Secondary Logo

Lack of Pertussis Protective Antibodies in Healthcare Providers Taking Care of Neonates and Infants in a Children’s Hospital

Ma, Hsuan-Yin MD; Pan, Sung-Ching MD; Wang, Jann-Tay MD; Liu, Ying-Chieh BS; Chang, Luan-Yin MD, PhD; Shao, Pei-Lan MD; Hsieh, Wu-Shiun MD; Lu, Chun-Yi MD, PhD; Huang, Li-Min MD, PhD

The Pediatric Infectious Disease Journal: April 2017 - Volume 36 - Issue 4 - p 433–435
doi: 10.1097/INF.0000000000001462
Brief Reports
Free

Contact tracing and seroepidemiologic studies were done after a premature baby contracted pertussis in a children’s hospital. No infection source was confirmed. Four (3.5%) healthcare providers were positive for anti-pertussis IgM, while only 23% (26/113) were positive for IgG in a following survey. Pertussis vaccination for healthcare providers is needed.

From the *Department of Pediatrics, National Taiwan University Children’s Hospital, Taipei, Taiwan; and Department of Internal Medicine and Center for Infections Control, National Taiwan University Hospital, Taipei, Taiwan.

Accepted for publication September 26, 2016.

The study was funded by the Center for Infections Control of the National Taiwan University Hospital.

The authors have no conflicts of interest to disclose.

Address for correspondence: Chun-Yi Lu, MD, PhD, Department of Pediatrics, National Taiwan University Children’s Hospital, 8 Chung-Shan S Road, Taipei, Taiwan. E-mail: cylu@ntu.edu.tw

Pertussis, caused by Bordetella pertussis, is highly contagious. Most hospitalizations and deaths are reported in young infants.1 Although universal immunization programs for children had been introduced since the late 1940s, significant resurgences of pertussis, especially in adults and adolescents, have been noted.2 Young infants often contract pertussis from infected parents, household members or healthcare providers lacking typical symptoms.1

We present an investigation in neonatal and infant care units after identification of a premature infant who contracted pertussis in the hospital. We tried to trace the infectious source and clarify the immunologic status among the healthcare workers.

Back to Top | Article Outline

INDEX CASE

A premature girl (birth weight 640 g and gestational age 24 weeks and 5 days) was admitted after birth to the neonatal intensive care unit receiving standard prematurity care for 6 months. Within 24 hours after discharge, she developed fever, tachypnea, chest wall retraction and oxygen desaturation. She did not have cough, coryza, diarrhea or vomiting. The baby was then admitted to the infant intensive care unit of the same hospital.

Examinations revealed white blood cell of 7690/μL (neutrophil 30.6% and lymphocyte 55.5%) and C-reactive protein of 0.12 mg/dL. The venous blood gas analysis revealed no acidosis with a pO2 of 42.5 mm Hg. Chest radiography showed no pneumonic patch. Frequent barking cough followed by severe desaturation with bradycardia were noted after admission. Sputum antigen tests for common respiratory viruses were negative. Positive pertussis culture and polymerase chain reaction (PCR) done by Taiwan Center for Disease Control confirmed B. pertussis infection.

Back to Top | Article Outline

SUBJECTS AND METHODS

Study Subjects

Because the baby girl was readmitted within 24 hours, we assumed that she acquired pertussis infection inside the hospital. To identify infection source, nasopharyngeal swabs from nurses and physicians having possible direct contact were taken for B. pertussis PCR. For seroepidemiology, serum specimens from nurses and physicians in the infant and neonatal care units were collected. All investigations were approved by National Taiwan University Hospital Research Ethics Committee and done after informed consent from each subject.

Back to Top | Article Outline

PCR for Detection of B. pertussis

DNA from nasopharyngeal swabs was extracted using DNA extraction kit (QIAamp Viral RNA MiniKit; Qiagen, Germany) according to manufacturer’s protocol. DNA sample underwent amplification by one-step PCR kit (Titan One Tube RT-PCR System; Roche Diagnostics, Indianapolis, IN) using primers targeting the repeated insertion sequences IS481 (forward: 5′ ATCAAGCACGCTTTACCC, reverse: 5′ TTGGGAGTTCTGGTAGGTGTG, probe: 5′ AATGGCAAGGCCGAACGCTTCA) for B. pertussis.3 Amplification was performed in the ABI Prism BigDye Terminator cycle sequencing kit and ABI Prism 3730 DNA sequencer (Model 3730 version 3.1; Applied Biosystems, Foster City, CA).

Back to Top | Article Outline

Pertussis Serology Test

Immunoglobulin G (IgG) against B. pertussis toxin and filamentous hemagglutinin and immunoglobulin M (IgM) against purified lysate antigens of B. pertussis were detected using NovaLisa enzyme-link immunosorbent assay kits (NovaTec Immundiagnostica GmbH, Dietzenbach, Germany).

The cutoff point of absorbance value was 0.38 for both IgG and IgM. The absorbance results were transformed into Novatec Units (NTU) by dividing patients’ absorbance value with cuffoff value and then multiplied by 10. An NTU below 9 is defined as negative, while an NTU above 10 as positive. An NTU between 9 and 10 was defined as intermediate.

Back to Top | Article Outline

RESULTS

Contact Tracing

Totally 27 specimens were collected for B. pertussis PCR, and all were negative for B. pertussis. Fourteen were from the nursing staff, 11 from physicians, 1 from another patient in the same room and 1 from the patient’s mother. All denied having symptoms suggestive of pertussis. We were unable to identify the sources of infection for this premature infant. No pertussis cases were suspected or confirmed after the index case.

Back to Top | Article Outline

Seroepidemiologic Study

We tested 113 serum specimens for pertussis IgG and IgM 4 months after the index case was identified. Ninety were from nursing staffs in the neonatal and infant care units and 23 were from physicians. All nursing staffs were female, while 12 (52%) of the 23 physicians were female. Only 4 (3.5%) had positive pertussis IgM (Table 1); 3 were nurses, and 1 was a resident pediatrician. Among these 4, only 1 nurse had direct contact with the index case and received pertussis PCR testing, which was negative. As for the pertussis IgG antibodies, 87 (77.0%) subjects were negative, 18 (15.9%) positive, and 8 (7.1%) intermediate (Table 1).

TABLE 1

TABLE 1

None of the surveyed healthcare workers had the typical symptoms of paroxysmal cough or inspiratory whooping. Based on their birth year, we assumed that all had pertussis vaccination in their infancy. None reported having received pertussis immunization after childhood.

Back to Top | Article Outline

DISCUSSION

The index baby had a high possibility of getting pertussis infection within the hospital. We did not identify a definite infection source, although 4 subjects had positive IgM. Our results confirmed that asymptomatic pertussis infections had occurred and warranted universal vaccination program for healthcare workers providing cares for neonates and infants.

Pertussis is seldom considered in the primary differential diagnosis for hospitalized infants with cough. Delayed diagnosis can lead to outbreaks in neonatal and infant care units. Healthcare workers are responsible for most reported outbreaks,5 impacting hospitalized infants, neonates or colleagues. In our investigation, none of the healthcare workers or other neonates had symptoms suggestive of pertussis. Hospital visitors were previously identified as infection sources6; however, we were unable to trace all the visitors during her hospitalization. Visitor restriction, respiratory droplet isolation and vaccination among healthcare workers were effective measures containing pertussis transmission.6 It was lucky that our index case did not lead to an outbreak in our hospital, probably because of rapid infection control measures and early containment of the infectious patient.

The fact that 77% of medical personnel taking care of neonates and infants did not have protective antibody against B. pertussis in our study is alarming. Waning protective immunity against B. pertussis, especially in adult and adolescents, was an important issue.2 A Taiwanese study conducted in 2013 revealed that only one-third of the primary school children had protective antibodies,7 which further decreased in adolescents and adults population.8 Furthermore, many healthcare workers did not have protective immunity against pertussis.9 Based on our and other studies, we concluded that only one-third to one-half of adults in the general population or healthcare professionals had positive anti-pertussis antibodies. Moreover, less than 10% of the previously vaccinated population had protective antibody, possibly resulting from waning of protective antibodies and lack of natural booster.

Our study adds additional evidence supporting pertussis booster vaccinations for healthcare workers, especially those taking care of neonates and infants. Currently, vaccine coverage rate among healthcare personnel is low, even though adult boosters are recommended.10 The vaccine coverage rate was lower in our hospital, probably because of unawareness among the medical staff and a lack of a clear policy for pertussis booster vaccination.

Based on the current study results, we re-emphasize that healthcare providers need to be reminded about the impact of pertussis. Routine pertussis vaccination for healthcare workers, especially those who take care of neonates and infants, is warranted.

Back to Top | Article Outline

ACKNOWLEDGMENTS

We appreciate all participating health care providers’ cooperation.

Back to Top | Article Outline

REFERENCES

1. Forsyth K, Plotkin S, Tan T, et al. Strategies to decrease pertussis transmission to infants. Pediatrics. 2015;135:e1475–e1482.
2. Hewlett EL, Edwards KM. Clinical practice. Pertussis–not just for kids. N Engl J Med. 2005;352:1215–1222.
3. Kösters K, Riffelmann M, Wirsing von König CH. Evaluation of a real-time PCR assay for detection of Bordetella pertussis and B. parapertussis in clinical samples. J Med Microbiol. 2001;50:436–440.
4. American Academy of Pediatrics Committee on Fetus And Newborn. Levels of neonatal care. Pediatrics 2012;130:587–597.
5. Maltezou HC, Ftika L, Theodoridou M. Nosocomial pertussis in neonatal units. J Hosp Infect. 2013;85:243–248.
6. Christie CD, Glover AM, Willke MJ, et al. Containment of pertussis in the regional pediatric hospital during the Greater Cincinnati epidemic of 1993. Infect Control Hosp Epidemiol. 1995;16:556–563.
7. Kuo CC, Huang YC, Hsieh YC, Huang YL, Huang YC, Hung YT. Seroepidemiology of pertussis among elementary school children in northern Taiwan. J Microbiol Immunol Infect. 2015.
8. Chiu TF, Lee CY, Lee PI, et al. Pertussis seroepidemiology in Taipei. J Formos Med Assoc. 2000;99:224–228.
9. Urbiztondo L, Broner S, Costa J, et al. Seroprevalence study of B. pertussis infection in health care workers in Catalonia, Spain. Hum Vaccin Immunother. 2015;11:293–297.
10. Lu PJ, Graitcer SB, O’Halloran A, et al. Tetanus, diphtheria and acellular pertussis (Tdap) vaccination among healthcare personnel-United States, 2011. Vaccine. 2014;32:572–578.
Keywords:

pertussis; antibody; vaccination; healthcare providers

Copyright © 2017 Wolters Kluwer Health, Inc. All rights reserved.