADPH, 0.1 μM calmodulin, and 30 μM tetrahydrobiopterin. Three reactions per sample were performed. CaCl2 (20 mM, + calcium reaction), 1 mM EDTA and 1 mM EGTA (− calcium reaction), and 10 mM L-NA (baseline activity) were added to reactions 1, 2, and 3, respectively. The reaction was terminated by adding 500 μL of stop buffer (20 mM Hepes, 2 mM EDTA, and 2 mM EGTA at pH 5.5). The tubes were kept on ice until aliquots were run through a glass column filled with 200 μg of equilibrated cation exchange chromatography resin (Dowex AG 50W-X8, 200-400 mesh sodium form; BioRad Laboratories). The columns were then washed with 1 mL of stop buffer to elute the samples. The flow-through was collected in glass vials, mixed with 6 mL of scintillation fluid (SX20-5 Scinti-safe Econo-1; Fisher Scientific), and the β emission was counted in a scintillation counter (scintillation counter; Beckman, Fullerton, CA).

Back to Top | Article Outline

NO quantification

NO production in liver homogenates was measured using the fluorescent dye DAF 2. Protein extracts (100 μg) were incubated on a 96-well plate in a buffer containing 1 mM NADPH, 0.1 μM calmodulin, and 30 μM tetrahydrobiopterin for 30 min at 37°C. [3H]L-arginine was substituted with nonradioactive L-arginine (5 mM) and 10 μM DAF 2, which converts into DAF 2-T when reacting with NO and emits a green fluorescence (emission/excitation 495/515). As described above, three reactions were conducted for each sample and terminated with the addition of stop buffer. Samples were counted once in a cytofluorometer (Perseptive Biosystems, Framingham, MA) to assess the intensity of the DAF 2 fluorescence.

Back to Top | Article Outline

Statistical analysis

Data are presented as mean ± SEM. Statistical analysis was performed using two-way analysis of variance with Student-Newman-Keuls post hoc test. P < 0.05 was considered significant. All statistical analysis was performed with Sigma-Stat software (SPSS, Chicago, IL).

Back to Top | Article Outline

RESULTS

In all the figures, four experimental groups were represented, depending on the chronic diet (5 weeks) and the subacute treatment (24 h): C, C-LPS, E, and E-LPS. Whereas chronic alcohol consumption and LPS treatment individually produced fairly consistent effects, combining these stresses was highly variable between animals and induced extensive steatosis and infiltration with or without extensive focal necrosis. Although all of our quantitative analysis considered it as one group, blots show representative samples with presence (fn+) or absence of focal necrosis (fn−), this emphasizes correlations observed between focal necrosis and the expression of some of the analyzed proteins.

Back to Top | Article Outline

Effect of chronic ethanol consumption and LPS on liver overall pathological condition

Figure 1A shows H&E-stained liver histological sections of the four experimental groups. No pathological change was seen in the control group (Fig. 1Aa). A mild pericentral infiltration was evidenced in the LPS group (Fig. 1Ab). Mixed micro- and macrovesicular steatosis scattered in the liver lobule was seen in the ethanol-fed group (Fig. 1Ac), confirming the mild fatty infiltration caused by the Lieber-DeCarli model compared with other models of chronic alcohol feeding reported. Furthermore, the 24-h LPS injection into ethanol-fed rats resulted in an exacerbation of the steatosis and extensive infiltration seen in the ethanol-fed rats (Fig. 1Ad) and panlobular extensive focal necrosis (Fig. 1Ae).

FIG. 1

FIG. 1

At the end of the 5-week diet, there was no significant difference in body weight between the experimental groups (data not shown). LPS treatment and, to a higher extent, chronic alcohol consumption alone increased the liver-to-body weight ratio (Fig. 1B). However, the combination of both stresses attenuated the effect of individual stresses, probably because of the necrotic destruction of liver tissue.

Liver injury was assessed by serum ALT levels. Individually, LPS and chronic ethanol consumption did not significantly increase ALT levels compared with the control diet. Combination of both stresses led to significant increase in serum ALT levels, which correlated with the presence of extensive necrosis covering up to 25% of some microscopic field taken at ×10 magnification (Fig. 1, C and D).

Back to Top | Article Outline

Effect of chronic ethanol consumption and LPS on eNOS activity

A radioactive NOS activity assay monitoring the conversion of [3H]L-arginine to [3H]L-citrulline was used to measure eNOS activity (calcium dependent) and iNOS activity (calcium independent). Chronic ethanol consumption and 24-h LPS treatment significantly decreased eNOS activity (Fig. 2A). Combining both stresses showed neither additive nor synergistic effects on eNOS activity. iNOS activity was increased in all the stress groups, with the highest activity measured in the chronic alcohol combined with LPS treatment (data not shown). Similar results were found after NO measurements using the fluorescent dye DAF 2. LPS injection and ethanol consumption significantly decreased NO production (Fig. 2B).

FIG. 2

FIG. 2

Back to Top | Article Outline

Effect of chronic ethanol consumption and LPS on preproET-1 and COX-2 expression

We investigated whether the increased vasoconstriction reported previously in vivo after chronic alcohol consumption is related to an increase in the expression of potent vasoconstrictive pathways. RT-PCR was used to assess preproET-1 mRNA level. PreproET-1 was increased in all experimental groups compared with the control group. Chronic ethanol consumption alone leads to significantly higher preproET-1 expression than LPS treatment alone. Combining both stresses synergistically increased preproET-1 expression, which reached its highest induction predominantly in the presence of focal necrosis (Fig. 3A). RT-PCR was also used to assess COX-2 mRNA expression. Chronic ethanol consumption, independent of the presence or absence of LPS treatment, led to the same level of COX-2 expression increase (Fig. 3B). The presence or absence of focal necrosis did not affect COX-2 expression.

FIG. 3

FIG. 3

Back to Top | Article Outline

Effect of chronic ethanol consumption and LPS on eNOS and iNOS protein expression

To explore the mechanisms leading to a decrease in eNOS activity, we examined eNOS protein expression. Western blot analysis shows that chronic alcohol consumption significantly decreased eNOS protein expression compared with the control diet alone (Fig. 4A), and LPS had no effect on eNOS proteins levels nor did it potentiate the effects of ethanol on eNOS. Western blot was also used to look for iNOS protein expression. Neither LPS nor ethanol affected iNOS protein, but interestingly, rats having extensive focal necrosis showed a substantial increase of this enzyme (10-fold increase), which correlated with iNOS activity (Fig. 4B). Immunostaining specific for iNOS was performed to localize its expression within the E-LPS group and was found to be localized predominantly in the focal necrotic areas (in Fig. 4C, arrowheads).

FIG. 4

FIG. 4

Back to Top | Article Outline

Effect of chronic ethanol consumption and LPS on ETA and ETB protein expression

The increase in preproET-1 expression in the liver after stress was associated with changes in proteins expression of ET-1 receptors ETA and ETB. ETB was significantly decreased in the ethanol-fed rats, independent of the LPS treatment. LPS alone did not affect ETB expression (Fig. 5A). Western blot analysis shows that ETA, which mediates the vasoconstrictive effects of ET-1, was increased in all experimental groups; no additive or synergistic effect was present (Fig. 5B).

FIG. 5

FIG. 5

Back to Top | Article Outline

Effect of chronic ethanol consumption and LPS on eNOS activity regulation

We examined two major eNOS regulation mechanisms: CAV-1, a potent eNOS inhibitor, and eNOS phosphorylation at serine 1177, an activation site. LPS treatment increased CAV-1 protein expression independent of the diet. Chronic alcohol consumption induced a further increase in CAV-1 protein expression, but with higher variability (Fig. 6A). Phosphorylation at serine 1177 was significantly decreased after chronic alcohol consumption, but not after LPS (Fig. 6B).

FIG. 6

FIG. 6

Back to Top | Article Outline

DISCUSSION

Liver microcirculation disruption is thought to contribute to early stages of liver disease. In the present study, the Lieber-DeCarli chronic alcohol feeding model was used to investigate the effects of a short-term alcohol diet on the liver microcirculation regulation pathways. Compared with other chronic alcohol feeding models, the Lieber-DeCarli alcohol diet induces a mild hepatic injury that mimics the early stages of human ALD (31).

The Lieber-DeCarli diet produces a subclinical injury that our laboratory and others have previously demonstrated to disrupt hepatic microvascular response and potentiate injury after hemorrhagic shock (4, 23) and after LPS treatment (21, 27). Alternative models are the intragastric feeding model described by Tsukamoto and French and various bolus models. The Tsukamoto-French model produces overt liver injury (fibrosis and cirrhosis), which is representative of a much smaller portion of the population than mild alcohol-dependent steatohepatitis (31). Thus, this model represents a much more relevant clinical issue. The bolus models can be good models for binge drinking, but our major interest is in the effect of fatty liver resulting from chronic alcohol consumption.

In our study, a 24-h sublethal LPS treatment was used to explore the priming effects of ethanol to subsequent endotoxemic stress. Individually, LPS and chronic ethanol feeding induced a mild level of liver injury (mild hepatitis and fatty liver, respectively). A combination of both stresses showed a synergistic effect and led to an extensive panlobular focal necrosis that was associated with significantly higher levels of serum ALT and induction of the proinflammatory NOS isoform: iNOS (32). These results demonstrated the alcohol-mediated sensitization of the liver to subsequent LPS treatment already reported (33).

Several studies have characterized the disruptive effects of chronic alcohol consumption on the liver microcirculation and have reported its sensitization to additional LPS treatment (21, 27). In the present study, we have investigated the molecular mechanisms responsible for chronic ethanol feeding-induced liver microcirculation disruption.

Hepatic microcirculation regulation is under the control of vasodilatory and vasoconstrictive forces. Severe alcohol feeding models cause hepatic stellate cell activation and their transformation into myofibroblasts, initiating collagen deposition and liver fibrosis (34). Although activated hepatic stellate cells have increased contractility, shifting the liver microvascular regulation toward excessive constriction, which is likely to contribute to the microcirculatory disruption that has been previously reported (23), depressed vasodilatory forces have been implicated in the hepatic microcirculation disruption seen under mild and severe stress conditions (22, 30). In this study, we have focused our analysis on changes in eNOS activity and regulation, which is a key vasodilatory pathway (22, 30). LPS, chronic ethanol consumption alone, and in combination led to a significant inhibition of eNOS activity. However, stress-mediated effects were not synergistic nor additive, suggesting that eNOS might be sensitive to the effects of mild stresses, consistent with the reported inhibition under remote trauma (22), and its activity cannot be further inhibited by sequential stresses. Although depressed eNOS activity correlated with decreased vasodilatory forces (35), the level of microcirculation disruption is dependent on the increased vasoconstrictive forces. ET-1 and COX-2 mRNA expression was increased after chronic alcohol consumption, but not after LPS treatment alone. Combining both stresses led to further synergistic induction, which would correspond with increased vasoconstrictive forces (26, 27). Induction of vasoconstrictive pathways associated with depressed vasodilatory pathways lead to microcirculation dysregulation, hypoxic stress, and hepatocellular injury.

LPS as well as chronic alcohol consumption sensitizes the liver microcirculation to the constrictive effects of ET-1 (18, 23). Decreased eNOS activity reported in this study is likely to contribute to ET-1 hypersensitivity through inhibition of ET-1-mediated vasodilatory effects. After alcohol consumption and subsequent LPS treatment, ET-1 expression was found to be increased, but did not correlate with increased eNOS activity, suggesting that ET-1-mediated eNOS activation was inhibited. We then investigated the mechanism leading to decreased eNOS basal and ET-1-mediated activation. eNOS protein levels were significantly decreased by ethanol, independent of the treatment with LPS that contributes to the decreased activity. This was consistent with studies showing a decrease in eNOS expression in CCL4-treated animals, and other models of cirrhosis (30, 36). We previously reported that after stress conditions such as LPS, ischemia/reperfusion, and cirrhosis, the ETB message is consistently increased (37-40). However, in this study, chronic ethanol consumption decreased ETB protein expression, which potentially contributes to the uncoupling of ET-1 from eNOS activation. Nevertheless, ETB mRNA expression was increased after chronic alcohol consumption with subsequent LPS treatment (data not shown). ETB protein expression is not only dependent on transcriptional activity, but can also be affected by the ETB endocytosis and recycling rate, which is related to ET-1 clearance (41). These results are consistent with other mild stress studies where the ETB message was increased but protein expression was decreased (22). This suggests that ETB protein expression could be increased and this effect might be blunted by the increased receptor turnover rate involved in clearing the high levels of ET-1 which results in lower detectable protein levels. ETA, the vasoconstriction-related ET isoform, protein expression was increased in all the stress groups similarly. Immunostaining for ETA showed a specific upregulation in the necrotic areas compared with the normal liver tissue, which suggests that ETA may be contributing to the injury through local sinusoidal shut down. However, further studies are needed to test if ETA is a cause or a consequence of the hepatic necrosis.

Recent in vitro studies in our laboratory have investigated the molecular mechanisms involved in stress-mediated inhibition of ET-1 induction of eNOS. These studies suggested that eNOS inhibition was achieved mainly through increased CAV-1 expression, eNOS phosphorylation disruption, and inhibition of eNOS translocation (42, 43). Chronic alcohol consumption and LPS treatment alone and in combination increased CAV-1 protein expression; however, there was no synergistic or additive effect. ET-1-mediated eNOS activation is dependent on eNOS phosphorylation at the serine 1177 residue (29). Chronic ethanol consumption significantly decreased eNOS pSer1177 phosphorylation levels, whereas LPS had no effects. Subsequent LPS treatment after chronic alcohol consumption partially recovered eNOS phosphorylation rates, which may be from the increased ET-1 levels seen under these conditions.

Disruption of eNOS activity appears to be related to different mechanisms depending on the stress: an increase in CAV-1 in LPS and a decrease in eNOS protein expression associated with an increase in CAV-1 in chronic ethanol consumption. eNOS phosphorylation at serine 1177 is further decreased in the ethanol group and may contribute to the inhibition of eNOS activity. Taken together, these results suggest that although LPS and chronic ethanol consumption lead to similar effects on eNOS activity, they likely exert their effects through different mechanisms. Our study investigated potential mechanisms involved in liver microcirculation disruption observed in vivo after chronic ethanol consumption and LPS treatment. These results suggest that eNOS regulation might play a major role in stress-mediated hepatic microcirculation disruption and liver injury. Further mechanistic studies are needed to dissect the specific contribution of each involved pathway.

Back to Top | Article Outline

REFERENCES

1. Johnson RD, Williams R: Genetic and environmental factors in the individual susceptibility to the development of alcoholic liver disease. Alcohol Alcohol 20:137-160, 1985.
2. De Torres M, Poynard T: Risk factors for liver fibrosis progression in patients with chronic hepatitis C. Ann Hepatol 2:5-11, 2003.
3. Balasubramanian S, Kowdley KV: Effect of alcohol on viral hepatitis and other forms of liver dysfunction. Clin Liver Dis 9:83-101, 2005.
4. Bauer I, Bauer M, Pannen BH, Leinwand MJ, Zhang JX, Clemens MG: Chronic ethanol consumption exacerbates liver injury following hemorrhagic shock: role of sinusoidal perfusion failure. Shock 4:324-331, 1995.
5. Zhong Z, Connor HD, Mason RP, Qu W, Gao W, Lemasters JJ, Thurman RG: Role of Kupffer cells in reperfusion injury in fat-loaded livers from ethanol-treated rats. J Pharmacol Exp Ther 275:1512-1517, 1995.
6. Enomoto N, Ikejima K, Bradford B, Rivera C, Kono H, Brenner DA, Thurman RG: Alcohol causes both tolerance and sensitization of rat Kupffer cells via mechanisms dependent on endotoxin. Gastroenterology 115:443-451, 1998.
7. Day CP, James OF: Steatohepatitis: a tale of two “hits”? Gastroenterology 114:842-845, 1998.
8. Tsukamoto H, Takei Y, McClain CJ, Joshi-Barve S, Hill D, Schmidt J, Deaciuc I, Barve S, Colell A, Garcia-Ruiz C, Kaplowitz N, Fernandez-Checa JC, Yokoyama H, Okamura Y, Nakamura Y, Ishii H, Chawla RK, Watson W, Nelson W, Lin M, Ohata M, Motomura K, Enomoto N, Ikejima K, Kitamura T, Oide H, Hirose M, Bradford BU, Rivera CA, Kono H, Peter S, Yamashina S, Konno A, Ishikawa M, Shimizu H, Sato N, Thurman R: How is the liver primed or sensitized for alcoholic liver disease? Alcohol Clin Exp Res 25:171S-181S, 2001.
9. Bjarnason I, Peters TJ, Wise RJ: The leaky gut of alcoholism: possible route of entry for toxic compounds. Lancet 1:179-182, 1984.
10. Nanji AA, Khettry U, Sadrzadeh SM, Yamanaka T: Severity of liver injury in experimental alcoholic liver disease. Correlation with plasma endotoxin, prostaglandin E2, leukotriene B4, and thromboxane B2. Am J Pathol 142:367-373, 1993.
11. Uesugi T, Froh M, Arteel GE, Bradford BU, Wheeler MD, Gabele E, Isayama F, Thurman RG: Role of lipopolysaccharide-binding protein in early alcohol-induced liver injury in mice. J Immunol 168:2963-2969, 2002.
12. Nanji AA, Khettry U, Sadrzadeh SM: Lactobacillus feeding reduces endotoxemia and severity of experimental alcoholic liver (disease). Proc Soc Exp Biol Med 205:243-247, 1994.
13. Enomoto N, Ikejima K, Bradford BU, Rivera C, Kono H, Goto M, Yamashina S, Schemmer P, Kitamura T, Oide H, Takei Y, Hirose M, Shimizu H, Miyazaki A, Brenner D, Sato N, Thurman R: Role of Kupffer cells and gut-derived endotoxins in alcoholic liver injury. J Gastroenterol Hepatol 15(Suppl):D20-D25, 2000.
14. Enomoto N, Ikejima K, Yamashina S, Hirose M, Shimizu H, Kitamura T, Takei Y, Sato N, Thurman RG: Kupffer cell sensitization by alcohol involves increased permeability to gut-derived endotoxin. Alcohol Clin Exp Res 25:51S-54S, 2001.
15. Mathurin P, Deng QG, Keshavarzian A, Choudhary S, Holmes EW, Tsukamoto H: Exacerbation of alcoholic liver injury by enteral endotoxin in rats. Hepatology 32:1008-1017, 2000.
16. Uesugi T, Froh M, Arteel GE, Bradford BU, Thurman RG: Toll-like receptor 4 is involved in the mechanism of early alcohol-induced liver injury in mice. Hepatology 34:101-108, 2001.
17. Yin M, Bradford BU, Wheeler MD, Uesugi T, Froh M, Goyert SM, Thurman RG: Reduced early alcohol-induced liver injury in CD14-deficient mice. J Immunol 166:4737-4742, 2001.
18. Baveja R, Yokoyama Y, Korneszczuk K, Zhang JX, Clemens MG: Endothelin 1 impairs oxygen delivery in livers from LPS-primed animals. Shock 17:383-388, 2002.
19. Eguchi H, Sato N, Minamiyama M, Matsumura T, Kawano S, Kamada T: Heterogeneous response in hepatic sinusoidal blood flow to acute ethanol ingestion in rats. Alcohol Alcohol (Suppl 1):519-521, 1987.
20. Fukui H, Sato N, Kawano S, Yoshihara H, Hijioka T, Eguchi H, Goto M, Matsunaga T, Kubota-Kashio S, Kamada T: Effect of ethanol on hepatic oxygenation: evidence of hepatic hypoxia. Adv Exp Med Biol 277:691-696, 1990.
21. Ohki E, Kato S, Horie Y, Mizukami T, Tamai H, Yokoyama H, Ito D, Fukuda M, Suzuki H, Kurose I, Ishii H: Chronic ethanol consumption enhances endotoxin-induced hepatic sinusoidal leukocyte adhesion. Alcohol Clin Exp Res 20:350A-355A, 1996.
22. Ashburn JH, Baveja R, Kresge N, Korneszczuk K, Keller S, Karaa A, Yokoyama Y, Zhang JX, Huynh T, Clemens MG: Remote trauma sensitizes hepatic microcirculation to endothelin via caveolin inhibition of eNOS activity. Shock 22:120-130, 2004.
23. Bauer M, Paquette NC, Zhang JX, Bauer I, Pannen BH, Kleeberger SR, Clemens MG: Chronic ethanol consumption increases hepatic sinusoidal contractile response to endothelin-1 in the rat. Hepatology 22:1565-1576, 1995.
24. Ohara N, Futagawa S, Watanabe S, Fukasawa M, Takamori S: Clinical investigation of endothelin-1 and nitric oxide in patients with portal hypertension focusing on plasma levels and immunohistological staining of liver tissues. Hepatol Res 21:40-54, 2001.
25. Pannen BH, Bauer M, Zhang JX, Robotham JL, Clemens MG: Endotoxin pretreatment enhances portal venous contractile response to endothelin-1. Am J Physiol Heart Circ Physiol 270:H7-H15, 1996.
26. Baveja R, Kresge N, Ashburn JH, Keller S, Yokoyama Y, Sonin N, Zhang JX, Huynh T, Clemens MG: Potentiated hepatic microcirculatory response to endothelin-1 during polymicrobial sepsis. Shock 18:415-422, 2002.
27. Horie Y, Kato S, Ohki E, Tamai H, Ishii H: Role of endothelin in endotoxin-induced hepatic microvascular dysfunction in rats fed chronically with ethanol. J Gastroenterol Hepatol 16:916-922, 2001.
28. Rockey DC, Weisiger RA: Endothelin-induced contractility of stellate cells from normal and cirrhotic rat liver: implications for regulation of portal pressure and resistance. Hepatology 24:233-240, 1996.
29. Liu S, Premont RT, Kontos CD, Huang J, Rockey DC: Endothelin-1 activates endothelial cell nitric-oxide synthase via heterotrimeric G-protein βγ subunit signaling to protein J kinase B/Akt. J Biol Chem 278:49929-49935, 2003.
30. Shah V, Cao S, Hendrickson H, Yao J, Katusic ZS: Regulation of hepatic eNOS by caveolin and calmodulin after bile duct ligation in rats. Am J Physiol Gastrointest Liver Physiol 280:G1209-G1216, 2001.
31. De la P, Hall M, Lieber CS, DeCarli LM, French SW, Lindros KO, Jarvelainen H, Bode C, Parlesak A, Bode JC: Models of alcoholic liver disease in rodents: a critical evaluation. Alcohol Clin Exp Res 25:245S-261S, 2001.
32. Vos TA, Gouw AS, Klok PA, Havinga R, van Goor H, Huitema S, Roelofsen H, Kuipers F, Jansen PL, Moshage H: Differential effects of nitric oxide synthase inhibitors on endotoxin-induced liver damage in rats. Gastroenterology 113:1323-1333, 1997.
33. Hill DB, D'Souza NB, Lee EY, Burikhanov R, Deaciuc IV, de Villiers WJ: A role for interleukin-10 in alcohol-induced liver sensitization to bacterial lipopolysaccharide. Alcohol Clin Exp Res 26:74-82, 2002.
34. Friedman SL: Stellate cell activation in alcoholic fibrosis: an overview. Alcohol Clin Exp Res 23:904-910, 1999.
35. Paxian M, Keller SA, Baveja R, Korneszczuk K, Huynh TT, Clemens MG: Functional link between ETB receptors and eNOS maintain tissue oxygenation in the normal liver. Microcirculation 11:435-449, 2004.
36. Shah V, Toruner M, Haddad F, Cadelina G, Papapetropoulos A, Choo K, Sessa WC, Groszmann RJ: Impaired endothelial nitric oxide synthase activity associated with enhanced caveolin binding in experimental cirrhosis in the rat. Gastroenterology 117:1222-1228, 1999.
37. Yokoyama Y, Baveja R, Sonin N, Nakanishi K, Zhang JX, Clemens MG: Altered endothelin receptor subtype expression in hepatic injury after ischemia/reperfusion. Shock 13:72-78, 2000.
38. Sonin NV, Garcia-Pagan JC, Nakanishi K, Zhang JX, Clemens MG: Patterns of vasoregulatory gene expression in the liver response to ischemia/reperfusion and endotoxemia. Shock 11:175-179, 1999.
39. Yokoyama Y, Baveja R, Kresge N, Sonin N, Nakanishi K, Zhang JX, Gitzelmann CA, Clemens MG: Endothelin receptor remodeling induces the portal venous hyper-response to endothelin-1 following endotoxin pretreatment. Shock 17:36-40, 2002.
40. Yokomori H, Oda M, Yasogawa Y, Nishi Y, Ogi M, Takahashi M, Ishii H: Enhanced expression of endothelin B receptor at protein and gene levels in human cirrhotic liver. Am J Pathol 159:1353-1362, 2001.
41. Dupuis J, Goresky CA, Fournier A: Pulmonary clearance of circulating endothelin-1 in dogs in vivo: exclusive role of ETB receptors. J Appl Physiol 81:1510-1515, 1996.
42. Karaa A, Kamoun W, Clemens M: Oxidative stress disrupts nitric oxide synthase activation in liver endothelial cells. Free Radical Biol Med 2005.
43. Merkel S, Kamoun W, Karaa A, Korneszczuk K, Schrum L, Clemens M: LPS inhibits endothelin-1-mediated eNOS translocation to the cell membrane in sinusoidal endothelial cells. Microcirculation 12:433-442, 2005.
Keywords:

Chronic alcohol; LPS; eNOS; focal necrosis; endothelin-1

©2005The Shock Society