Journal Logo

Experimental

The Effect of Omega-3 Fatty Acids on Capsular Tissue around the Breast Implants

Lombardo, Giuseppe A. G. M.D., Ph.D.; Tamburino, Serena M.D.; Magano, Katia Ph.D.; Fagone, Paolo; Mammana, Santa Ph.D.; Cavalli, Eugenio Ph.D.; Basile, Maria S. Ph; Salvatorelli, Lucia M.D., Ph.D.; Catalano, Francesca M.D.; Magro, Gaetano M.D.; Nicoletti, Ferdinando M.D.

Author Information
Plastic and Reconstructive Surgery: March 2020 - Volume 145 - Issue 3 - p 701-710
doi: 10.1097/PRS.0000000000006553
  • Free
  • Watch Video
  • Editor's Pick
  • Press Release

Abstract

In 2013, more than 360,000 women in the United States alone underwent breast implant placement for augmentation mammaplasty or heterologous reconstruction.1 One of the most common complications of the use of foreign material, in both reconstructive and cosmetic breast surgery, which often leads to re-intervention, is capsular contracture. It consists of pathological hardening of the fibrous shell developing around a prosthesis.2–5 The development of connective tissue around any foreign body is physiological, but progression into a thick and firm capsule is responsible for varying degrees of local inflammation, dislocation, and deformation of the prosthesis.

One of the mechanisms apparently affecting most capsular formation is the direct immuno stimulation through silicone particles and, indirectly, through biofilm formation.6,7 Both pathways induce and maintain chronic inflammation, which in turn provokes fibroblast proliferation.

Nowadays, the only sufficient treatment to overcome capsular contracture is surgical revision with dissection of the capsule and silicone implant removal, followed by several reconstruction options, such as implant replacement, mastopexy with autoaugmentation, replacement with a saline implant, fat transfer, or eventually conversion to autologous breast reconstruction.8–10

Historically, research on capsular contracture has focused mainly on reducing bacterial contamination through antibiotic solutions, identifying the principle pathogenic cause of subclinical infection.7,11–24 Only secondary studies have focused on pharmacological control of the inflammation process. Several colleagues tried to irrigate the implant pocket using steroids25 and, successively, a liposome-delivered prednisolone, which resulted in a reduction in capsular contracture.26 Considering the main inflammation pathway, the arachidonic acid cascade, a leukotriene antagonist (zafirlukast) was used for the first time in 2002 in contracted breasts, leading to a decrease in fibrosis,27 and these findings were further supported.28,29 An important role in the arachidonic acid cascade is also played by the omega-3 fatty acids. The omega-3 polyunsaturated fatty acids, eicosapentaenoic acid and docosahexaenoic acid, are found mainly in oily fish and food supplements. Such products are now becoming hugely popular, given their health benefits.30 Increased consumption of marine omega-3 polyunsaturated fatty acids results in their dose-dependent incorporation into cell phospholipids, thus replacing arachidonic acid. This leads to a decreased amount of substrate available for synthesis of the classic proinflammatory eicosanoids. Accordingly, an increased intake of omega-3 polyunsaturated fatty acid in animals and human beings has been reported to decrease production of a large range of proinflammatory eicosanoids.31,32 Moreover, if on the one hand the anti-inflammatory action of omega-3 fatty acids is nowadays widely known, their action on the fibrosis process is as yet based on new evidence, mainly discovered by studying the cardiac remodeling following a heart attack33 (Fig. 1).

Fig. 1.
Fig. 1.:
Metabolic pathways involve reactions catalyzed by conversion through cyclooxygenase-1 (COX-1), cyclooxygenase-2 (COX-2), and lipoxygenases to eicosanoids, which include prostaglandins, thromboxanes, and leukotrienes in different cell types. Arachidonic acid (AA) is the precursor of the prostanoids of the 2 series [prostaglandin synthase (PGs) 2 and thromboxane A2 (TXA 2)], whereas eicosapentaenoic acid (EPA) is the precursor of prostanoids of the 3 series [PGs3 and thromboxane A3 (TXA 3)]. In leukocytes and monocytes, arachidonic acid and eicosapentaenoic acid are substrates of 5-lipoxygenase (5-LOX) for the synthesis of leukotrienes. Leukotrienes derived from arachidonic acid (LTS 4) have potent chemotactic and leukocyte-activating properties and vasoconstrictive effects, and they increase vascular permeability. Through 5-lipoxygenase, eicosapentaenoic acid gives rise to leukotrienes of the 5 series (LTS 5), which have weaker proinflammatory and vasoconstrictive activities. Different pro-resolving mediators derived from omega-3 polyunsaturated fatty acid, such as resolvins and protectins, apply their anti-inflammatory effects in a stereospecific manner thanks to their distinct chemical structures. Eicosapentaenoic acid and docosahexaenoic acid (DHA) directly reduced fibrosis by inhibiting TGF-β–induced smad2/3 and smad 4 nuclear translocation.

To our knowledge, no study in the literature has examined the effect of dietary supplementation with omega-3 fatty acids on the fibrosis forming around silicone breast implants. Thus, the goal of the present study was to investigate the effects of omega-3 supplements on capsular tissue, by evaluating thickness, vascular density, and transforming growth factor (TGF)-β expression on samples of capsules collected in a living rat model.

MATERIALS AND METHODS

Animal Care and Surgery

Thirty-two female C57BL/6 mice were obtained from Harlan Laboratories (San Pietro al Natisone, Udine, Italy) and acclimated for 1 week before the study at the animal house of the Department of Biomedical Sciences, University of Catania (Catania, Italy). The study was approved by the local institutional ethics committee and was performed in agreement with Italian Legislative Decree 26/2014 regarding the protection of animals used for experimental or other scientific purposes. Animals were kept in temperature- and light-controlled rooms, at a constant temperature of ~24°C and in a 12-hr light/dark cycle. The animals were fed standard animal pellets and tap water ad libitum. Mice were operated on at 8 weeks of age and subsequently housed in a one-animal cage following implant surgery. Mice were divided into two groups (n = 16 per group). The treated group received omega-3 oil daily by gavage (EnerZona Omega 3 RX; Enervit Italia, Milan, Italy) 300 mg/kg (0.002 g of eicosapentaenoic acid + 0.001 g of docosahexaenoic acid) at 200 µl volume. The control group received 200 µl of water daily by gavage. On day 0, mice were implanted with custom-made 300-mg silicone gel implants (Mentor Corp., Santa Barbara, Calif.) (Fig. 2).

Fig. 2.
Fig. 2.:
Custom-made, 300-mg, round smooth silicone gel implants (Mentor Corp., Santa Barbara, Calif.).

Mice were anesthetized using tribromoethanol (400 mg/kg), and Altadol (5 mg/kg; Formevet, Milan, Italy) was used as analgesic for the surgical procedure. The surgical site was then shaved and prepared with an iodine solution. A 2-cm transverse incision was made on the dorsal aspect of the mouse at the level of the sacral spine. A tunnel was then dissected above the rib cage, and the prosthesis were placed in a pocket beneath both the skin and the thin panniculus carnosus muscle-fascial layer. The incision was then closed with interrupted sutures using 6-0 nylon (Ethicon, Inc., Somerville, N.J.).74

After 12 weeks, mice were euthanized using carbon dioxide inhalation. The implants and surrounding fibrous tissue were harvested in one piece (Fig. 3).

Fig. 3.
Fig. 3.:
Implants with the surrounding fibrous tissue (capsule) were harvested in one piece.

Histologic Analysis

Capsular tissue was harvested on postoperative day 84 and fixed in 10% neutral buffered formalin for 36 hours. Fixed tissues were dehydrated in a gradient of alcohols and embedded in paraffin blocks. Serial, longitudinal, 3-µm, paraffin-embedded sections were prepared and stained with hematoxylin and eosin. Two independent authors (L.S. and G.A.G.L.) measured capsule thickness by using the Aperio ScanScope SC digital slide scanner (Aperio Technologies, Vista, Calif.). Each author performed five measurements per specimen, and the value resulting from the mean of the 10 measurements was recorded as the capsule thickness of reference for that specimen. Both authors were blinded to the samples’ treatment.

Real-Time Polymerase Chain Reaction Analysis

The excised capsule tissue, approximately 25 mg, was stored in an Invitrogen RNAlater (Thermo Fisher Scientific, Carlsbad, Calif.) at 4°C until needed for further processing. Total RNA was extracted using the RNeasy Mini Kit (Quiagen, Hilden, Germany) according to the manufacturer’s protocol, and a real-time polymerase chain reaction analysis was carried out according to Livak and Schmittgen.34

Briefly, 2 μg of total RNA were retrotranscribed and the cDNA was used to determine TGF-β2 and COL1A2 expression by real-time reverse transcriptase polymerase chain reaction using the FastStart SYBR Green Master (Roche, Monza, Italy). Primer sequences were designed in-house or obtained from the PrimerBank database (http://pga.mgh.harvard.edu/primerbank/). The following primers were used:

  • TGF-β2 forward: TCGACATGGATCAGTTTATGCG;
  • TGF-β2 reverse: CCCTGGTACTGTTGTAGATGGA;
  • COL2A1 forward: GGTGAGCCTGGTCAAACGG;
  • COL2A1 reverse: ACTGTGTCCTTTCACGCCTTT;
  • β-actin forward: CATCATGAAGTGTGACGTTGAC;
  • β-actin reverse: GCATCCTGTCAGCAATGCC.

Gene expression was calculated using the formula 2−ΔCt, where ΔCt = (Ct,target gene − Ctbeta-actin).

Statistical Analysis

Differences between controls and omega-3–treated samples were analyzed using the unpaired two-tailed Student t test, with p < 0.05 being considered statistically significant.

RESULTS

Histologic Analysis

No signs of infection of the surrounding capsular tissue were detected. Capsules in the omega-3 group were thinner than those found in the control group.

The average capsular thickness was 205.09 μm in the omega-3 group, compared with 361.63 μm in the control group. This difference was statistically significant (p = 0.0004) (Figs. 4 through 6).

Fig. 4.
Fig. 4.:
Histological view of capsular thickness. A representative histological section of capsular tissue in the control group. Sections were stained with hematoxylin and eosin. Capsule thickness was measured with the Aperio ScanScope SC digital slide scanner (Aperio Technologies).
Fig. 5.
Fig. 5.:
Histological view of capsular thickness. A representative histological section of capsular tissue in the treated group. Sections were stained with hematoxylin and eosin. The capsular thickness of the omega-3 group was inferior to that of the control group. Capsule thickness was measured with the Aperio ScanScope SC digital slide scanner (Aperio Technologies).
Fig. 6.
Fig. 6.:
The average capsular thickness was 205.09 μm in the omega-3 group, compared with 361.63 μm in the control group. This difference was statistically significant (p = 0.0004).

Real-Time Polymerase Chain Reaction Analysis Evaluation

Expression levels of TGF-β2 and COL1A2 were evaluated by real-time polymerase chain reaction in the collected capsules. A significant downregulation of the TGF-β2 gene transcript was observed in the omega-3–treated group compared with the vehicle control group (p = 0.048). We also evaluated the expression of COL1A2, which encodes for the pro-a2(I) chain, a component of type 1 collagen and a well-known component of implant-associated capsules, including breast implants.35–39 Along the same lines as TGF-β2, COL1A2 gene expression was significantly lower (p = 0.039) in the omega-3–treated mice when compared with the vehicle-treated animals (Fig. 7).

Fig. 7.
Fig. 7.:
The real-time polymerase chain reaction analysis evaluation allowed investigation of TGF-β2 and COL1A2 gene expression in capsules among the studied groups. TGF-β2 expression in the control group was higher than that in the omega-3 group (p = 0.048), as was COL1A2 gene expression (p = 0.039). On the basis of these observations, omega-3 significantly decreased TGF-β2 and COL1A2 expression in the treated group.

DISCUSSION

Capsular contracture occurs in response to breast implants and it is one of the most common causes of reoperation following implantation.40–42 A certain amount of connective tissue physiologically develops around any foreign body, but its progression into a thick and firm capsule is responsible for local inflammation, dislocation, and implant deformation. This inevitably affects the efforts of the surgeon, who attempts to achieve both aesthetically pleasing and good functional results.43

Several hypotheses have been postulated to explain capsule formation, although no definitive evidence has been found. The current understanding of capsular contracture can be viewed as a balance of multiple related factors that affect periprosthetic inflammation, which are defined as potentiators and suppressors.44

Historically, authors correctly guessed that one of the causes of capsular contracture was a continuous and excessive inflammation around the prosthesis and therefore turned to corticosteroid therapy and irrigation.25,45 This procedure was later shown to be quite useless in managing long-term complications and was abandoned.46,47

Subsequently, Burkhardt et al.13 defined the first theories about the correlation between capsular contracture and bacteria contamination, which developed a few years after introduction of the concept of subclinical infection. Detection of this type of infection may be difficult, since bacteria adhere to the silicone implant and are protected by a biofilm, and thus may not be readily accessible to antibiotics.48,49

Capsular contracture’s prevention is historically based on two essential points: (1) decreasing bacterial contamination during implant insertion and (2) reducing inflammation. Many authors have proposed treatments to reduce bacterial contamination such as use of the Tegaderm nipple shield (3M, Two Harbors, Minn.),50 breast pocket irrigation with antibiotics,35,51,52 and prophylactic intravenous antibiotics.53,54 Although these treatments showed quite good efficacy against immature biofilms and soft-tissue infection, they had limited results against mature biofilm. Besides, due to the rise of antibiotic resistance, additional studies and approaches are needed.55,56

It appears clear that inflammation reduction around the prosthesis remains a major concern.57–60 This is especially true in patients who underwent breast reconstruction after cancer treatment, when one considers that systemic therapy with steroids or other anti-inflammatory drugs is forbidden in oncological cases.

Moreira et al.26 showed how a local depot of liposomal prednisolone was effective in decreasing fibrous capsule thickness around textured silicone breast implants. In addition, leuko triene inhibitors were used in an attempt to reduce inflammation.61 Several studies reported specific leukotriene receptor antagonists, such as zafirlukast and montelukast, as a possible option for capsular contracture prevention and/or treatment through the alteration of the inflammatory cascade.43,62,63 Both zafirlukast and montelukast appear to effectively reverse capsular contracture in a time-related manner. Nevertheless, they seem to increase the risk of hepatitis liver failure64,65; thus, the off-label use of these medications is not recommended.44

Many authors have proposed several therapies to achieve a decrease in inflammation but they have not found a definitive and unique evidence-based therapy to follow. The beneficial effects of omega-3 polyunsaturated fatty acids, mainly eicosapentaenoic acid and docosahexaenoic acid, have been well-known since the 1960s, when epidemiological evidence highlighted how populations with a diet particularly rich in omega-3 polyunsaturated fatty acid reported a lower incidence of myocardial infarction.66

The role of omega-3 polyunsaturated fatty acids in inflammation reduction could be relevant at several steps in the inflammatory pathway. Indeed, they have been shown to decrease the plasmatic levels of leukotrienes, proinflammatory prostaglandins, interleukin, and tumor necrosis factor-α. On the other hand, they increase anti-inflammatory prostaglandins and molecules such as resolvins and protectins66 (Fig. 1).

Different pro-resolving mediators derived from omega-3 polyunsaturated fatty acid, such as resolvins, protectins, and maresins, apply their anti-inflammatory effects in a stereospecific manner thanks to their distinct chemical structures.67 In the literature, authors usually refer to these mediators with the term “specialized pro-resolving mediators.” Particularly, the main role of resolvin E is to switch off leukocyte migration to the inflamed site, to promote the clearance of inflammatory cells and debris, and to suppress cytokine production, thereby leading to resolution of acute inflammation.67

In contrast with these findings, some authors reported an increased synthesis of proinflammatory eicosanoids derived from arachidonic acid, such as prostaglandins, thromboxanes, leukotrienes, hydroxy fatty acids, and lipoxins, and a decreased synthesis of anti-inflammatory eicosanoids from eicosapentaenoic acid and docosahexaenoic acid, following high intake of dietary omega-6 polyunsaturated fatty acids.68 Nevertheless, additional studies on animal models accurately described these phenomena, reporting an increased expression of genes involved in lipid metabolism, proteins, and obesity-linked pro-inflammatory cytokines related to a low ratio of omega-3 to omega-6 polyunsaturated fatty acids.69,70 According to all these findings, omega-3 polyunsaturated fatty acids may have both anti-inflammatory and antifibrotic properties.

How can omega -3 reduce the fibrosis around the prosthesis? As mentioned, numerous studies, mostly of myocardial infarction, have shown several pathways implied in polyunsaturated fatty acid’s prevention of arachidonic acid conversion into proinflammatory eicosanoids, acting as an alternative substrate for cyclooxygenase or lipoxygenase or decreasing the fibrosis process through several cascades.71

As Adams postulated, inflammation is the final pathway prior to capsular contracture. So, chronic inflammation apparently finally leads to fibrosis. If, on the one hand, the anti-inflammatory action of omega-3 fatty acids is nowadays widely known, their action on the fibrosis process is as yet based on new evidence discovered mainly by studying cardiac remodeling following a heart attack. Indeed, omega-3 polyunsaturated fatty acids suppress cardiac fibroblast proliferation, transformation, and collagen production, thus leading to inhibition of the cardiac fibrotic response and prevention of cardiac dysfunction progression.33

In a recent study, Kim et al.36 demonstrated that botulinum toxin type A suppresses TGF-β1 signaling, thus inhibiting the synthesis of collagen types 1 and 3 and activating matrix metalloproteinases. This finally leads to prevention of capsule formation around silicone implants. Consequently, the authors supposed that botulinum toxin type A could help in reducing capsular formation and that TGF-β1 signaling is an important target of capsule formation induced by silicone implants.36

When considering the deposition of collagen and fibrosis that occurs during foreign body response, TGF-β definitely plays a relevant role in this process.72 Shah et al.73 demonstrated that suppression of TGF-β expression led to a reduction in hypertrophic scars and keloids. According to our results, TGF-β2 levels were significantly reduced in the area surrounding the prosthesis in the treated group. This decrease reflected a lower incidence of capsular formation. Therefore, targeting the TGF-β pathway might be effective for controlling collagen synthesis and capsular formation.

In our findings, the COL1-A2 level in the capsule was significantly lower. On the other hand, it could be interesting to analyze in future studies the overall cellularity through immunohistochemical analysis, in order to investigate the balance between acellular and cellular components within the capsule in treated and nontreated groups. Furthermore, the capsule showed minor thickness in the treated group, with a mean thickness of 205.09 μm, compared with the control group, in which capsule thickness measured on average 361.63 μm (statistically significant difference, p = 0.0004).

In the present study, we attempted to demonstrate the efficiency of omega-3 nutritional supplements in preventing the occurrence of capsular contracture. To increase the clinical relevance of this work, we used a miniaturized version of the prosthesis that was specifically designed following the current protocol for breast augmentation and breast reconstruction. Results were evaluated at 12 weeks after surgery, according to previous experimental studies that have shown how capsules around breast implants are typically evident within 4 to 6 weeks after implantation.36

CONCLUSIONS

This study’s results suggest that omega-3 supplementation seems to be effective in reducing the occurrence of capsular formation. The main role of omega-3 fatty acids in inflammation and fibrosis reduction around implants is explained by their inhibition of the TGF-β pathway and thus impairment of collagen deposition.

We believe that omega-3 supplementation is a simple and promising method that could be used to prevent or at least reduce capsular contracture after silicone implant surgery. This therapy could have a significant impact considering the number of patients every year who undergo breast reconstruction or aesthetic mammaplasty. Furthermore, omega-3 fatty acid is a dietary supplement with minimal side effects that is normally used worldwide for multiple purposes. Nevertheless, the omega-3 dose fed to the mice was 300 mg/kg, which would be quite a dose when translated into dosages for patient consumption. Moreover, we still do not know if this treatment would provide long-term benefit, so further clinical studies are warranted to examine their therapeutic applicability. Additional studies should be conducted to support our findings concerning the decrease in capsular contracture occurrence.

ACKNOWLEDGMENT

The implants used for this study were kindly donated by the Mentor Corporation.

REFERENCES

1. Segreto F, Carotti S, Tosi D, et al. Toll-like receptor 4 expression in human breast implant capsules: Localization and correlation with estrogen receptors. Plast Reconstr Surg. 2016;137:792–798.
2. Escudero FJ, Guarch R, Lozano JA. [Tissue reaction to breast prostheses: Periprosthetic capsular contracture]. An Sist Sanit Navar. 2005;28(Suppl 2):41–53.
3. McCoy BJ, Person P, Cohen IK. Collagen production and types in fibrous capsules around breast implants. Plast Reconstr Surg. 1984;73:924–927.
4. Handel N, Cordray T, Gutierrez J, Jensen JA. A long-term study of outcomes, complications, and patient satisfaction with breast implants. Plast Reconstr Surg. 2006;117:757–767; discussion 768.
5. Araco A, Caruso R, Araco F, Overton J, Gravante G. Capsular contractures: A systematic review. Plast Reconstr Surg. 2009;124:1808–1819.
6. Wilflingseder P, Hoinkes G, Mikuz G. Tissue reactions from silicone implant in augmentation mammaplasties. Minerva Chir. 1983;38:877–880.
7. Tamboto H, Vickery K, Deva AK. Subclinical (biofilm) infection causes capsular contracture in a porcine model following augmentation mammaplasty. Plast Reconstr Surg. 2010;126:835–842.
8. Collis N, Sharpe DT. Recurrence of subglandular breast implant capsular contracture: Anterior versus total capsulectomy. Plast Reconstr Surg. 2000;106:792–797.
9. Gurunluoglu R, Sacak B, Arton J. Outcomes analysis of patients undergoing autoaugmentation after breast implant removal. Plast Reconstr Surg. 2013;132:304–315.
10. Young VL. Guidelines and indications for breast implant capsulectomy. Plast Reconstr Surg. 1998;102:884–891; discussion 892.
11. Bartsich S, Ascherman JA, Whittier S, Yao CA, Rohde C. The breast: A clean-contaminated surgical site. Aesthet Surg J. 2011;31:802–806.
12. Thornton JW, Argenta LC, McClatchey KD, Marks MW. Studies on the endogenous flora of the human breast. Ann Plast Surg. 1988;20:39–42.
13. Burkhardt BR, Fried M, Schnur PL, Tofield JJ. Capsules, infection, and intraluminal antibiotics. Plast Reconstr Surg. 1981;68:43–49.
14. Deva AK, Adams WP Jr, Vickery K. The role of bacterial biofilms in device-associated infection. Plast Reconstr Surg. 2013;132:1319–1328.
15. Mah TF, O’Toole GA. Mechanisms of biofilm resistance to antimicrobial agents. Trends Microbiol. 2001;9:34–39.
16. Mah TF, Pitts B, Pellock B, Walker GC, Stewart PS, O’Toole GA. A genetic basis for Pseudomonas aeruginosa biofilm antibiotic resistance. Nature 2003;426:306–310.
17. Borriello G, Werner E, Roe F, Kim AM, Ehrlich GD, Stewart PS. Oxygen limitation contributes to antibiotic tolerance of Pseudomonas aeruginosa in biofilms. Antimicrob Agents Chemother. 2004;48:2659–2664.
18. Fux CA, Costerton JW, Stewart PS, Stoodley P. Survival strategies of infectious biofilms. Trends Microbiol. 2005;13:34–40.
19. Fux CA, Wilson S, Stoodley P. Detachment characteristics and oxacillin resistance of Staphyloccocus aureus biofilm emboli in an in vitro catheter infection model. J Bacteriol. 2004;186:4486–4491.
20. Deva AK, Chang IC. Bacterial biofilms: A cause for accelerated capsular contracture? Aesthet Surg J. 1999;19:130–133.
21. Leid JG, Shirtliff ME, Costerton JW, Stoodley P. Human leukocytes adhere to, penetrate, and respond to Staphylococcus aureus biofilms. Infect Immun. 2002;70:6339–6345.
22. Jesaitis AJ, Franklin MJ, Berglund D, et al. Compromised host defense on Pseudomonas aeruginosa biofilms: Characterization of neutrophil and biofilm interactions. J Immunol. 2003;171:4329–4339.
23. Pajkos A, Deva AK, Vickery K, Cope C, Chang L, Cossart YE. Detection of subclinical infection in significant breast implant capsules. Plast Reconstr Surg. 2003;111:1605–1611.
24. Netscher DT. Subclinical infection as a possible cause of significant breast capsules. Plast Reconstr Surg. 2004;113:2229–2230; author reply 2230.
25. Peterson HD, Burt GB Jr.. The role of steroids in prevention of circumferential capsular scarring in augmentation mammaplasty. Plast Reconstr Surg. 1974;54:28–30.
26. Moreira M, Fagundes DJ, de Jesus Simões M, Taha MO, Perez LM, Bazotte RB. The effect of liposome-delivered prednisolone on collagen density, myofibroblasts, and fibrous capsule thickness around silicone breast implants in rats. Wound Repair Regen. 2010;18:417–425.
27. Schlesinger SL, Ellenbogen R, Desvigne MN, Svehlak S, Heck R. Zafirlukast (Accolate): A new treatment of a difficult problem. Aesth Surg J. 2002;22:329–336.
28. Spano A, Palmieri B, Taidelli TP, Nava MB. Reduction of capsular thickness around silicone breast implants by zafirlukast in rats. Eur Surg Res. 2008;41:8–14.
29. Bastos EM, Sabino Neto M, Garcia EB, et al. Effect of zafirlukast on capsular contracture around silicone implants in rats. Acta Cir Bras. 2012;27:1–6.
30. Saravanan P, Davidson NC, Schmidt EB, Calder PC. Cardiovascular effects of marine omega-3 fatty acids. Lancet 2010;376:540–550.
31. Rees D, Miles EA, Banerjee T, et al. Dose-related effects of eicosapentaenoic acid on innate immune function in healthy humans: A comparison of young and older men. Am J Clin Nutr. 2006;83:331–342.
32. Calder PC. Polyunsaturated fatty acids and inflammatory processes: New twists in an old tale. Biochimie 2009;91:791–795.
33. Chen P, Véricel E, Lagarde M, Guichardant M. Poxytrins, a class of oxygenated products from polyunsaturated fatty acids, potently inhibit blood platelet aggregation. FASEB J. 2011;25:382–388.
34. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001;25:402–408.
35. Bae HS, Son HY, Lee JP, Chang H, Park JU. The role of periostin in capsule formation on silicone implants. Biomed Res Int. 2018;2018:3167037.
36. Kim S, Ahn M, Piao Y, et al. Effect of botulinum toxin type A on TGF-β/Smad pathway signaling: Implications for silicone-induced capsule formation. Plast Reconstr Surg. 2016;138:821e–829e.
37. Lipa JE, Qiu W, Huang N, Alman BA, Pang CY. Pathogenesis of radiation-induced capsular contracture in tissue expander and implant breast reconstruction. Plast Reconstr Surg. 2010;125:437–445.
38. Zeplin PH, Larena-Avellaneda A, Schmidt K. Surface modification of silicone breast implants by binding the antifibrotic drug halofuginone reduces capsular fibrosis. Plast Reconstr Surg. 2010;126:266–274.
39. Silva EN, Ribas-Filho JM, Czeczko NG, et al. Histological evaluation of capsules formed by silicon implants coated with polyurethane foam and with a textured surface in rats. Acta Cir Bras. 2016;31:774–782.
40. Adams WP Jr, Rios JL, Smith SJ. Enhancing patient outcomes in aesthetic and reconstructive breast surgery using triple antibiotic breast irrigation: Six-year prospective clinical study. Plast Reconstr Surg. 2006;117:30–36.
41. Spear SL, Low M, Ducic I. Revision augmentation mastopexy: Indications, operations, and outcomes. Ann Plast Surg. 2003;51:540–546.
42. McLaughlin JK, Lipworth L, Murphy DK, Walker PS. The safety of silicone gel-filled breast implants: A review of the epidemiologic evidence. Ann Plast Surg. 2007;59:569–580.
43. Marangi GF, Langella M, Gherardi G, et al. Microbiological evaluation of tissue expanders in patients who had first stage breast reconstruction. J Plast Surg Hand Surg. 2010;44:199–203.
44. Adams WP Jr.. Capsular contracture: What is it? What causes it? How can it be prevented and managed? Clin Plast Surg. 2009;36:119–126, vii.
45. Perrin ER. The use of soluble steroids within inflatable breast prostheses. Plast Reconstr Surg. 1976;57:163–166.
46. Price RI. Failure of steroid instillation to prevent capsular contracture after augmentation mammaplasty (Letter). Plast Reconstr Surg. 1976;57:371.
47. Cohen IK, Carrico TJ. Capsular contracture and steroid-related complications in augmentation mammaplasty. Aesthetic Plast Surg. 1980;4:267–272.
48. Parsons CL, Stein PC, Dobke MK, Virden CP, Frank DH. Diagnosis and therapy of subclinically infected prostheses. Surg Gynecol Obstet. 1993;177:504–506.
49. Persichetti P, Giovanni Lombardo GA, Marangi GF, Gherardi G, Dicuonzo G. Capsular contracture and genetic profile of ica genes among Staphylococcus epidermidis isolates from subclinical periprosthetic infections. Plast Reconstr Surg. 2011;127:1747–1748; author reply 1748.
50. Wixtrom RN, Stutman RL, Burke RM, Mahoney AK, Codner MA. Risk of breast implant bacterial contamination from endogenous breast flora, prevention with nipple shields, and implications for biofilm formation. Aesthet Surg J. 2012;32:956–963.
51. Adams WP Jr, Conner WC, Barton FE Jr, Rohrich RJ. Optimizing breast pocket irrigation: An in vitro study and clinical implications. Plast Reconstr Surg. 2000;105:334–338; discussion 339.
52. Adams WP Jr, Conner WC, Barton FE Jr, Rohrich RJ. Optimizing breast-pocket irrigation: The post-betadine era. Plast Reconstr Surg. 2001;107:1596–1601.
53. Arad E, Navon-Venezia S, Gur E, et al. Novel rat model of methicillin-resistant Staphylococcus aureus-infected silicone breast implants: A study of biofilm pathogenesis. Plast Reconstr Surg. 2013;131:205–214.
54. Gylbert L, Asplund O, Berggren A, Jurell G, Ransjö U, Ostrup L. Preoperative antibiotics and capsular contracture in augmentation mammaplasty. Plast Reconstr Surg. 1990;86:260–267; discussion 268.
55. Chen M, Yu Q, Sun H. Novel strategies for the prevention and treatment of biofilm related infections. Int J Mol Sci. 2013;14:18488–18501.
56. van Heerden J, Turner M, Hoffmann D, Moolman J. Antimicrobial coating agents: Can biofilm formation on a breast implant be prevented? J Plast Reconstr Aesthet Surg. 2009;62:610–617.
57. Harmon KA, Lane BA, Boone RE, et al. therapeutic engineered hydrogel coatings attenuate the foreign body response in submuscular implants. Ann Plast Surg. 2018;80(6S Suppl 6):S410–S417.
58. DiEgidio P, Friedman HI, Gourdie RG, Riley AE, Yost MJ, Goodwin RL. Biomedical implant capsule formation: Lessons learned and the road ahead. Ann Plast Surg. 2014;73:451–460.
59. Soder BL, Propst JT, Brooks TM, et al. The connexin43 carboxyl-terminal peptide ACT1 modulates the biological response to silicone implants. Plast Reconstr Surg. 2009;123:1440–1451.
60. Friedman HI, Giurgiutiu V, Bender J, Crachiolo G, Yost MJ. A biomechanical and morphologic analysis of capsule formation around implanted piezoelectric wafer active sensors in rats treated with cyclooxygenase-2 inhibition. Ann Plast Surg. 2008;60:198–203.
61. Reid RR, Greve SD, Casas LA. The effect of zafirlukast (Accolate) on early capsular contracture in the primary augmentation patient: A pilot study. Aesthet Surg J. 2005;25:26–30.
62. Scuderi N, Mazzocchi M, Fioramonti P, Bistoni G. The effects of zafirlukast on capsular contracture: Preliminary report. Aesthetic Plast Surg. 2006;30:513–520.
63. Huang CK, Handel N. Effects of Singulair (montelukast) treatment for capsular contracture. Aesthet Surg J. 2010;30:404–408.
64. Gryskiewicz JM. Investigation of Accolate and Singulair for treatment of capsular contracture yields safety concerns. Aesthet Surg J. 2003;23:98–101.
65. Riccioni G, Bucciarelli T, Mancini B, Di Ilio C, D’Orazio N. Antileukotriene drugs: Clinical application, effectiveness and safety. Curr Med Chem. 2007;14:1966–1977.
66. Mozaffarian D, Wu JH. Omega-3 fatty acids and cardiovascular disease: Effects on risk factors, molecular pathways, and clinical events. J Am Coll Cardiol. 2011;58:2047–2067.
67. Serhan CN, Chiang N, Dalli J, Levy BD. Lipid mediators in the resolution of inflammation. Cold Spring Harb Perspect Biol. 2014;7:a016311.
68. Simopoulos AP. The importance of the omega-6/omega-3 fatty acid ratio in cardiovascular disease and other chronic diseases. Exp Biol Med (Maywood). 2008;233:674–688.
69. Duan Y, Li F, Li L, Fan J, Sun X, Yin Y. n-6:n-3 PUFA ratio is involved in regulating lipid metabolism and inflammation in pigs. Br J Nutr. 2014;111:445–451.
70. Heerwagen MJ, Stewart MS, de la Houssaye BA, Janssen RC, Friedman JE. Transgenic increase in N-3/n-6 fatty acid ratio reduces maternal obesity-associated inflammation and limits adverse developmental programming in mice. PLoS One 2013;8:e67791.
71. Endo Y, Blinova K, Romantseva T, Golding H, Zaitseva M. Differences in PGE2 production between primary human monocytes and differentiated macrophages: Role of IL-1β and TRIF/IRF3. PLoS One 2014;9:e98517.
72. Kondo S, Kagami S, Kido H, Strutz F, Müller GA, Kuroda Y. Role of mast cell tryptase in renal interstitial fibrosis. J Am Soc Nephrol. 2001;12:1668–1676.
73. Shah M, Foreman DM, Ferguson MW. Neutralising antibody to TGF-beta 1,2 reduces cutaneous scarring in adult rodents. J Cell Sci. 1994;107(Pt 5):1137–1157.
74. Katzel EB, Koltz PF, Tierney R, et al. A novel animal model for studying silicone gel-related capsular contracture. Plast Reconstr Surg. 2010;126:1483–1491.
Copyright © 2020 by the American Society of Plastic Surgeons