Secondary Logo

Share this article on:

No association between FOXP2 rs10447760 and schizophrenia in a replication study of the Chinese Han population

Yin, Jiajuna,*; Jia, Ningrenc,*; Liu, Yansongd; Jin, Chunhuia; Zhang, Fuquana,b; Yu, Shuia; Wang, Juna,b; Yuan, Jianmina

doi: 10.1097/YPG.0000000000000193
ORIGINAL ARTICLES

Background Schizophrenia (SCZ) is a severe and heritable psychiatric disorder, and previous studies have shown that regulation of the forkhead-box P2 gene (FOXP2) may play a role in schizophrenia. Moreover, just a few studies have identified a single nucleotide polymorphism (SNP) rs10447760 within the gene that was a risk variant for SCZ in the Chinese Han population.

Methods To examine whether the variant in the FOXP2 gene contributes toward SCZ susceptibility, we carried out an association analysis of the SNP rs10447760 of the FOXP2 gene in a case–control study (1405 cases, 1137 controls) from China.

Results We identified no association of rs10447760 in the FOXP2 gene with SCZ (all P>0.05). In addition, a meta-analysis indicated that the SNP rs10447760 was not associated with susceptibility to SCZ in Han Chinese populations (pooled odds ratio=1.44, 95% confidence interval: 0.63–3.31, P=0.39).

Conclusion Thus, our results did not support the association between FOXP2 rs10447760 and schizophrenia in a Chinese Han population, and large-scale genetic replication studies with different racial and geographic origins are required in the future.

aBrain Science Basic Laboratory

bDepartment of Psychiatry, Wuxi Mental Health Center, Nanjing Medial University, Wuxi

cDepartment of Clinical Laboratory, Jiangsu Province Traditional Chinese Medicine Hospital, Nanjing

dDepartment of Clinical Psychology, Suzhou Psychiatric Hospital, The Affiliated Guangji Hospital of Soochow University, Suzhou, Jiangsu Province, People’s Republic of China

*Jiajun Yin and Ningren Jia contributed equally to the writing of this article.

Correspondence to Jianmin Yuan, BS, Wuxi Mental Health Center, Nanjing Medial University, 156 Qianrong Road, Wuxi 214151, Jiangsu Province, People’s Republic of China Tel: +86 510 832 50132; fax: +86 510 830 12201; e-mail: 13358118723@163.com

This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial-No Derivatives License 4.0 (CCBY-NC-ND), where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal. http://creativecommons.org/licenses/by-nc-nd/4.0/

Received August 1, 2017

Received in revised form December 7, 2017

Accepted December 26, 2017

Back to Top | Article Outline

Introduction

Schizophrenia (SCZ) is a severe and heritable psychiatric disorder that is characterized by positive and negative symptoms, and it affects almost 1% of the general population worldwide (Thaker and Carpenter, 2001). Although the heritability rate for SCZ has been estimated to be 64–81%, the environmental factor is considered another pathogenic factor (Sullivan et al., 2003 ; Lichtenstein et al., 2009). Despite the high prevalence of SCZ and many decades of research, the precise etiology and genetic mechanism of this illness are still unknown.

The Forkhead-box P2 (FOXP2) gene is located on chromosome 7q31, and it encodes a transcription factor. The first evidence that FOXP2 carried a heterozygous missense mutation was based on the investigation of a large three-generation pedigree (the KE family), in which approximately half of the individuals had a severe speech and language disorder (Fisher et al., 1998 ; Lai et al., 2001). FOXP2 was proven to directly affect Childhood Apraxia of Speech; however, several reports have identified that there are potential genes that are regulated by FOXP2 in other communication disorders (Spiteri et al., 2007 ; Vernes et al., 2007, 2011 ; Konopka et al., 2009). As many studies have reported, brain tissues show broad expression of the FOXP2 transcript (Ferland et al., 2003 ; Lai et al., 2003 ; Takahashi et al., 2003). In the cerebellar neural circuit, Foxp2 expression was crucial for synaptic plasticity in Foxp2 (R552H) knockin mice (Groszer et al., 2008). Foxp2 knockout mice showed a reduced size of the cerebellum and poor dendritic arbors of these neurons, which impaired motor function and the ability to communicate (Shu et al., 2005 ; Fujita et al., 2008).

There are some evidences for FOXP2 interacting with schizophrenia-related genes. FOXP2 directly suppressed the transcription of the DISC1 gene; however, two FOXP2 mutations decreased the inhibition of DISC1 expression (Walker et al., 2012). A balanced t(1;11) translocation disrupted the DISC1 gene in a Scottish family, which showed a significant linkage for SCZ (Blackwood et al., 2001). In addition, several studies have confirmed the role of DISC1 in psychiatric disorders (Brandon and Sawa, 2011 ; Porteous et al., 2011). DISC1 can has been implicated in GSK3β/β-catenin signaling pathways, which create alterations in early neurodevelopment and synaptic regulation (Mao et al., 2009). Furthermore, FOXP2 produced regulation in the transcript levels of the CNTNAP2 gene (Zhao et al., 2015). The phenotypes associated with CNTNAP2 mutations were usually complex and associated with autism, SCZ, intellectual disability, seizures, and language regression (Rodenas-Cuadrado et al., 2014). In both human patients and mouse models, CNTNAP2 played an important role in regulating neuronal development (Penagarikano et al., 2011). Thus, FOXP2 may promote neurodevelopment by regulating DISC1, CNTNAP2, and other downstream targets.

Language and communication are commonly considered the two core signs of normally developed human beings. In addition, deficits in language and speech are important features of many psychiatric disorders, and the specific language circuits have been found to be affected early in psychiatric disorders such as SCZ (Li et al., 2009). Thus, FOXP2 can be considered a good candidate gene for an indicator of mental diseases. The FOXP2 polymorphism related to SCZ has been identified in many studies. For example, Sanjuán et al. (2006) identified a significant associated single nucleotide polymorphism (SNP) rs2396753 and a haplotype with SCZ patients with auditory hallucinations. Furthermore, they found a significant association between FOXP2 rs2253478 and SCZ patients (Tolosa et al., 2010). Gong et al. (2004) found a significant association between autistic disorder and FOXP2 rs1456031. Taken together, these findings suggest that FOXP2 gene polymorphisms may play an important role in the pathogenesis of SCZ.

A study of FOXP2 rs10447760 has been carried out previously by Li et al. (2013) in the Chinese Han population. They focused on the relationship between the gene FOXP2 and SCZ in 1135 schizophrenic patients and 1135 normal controls. They found statistically significant differences in allele frequencies (P=0.00069, 0.00838 after Bonferroni correction) at rs10447760 (Li et al., 2013). Subsequently, the most recent study failed to find differences in the genotype and allele frequencies between the chronic SCZ patients and healthy controls, but they found significant differences in the Positive and Negative Syndrome Scale total, positive symptom score, and general psychopathology (Rao et al., 2017). However, these findings have produced both negative and positive results in the previous studies. Therefore, in our study, to evaluate the association of FOXP2 rs10447760 with SCZ, we replicated the case–control study in an independent Han Chinese population from Jiangsu province.

Back to Top | Article Outline

Participants and methods

Participants

The ethnicity of all participants was Han Chinese. The patients with SCZ were recruited from the Wuxi Mental Health Center and diagnosed according to the Diagnostic and Statistical Manual of Mental Disorders, 4th ed. (DSM-IV). Healthy controls without a current or a previous psychiatric diagnosis or a family history of mental illness were recruited from the general population by advertisements. Before enrollment, signed informed consent was obtained from every participant or their guardians if the participant was a minor or could not provide consent. The study protocols were performed according to the principles of the Declaration of Helsinki. This study was approved by the Ethics Committees of the Wuxi Mental Health Center.

The study sample included 1405 patients with SCZ (875 men and 530 women; mean age=45.93 years at recruitment, SD=11.45) and 1137 matched unrelated healthy controls (630 men and 507 women; mean age=44.91 years at recruitment, SD=10.30), drawn from a population of individuals of Han descent (Table 1).

Table 1

Table 1

Back to Top | Article Outline

DNA extraction and SNP genotyping

Blood samples were collected from all participants using K2EDTA tubes and DNA was extracted from whole blood using a blood genotyping DNA extraction kit (Tiangen Biotech, Beijing, China). DNA samples were stored at−80°C until genotype analysis, in which we used the ligase detection reaction–PCR method (Yi et al., 2009 ; Yuan et al., 2015) from Shanghai Biowing Applied Biotechnology Co. Ltd. (http://www.biowing.com.cn).

Genomic DNA extracted from the clinical samples was first subjected to multiplex PCR to obtain a PCR product including rs10447760. The PCR primers were 5′-AACACTGCAGGCTTTGTTCG-3′ (forward) and 5′-TTTGGAGTCAGCTAGCACAG-3′ (reverse). This PCR product and the LDR probes (CGGCTGCTGCTGGAACTGGCCG for ‘C’ allele detection; TCGGCTGCTGCTGGAACTGGCCA for ‘T’ allele detection) were then subjected to a multiplex LDR reaction, with a DNA sequencer used to detect the products.

Back to Top | Article Outline

Statistical and bioinformatics analysis

The online software platform SHEsis (http://analysis.bio-x.cn/myAnalysis.php) was used to carry out all statistical analyses (Shi and He, 2005), including association studies, Hardy–Weinberg equilibrium (HWE) tests, and the calculation of genotype and allele frequencies between patients with SCZ and healthy controls. A logistic regression adjusted for age and sex was applied to evaluate how these factors influence the distribution of the SNP rs10447760. Power calculations to determine the appropriate sample size were carried out using PS software (http://biostat.mc.vanderbilt.edu/wiki/Main/PowerSampleSize) (Dupont and Plummer, 1990, 1998). All of the P values less than 0.05 were used as the threshold of statistical significance. Odds ratio (OR) and 95% confidence intervals (95% CI) were determined to assess the influence of any difference in heterogeneity. Meta-analysis was carried out using the Review Manager 5.3 (The Nordic Cochrane Centre for The Cochrane Collaboration, Copenhagen, Denmark) and STATA 12.0 (Stata Corp., College Station, Texas, USA). The significance of the pooled ORs was determined using a Z-test. Between-study heterogeneity was assessed by the Q-test and I 2-statistic; P less than 0.10 and I 2 greater than 50% indicated evidence of heterogeneity (Higgins and Thompson, 2002). A random-effect model or a fixed-effect model was chosen to calculate the subtotal OR and 95% CI on the basis of whether there was a significant difference in heterogeneity among these studies.

Back to Top | Article Outline

Results

In this study, we analyzed the data from 1405 patients with SCZ and 1137 unrelated healthy controls. The total genotyping rate in all individuals was 100%. HWE tests indicated that the genotype and allele frequency distribution of FOXP2 rs10447760 did not deviate significantly from HWE (P=0.970 for cases; P=0.961 for controls) (Table 2). In addition, the power calculation using the OR (Ψ = 0.377) from previous study (published by Li et al., 2013) determined whether our sample size was enough under well-recognized genetic effect threshold. The power of the present study for the SNP was estimated to be ∼80% using PS software (assumption condition: α=0.05, P 0=0.01, n=2810, m=0.809, Ψ=0.377).

Table 2

Table 2

Our results of the association study suggested that the minor allele T of SNP rs10447760 within FOXP2 was not associated significantly with SCZ risk (P=0.387, OR=0.772, 95% CI: 0.429–1.389) in a Han Chinese sample (Table 2). In addition, logistic regression models adjusted for age and sex failed to support any positive association between SCZ and the SNP rs10447760 (Table 3). For the meta-analysis, we combined and analyzed data from three independent studies, including the current study. Random-effects models were adopted as significant heterogeneity was present in the current meta-analysis (P=0.01, I 2=77%). The statistical results suggested that the SNP rs10447760 in FOXP2 might not be a risk locus for susceptibility to SCZ in Han Chinese populations using a random-effect model (pooled OR=1.44, 95% CI: 0.63–3.31, P=0.39) (Fig. 1).

Table 3

Table 3

Fig. 1

Fig. 1

Back to Top | Article Outline

Discussion

Many current reports have indicated that a prime candidate, FOXP2, is likely related to human language development (Fisher et al., 1998 ; Lai et al., 2001 ; Enard et al., 2002, 2009 ; Macdermot et al., 2005 ; Vernes et al., 2006, 2008). Language and communication are often disordered in patients with SCZ and some other mental diseases. Thus, FOXP2 can be considered a good candidate gene for an indicator of mental diseases.

In the previous studies, these findings showed an association between rs10447760 within the FOXP2 gene and SCZ, with conflicting results. It was first reported by Sanjuán et al. (2006) that a haplotype of FOXP2, which contained rs10447760, significantly correlated with SCZ by a permutation test (P=0.009). In addition, rs10447760 was also shown to have a significant correlation with SCZ in the study by Li et al. (2013) (allelic P=0.000698, and P=0.00838 after correction). However, Rao et al. (2017) failed to find significant differences in the genotype and allele frequencies between the chronic SCZ patients and healthy controls, but they found significant differences between the PANSS positive symptom score and general psychopathology (both P<0.05). Therefore, we repeated this experiment to confirm whether this SNP was associated with SCZ in the Han Chinese population. As a result, there was no statistically significant correlation between FOXP2 rs10447760 and SCZ in our study. Meanwhile, statistical results from the meta-analysis also indicated no significant correlation in the studies. Our results are consistent with the study by Rao et al. (2017) in the Han Chinese population.

The finding in this study may be the result of several limitations. One of the main limitations of our current study was that the participants were all recruited from Jiangsu province, whereas samples obtained from the study by Sanjuán et al. (2006) were drawn from Europe, Li et al. (2013) from Shanghai, and Rao et al. (2017) from Beijing. In the study by Sanjuán et al. (2006), all individuals were Whites of Spanish descent, and the frequency of the variant allele T at rs10447760 among the controls was 0.2406, which was much higher than that of Li et al. (2013) , Rao et al. (2017), and this study (0.007, 0.006, and 0.01, respectively). Therefore, the differences in the rs10447760 polymorphism profiles suggested that the individuals from differently racial and geographic aspects might also show genetic heterogeneity of SCZ. Meanwhile, statistical results from the meta-analysis also indicated a significant heterogeneity between the studies, and different genotyping methodologies may affect the rare allele frequency, thereby causing the heterogeneity. In addition, sampling errors caused by differences in clinical diagnosis of SCZ cannot entirely be excluded.

Other limitations of our report should be considered. First, the most recent study showed that rs10447760 may be associated with clinical symptoms of SCZ (Rao et al., 2017). Because of insufficient clinical information, we could not assess the influence of these factors on the interaction between rs10447760 and SCZ. Second, our results may be influenced by the low statistical power and limited sample size because the allele T at rs10447760 is a rare variant. Third, other SNPs within the FOXP2 gene were not analyzed, and the likelihood of their modification on SCZ could not be ruled out. Fourth, the particular SNP rs10447760 is a rare variant in the study, and the P values of rare variants can be easily disturbed by a slight inaccuracy genotyping or other random factors.

Back to Top | Article Outline

Conclusion

In our study, no statistically significant association between FOXP2 rs10447760 and SCZ was discovered in a Chinese Han population, and consistent results were obtained compared with the most recent research. However, in this study, we failed to identify the potential risk within FOXP2 because we studied only the SNP rs10447760 in FOXP2 gene that could not fully elucidate the mechanism of the FOXP2 gene behind its influence on SCZ. Thus, other SNPs within the FOXP2 gene and large-scale genetic replication studies with different racial and geographic origins are needed in the future.

Back to Top | Article Outline

Acknowledgements

The authors thank the SCZ patients and healthy participants for their cooperation in the study. This work was supported by the National Natural Science Foundation of China (81471364).

Authors’ contributions: Conceived and designed the experiments: J.Y., N.J., J.Y. Performed the experiments: J.Y., N.J., Y.L., S.Y. Analyzed the data: J.Y., N.J., C.J. F.Z. Contributed reagents/materials/analysis tools: S.Y. J.W. Wrote the paper: J.Y. N.J. J.Y. All the authors read and approved the final manuscript.

Back to Top | Article Outline

Conflicts of interest

There are no conflicts of interest.

Back to Top | Article Outline

References

Blackwood DH, Fordyce A, Walker MT St, Clair DM, Porteous DJ, Muir WJ (2001). Schizophrenia and affective disorders – cosegregation with a translocation at chromosome 1q42 that directly disrupts brain-expressed genes: clinical and P300 findings in a family. Am J Hum Genet 69:428–433.
Brandon NJ, Sawa A (2011). Linking neurodevelopmental and synaptic theories of mental illness through DISC1. Nat Rev Neurosci 12:707–722.
Dupont WD, Plummer WD (1990). Power and sample size calculations. a review and computer program. Control Clin Trials 11:116–128.
Dupont WD, Plummer WD (1998). Power and sample size calculations for studies involving linear regression. Control Clin Trials 19:589–601.
Enard W, Przeworski M, Fisher SE, Lai CS, Wiebe V, Kitano T, et al (2002). Molecular evolution of FOXP2, a gene involved in speech and language. Nature 418:869–872.
Enard W, Gehre S, Hammerschmidt K, Holter SM, Blass T, Somel M, et al (2009). A humanized version of Foxp2 affects cortico-basal ganglia circuits in mice. Cell 137:961–971.
Ferland RJ, Cherry TJ, Preware PO, Morrisey EE, Walsh CA (2003). Characterization of Foxp2 and Foxp1 mRNA and protein in the developing and mature brain. J Comp Neurol 460:266–279.
Fisher SE, Vargha-Khadem F, Watkins KE, Monaco AP, Pembrey ME (1998). Localisation of a gene implicated in a severe speech and language disorder. Nat Genet 18:168–170.
Fujita E, Tanabe Y, Shiota A, Ueda M, Suwa K, Momoi MY, et al (2008). Ultrasonic vocalization impairment of Foxp2 (R552H) knockin mice related to speech-language disorder and abnormality of Purkinje cells. Proc Natl Acad Sci USA 105:3117–3122.
Gong X, Jia M, Ruan Y, Shuang M, Liu J, Wu S, et al (2004). Association between the FOXP2 gene and autistic disorder in Chinese population. Am J Med Genet B Neuropsychiatr Genet 127B:113–116.
Groszer M, Keays DA, Deacon RM, De Bono JP, Prasad-Mulcare S, Gaub S, et al (2008). Impaired synaptic plasticity and motor learning in mice with a point mutation implicated in human speech deficits. Curr Biol 18:354–362.
Higgins JP, Thompson SG (2002). Quantifying heterogeneity in a meta-analysis. Stat Med 21:1539–1558.
Konopka G, Bomar JM, Winden K, Coppola G, Jonsson ZO, Gao F, et al (2009). Human-specific transcriptional regulation of CNS development genes by FOXP2. Nature 462:213–217.
Lai CS, Fisher SE, Hurst JA, Vargha-Khadem F, Monaco AP (2001). A forkhead-domain gene is mutated in a severe speech and language disorder. Nature 413:519–523.
Lai CS, Gerrelli D, Monaco AP, Fisher SE, Copp AJ (2003). FOXP2 expression during brain development coincides with adult sites of pathology in a severe speech and language disorder. Brain 126:2455–2462.
Li X, Branch CA, Delisi LE (2009). Language pathway abnormalities in schizophrenia: a review of fMRI and other imaging studies. Curr Opin Psychiatry 22:131–139.
Li T, Zeng Z, Zhao Q, Wang T, Huang K, Li J, et al (2013). FoxP2 is significantly associated with schizophrenia and major depression in the Chinese Han population. World J Biol Psychiatry 14:146–150.
Lichtenstein P, Yip BH, Björk C, Pawitan Y, Cannon TD, Sullivan PF, et al (2009). Common genetic determinants of schizophrenia and bipolar disorder in Swedish families: a population-based study. Lancet 373:234–239.
Macdermot KD, Bonora E, Sykes N, Coupe AM, Lai CS, Vernes SC, et al (2005). Identification of FOXP2 truncation as a novel cause of developmental speech and language deficits. Am J Hum Genet 76:1074–1080.
Mao Y, Ge X, Frank CL, Madison JM, Koehler AN, Doud MK, et al (2009). Disrupted in schizophrenia 1 regulates neuronal progenitor proliferation via modulation of GSK3beta/beta-catenin signaling. Cell 136:1017–1031.
Penagarikano O, Abrahams BS, Herman EI, Winden KD, Gdalyahu A, Dong H, et al (2011). Absence of CNTNAP2 leads to epilepsy, neuronal migration abnormalities, and core autism-related deficits. Cell 147:235–246.
Porteous DJ, Millar JK, Brandon NJ, Sawa A (2011). DISC1 at 10: connecting psychiatric genetics and neuroscience. Trends Mol Med 17:699–706.
Rao W, Du X, Zhang Y, Yu Q, Hui L, Yu Y, et al (2017). Association between forkhead-box P2 gene polymorphism and clinical symptoms in chronic schizophrenia in a Chinese population. J Neural Transm 124:891–897.
Rodenas-Cuadrado P, Ho J, Vernes SC (2014). Shining a light on CNTNAP2: complex functions to complex disorders. Eur J Hum Genet 22:171–178.
Sanjuán J, Tolosa A, González JC, Aguilar EJ, Pérez-Tur J, Nájera C, et al (2006). Association between FOXP2 polymorphisms and schizophrenia with auditory hallucinations. Psychiatr Genet 16:67–72.
Shi YY, He L (2005). SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Res 15:97–98.
Shu W, Cho JY, Jiang Y, Zhang M, Weisz D, Elder GA, et al (2005). Altered ultrasonic vocalization in mice with a disruption in the Foxp2 gene. Proc Natl Acad Sci USA 102:9643–9648.
Spiteri E, Konopka G, Coppola G, Bomar J, Oldham M, Ou J, et al (2007). Identification of the transcriptional targets of FOXP2, a gene linked to speech and language, in developing human brain. Am J Hum Genet 81:1144–1157.
Sullivan PF, Kendler KS, Neale MC (2003). Schizophrenia as a complex trait: evidence from a meta-analysis of twin studies. Arch Gen Psychiatry 60:1187–1192.
Takahashi K, Liu FC, Hirokawa K, Takahashi H (2003). Expression of Foxp2, a gene involved in speech and language, in the developing and adult striatum. J Neurosci Res 73:61–72.
Thaker GK, Carpenter WT (2001). Advances in schizophrenia. Nat Med 7:667–671.
Tolosa A, Sanjuán J, Dagnall AM, Molto MD, Herrero N, Frutos RD (2010). FOXP2 gene and language impairment in schizophrenia: association and epigenetic studies. BMC Med Genet 11:114.
Vernes SC, Nicod J, Elahi FM, Coventry JA, Kenny N, Coupe AM, et al (2006). Functional genetic analysis of mutations implicated in a human speech and language disorder. Hum Mol Genet 15:3154–3167.
Vernes SC, Spiteri E, Nicod J, Groszer M, Taylor JM, Davies KE, et al (2007). High-throughput analysis of promoter occupancy reveals direct neural targets of FOXP2, a gene mutated in speech and language disorders. Am J Hum Genet 81:1232–1250.
Vernes SC, Newbury DF, Abrahams BS, Winchester L, Nicod J, Groszer M, et al (2008). A functional genetic link between distinct developmental language disorders. N Engl J Med 359:2337–2345.
Vernes SC, Oliver PL, Spiteri E, Lockstone HE, Puliyadi R, Taylor JM, et al (2011). Foxp2 regulates gene networks implicated in neurite outgrowth in the developing brain. PLoS Genet 7:e1002145.
Walker RM, Hill AE, Newman AC, Hamilton G, Torrance HS, Anderson SM, et al (2012). The DISC1 promoter: characterization and regulation by FOXP2. Hum Mol Genet 21:2862–2872.
Yi P, Chen Z, Zhao Y, Guo J, Fu H, Zhou Y, et al (2009). PCR/LDR/capillary electrophoresis for detection of single-nucleotide differences between fetal and maternal DNA in maternal plasma. Prenat Diagn 29:217–222.
Yuan J, Cheng Z, Zhang F, Zhou Z, Yu S, Jin C (2015). Lack of association between microRNA-137 SNP rs1625579 and schizophrenia in a replication study of Han Chinese. Mol Genet Genomics 290:297–301.
Zhao Y, Liu X, Sun H, Wang Y, Yang W, Ma H (2015). Contactin-associated protein-like 2 expression in SHSY5Y cells is upregulated by a FOXP2 mutant with a shortened polyglutamine tract. Mol Med Rep 12:8162–8168.
Keywords:

FOXP2; rs10447760; schizophrenia

Copyright © 2018 Wolters Kluwer Health, Inc. All rights reserved.