Secondary Logo

Share this article on:

Serum response factor mediates nociceptor inflammatory pain plasticity

Gomez, Rubena; Kohler, Dorothy, M.a; Brackley, Allison, D.a,b; Henry, Michael, A.c; Jeske, Nathaniel, A.a,b,d,*

doi: 10.1097/PR9.0000000000000658
Basic Science

Introduction: Chronic metabotropic glutamate receptor activation in nociceptive afferents may upregulate A-Kinase Anchoring Protein 150 (AKAP150) expression and/or function.

Objectives: To quantify transcriptional changes in AKAP150 expression and/or function after long-term mGluR5 agonist exposure, and identify transcriptional elements responsible.

Methods: Dorsal root ganglia (DRG) were dissected from Sprague-Dawley rats and cultured for biochemical analysis of AKAP150 expression after prolonged mGluR5 agonist exposure. Serum response factor (SRF) expression was knocked down through siRNA in cultures to demonstrate significance to AKAP150 upregulation. Serum response factor was also knocked down in vivo through intrathecal injections of specifically targeted oligonucleotides to demonstrate significance to hyperalgesic priming behavior in persistent mechanical hypersensitivity.

Results: Serum response factor and AKAP150 are coexpressed in TRPV1(+) DRG neurons in intact DRG. Prolonged mGluR5 agonist exposure increases SRF-dependent transcription and AKAP150 expression in a manner sensitive to protein kinase C inhibition and SRF knock down. Serum response factor in vivo knock down reduces mechanical hyperalgesic priming.

Conclusion: Serum response factor transcription plays an important role in transcriptional upregulation of AKAP and hyperalgesic priming behavior, and may contribute to the increased role of AKAP150 in the transition from acute to chronic pain.

Serum response factor upregulates A-Kinase Anchoring Protein 79/150 expression in afferent sensory neurons through metabotropic glutamate receptor signaling.

Departments of aOral and Maxillofacial Surgery

bPharmacology

cEndodontics. Dr. Henry is now with the School of Surgical Dentistry, University of Colorado Anschutz Medical Campus, Aurora, CO, USA and

dPhysiology, University of Texas Health Science Center at San Antonio, San Antonio, TX, USA

Corresponding author. Address: Department of Oral and Maxillofacial Surgery, University of Texas Health Science Center at San Antonio, 7703 Floyd Curl Dr, San Antonio, TX 78229. Tel.: 210-567-3466. E-mail address: jeske@uthscsa.edu (N.A. Jeske).

Sponsorships or competing interests that may be relevant to content are disclosed at the end of this article.

Supplemental digital content is available for this article. Direct URL citations appear in the printed text and are provided in the HTML and PDF versions of this article on the journal's Web site (www.painrpts.com).

This is an open access article distributed under the Creative Commons Attribution-NoDerivatives License 4.0 (CC BY-ND) which allows for redistribution, commercial and non-commercial, as long as it is passed along unchanged and in whole, with credit to the author.

Received December 01, 2017

Received in revised form April 04, 2018

Accepted April 08, 2018

Back to Top | Article Outline

1. Introduction

Multiple mechanisms contribute to primary afferent neuroplasticity including modulation (reversible posttranslational changes in sensory neuron excitability) and modification (extended changes in receptor, channel, and/or transmitter expression/function) of sensory neurons that define neuroplastic changes and support persistent pain.30 Although the central nervous system plays a role, primary afferent biochemistry produces the initial peripheral sensitization responsible for increasing nociceptor responsivity to environmental stimuli. Biochemical signaling pathways downstream of inflammatory mediator-activated receptors drive posttranslational modulation of other receptors and ion channels, increasing the likelihood and frequency of nociceptor depolarization and pain sensation. However, transcriptional modulators can also be upregulated after inflammatory injury, thereby modifying gene expression. At this point of transcriptional regulation, we identify a new target for analgesic consideration that could serve to quell inflammatory sensitization of nociceptors that contribute to persistent pain phenotypes.

Serum response factor (SRF) is a member of the MCM1, Agamous, Deficiens, and SRF (MADS) box family of transcription factors and binds the core sequence of CArG (CC [A/T] 6 GG) as a homodimer after Ser162 phosphorylation by protein kinase C (PKC).16 Serum response factor binds to serum response elements (SREs) located in multiple immediate early genes involved in cell growth, migration, and cytoskeletal organization.15 Importantly, SRF also controls the phenotypes of embryonic dorsal root ganglia (DRG) neurons29 through nerve growth factor (NGF) signaling. Given that SRF transcription plays a role in adult cardiac and muscle tissue,6 we questioned whether SRF also mediates adult DRG transcriptional changes in protein expression. Additionally, we questioned whether tissue inflammation could upregulate transcriptional activity via SRF. Analysis of over 200 genes containing consensus SRE sequences23 revealed several important genes expressed by DRG neurons, including the gene for A-Kinase Anchoring Protein 150 (AKAP150).

AKAP is a scaffolding protein expressed in nervous tissue that has been shown to positively modulate multiple channels associated with inflammatory hyperalgesia. Importantly, AKAP150 exists as the rodent homolog to AKAP79, which is the human homolog of the scaffolding protein. Previous studies have demonstrated that AKAP150 expression is required for protein kinase A– and PKC-mediated phosphorylation and sensitization of transient receptor potential channel family V1 (TRPV19,10,18,31). Recent work has also identified a role for the scaffolding protein in protein kinase A– and PKC-phosphorylation and sensitization of TRPA1.4 As a biochemical integrator of signaling pathways know to sensitize nociceptors, AKAP150 expression and function exists as a barometer of peripheral inflammatory plasticity.

Multiple measures of nociceptor sensitivity were used here to identify whether inflammatory activation of SRF mediates changes in AKAP150 expression and function. Studies on primary cultures, combined with in vivo rodent behavior, complement each other to identify that inflammation stimulates SRF-dependent upregulation of AKAP150, and that SRF contributes towards inflammatory hyperalgesic priming to generate persistent mechanical hypersensitivity. Taken together, these findings identify SRF as an important transcriptional mediator in primary afferent neurons that contribute to persistent pain.

Back to Top | Article Outline

2. Materials and methods

2.1. Animals

Procedures using animals were approved by the Institutional Animal Care and Use Committees of The University of Texas Health Science Center at San Antonio (UTHSCSA). Moreover, these procedures were conducted in accordance with policies for the ethical treatment of animals established by the National Institutes of Health and International Association for the Study of Pain.

Back to Top | Article Outline

2.2. Tissue culturing

Male Sprague-Dawley rats (175–200 g; Charles River Laboratories, Wilmington, MA) were used. L4 to L6 DRG were removed bilaterally from male rats, and dissociated by collagenase treatment (30 minutes, Worthington, Lakewood, NJ), followed by trypsin treatment (15 minutes, Sigma, St. Louis, MO). Cells were centrifuged and resuspended between each treatment with Pasteur pipettes. Dorsal root ganglia were then centrifuged, aspirated, and resuspended in Dulbecco's Modified Eagle Medium (DMEM; Gibco, Grand Island, NY) with 10% fetal bovine serum (Gibco), 100 ng/mL NGF (Harlan, Indianapolis, IN), 1% 5-fluoro deoxyuridine (Sigma), 1% penicillin/streptomycin (Gibco), and 1% L-glutamine, and then placed on plates coated with poly-D-lysine (Corning, Corning, NY). Cultures were maintained at 37°C, 5% CO2, and grown in 48-well or 6-well plates for 5 to 7 days for biochemistry experiments.

Back to Top | Article Outline

2.3. Serum response factor siRNA

Small interfering RNA (siRNA) directed against rat SRF (Gene ID: 501099) were custom designed through Dharmacon: SRF siRNA-1 sense 5′ GCGUGAAGAUCAAGAUGGAUU, antisense (AS) 5′ UCCAUCUUGAUCUU CACGCUU, SRF siRNA-2 sense 5′ ACAACAAGCUGCGGCGUUAUU, AS 5′ UAACGCCGCAGCUUGUUGUUU. Transfection of primary sensory neuron cultures was performed with HiPerFect (Qiagen, Germantown, MD) following manufacturer's instructions.

Back to Top | Article Outline

2.4. Nuclear isolation

Dorsal root ganglia cultures were collected in Dulbecco's phosphate-buffered saline (PBS) by centrifugation and rinsed twice with cold PBS on ice. Supernatant was discarded and the cell pellet was resuspended in 150 μL homogenization buffer (25 mM HEPES, 25 mM sucrose, 1.5 mM MgCl2, 50 mM NaCl, pH to 7.2) with 1 μg/mL pepstatin, 5 μg/mL leupeptin, 100 nM PMSF, and 1 mM sodium orthovanadate added immediately before use. This resuspension was homogenized in a Potter Elvehjem homogenizer by 20 strokes and incubated on ice for 15 minutes. After incubation, NP-40 detergent was added to each sample to a final concentration of 0.5% NP-40, vortexed for 10 seconds, and centrifuged at 1,000g for 10 minutes at 4°C. The resulting supernatant represents the cytoplasmic fraction. The pellet is resuspended in general lysis buffer (1 mM sodium pyrophosphate, 50 mM HEPES [pH7.5], 1% Triton X-100, 50 mM NaCl, 50 mM NaF, 5 mM EDTA [pH 8.0], pH to 7.4) and incubated on ice for 30 minutes with 10 seconds of vortexing in 10-minute intervals. Samples are then centrifuged for 30 minutes at 14,000g at 4°C, with the supernatant representing the nuclear fraction. Protein quantification is conducted following the Bradford method.5 Representative Western blot results of cytoplasmic and nuclear fractions resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and probed for nuclear pore complex protein 98 (NUP98) and β-actin (Supplementary Figure 1, available at http://links.lww.com/PR9/A19) demonstrate the high fidelity of this protocol.

Back to Top | Article Outline

2.5. Western blotting

Dorsal root ganglia cultures in 6-well plates were treated as described, rinsed twice with ice-cold PBS, and lysed in general lysis buffer, with 1 μg/mL pepstatin, 5 μg/mL leupeptin, 100 nM PMSF, and 1 mM sodium orthovanadate added immediately before use via 20 passes through a 24 g hypodermic needle. Lysates were incubated on ice for 15 minutes, then cleared by centrifuging at 4°C for 2 minutes at 1000g, before quantification of protein concentration by Bradford analysis.5 Equal 30 μg samples across treatment parameters were resolved by 12.5% SDS-PAGE and transferred to polyvinyldifluoride membranes (EMD Millipore, Billerica, MA) using the semi-dry blotting method. Membranes were blocked in 5% nonfat milk in Tris-buffered saline with 0.1% Tween-20 nonionic detergent and incubated 18 hours with primary antibody anti-AKAP (Santa Cruz Biotechnology, Santa Cruz, CA),9 anti-β-Actin (Sigma-Aldrich, St. Louis, MO), anti-phospho-SRF Serine 162 (Cell Signaling Technology, Danvers, MA20), and anti-SRF (Cell Signaling Technology).22 Anti-rabbit or anti-mouse secondary antibodies (GE Healthcare Life Sciences, Piscataway, NJ) were applied to rinsed blots, incubated at room temperature for 1 hour, and then blots were rinsed again. Membranes were incubated with enhanced chemiluminescence solution (GE Healthcare Life Sciences), exposed to X-ray film and developed for analysis. Membranes were subsequently rinsed with DPBS 4 × 5 minutes at room temperature, and then chemically stripped for 40 minutes at 55°C in a hybridizing oven in stripping buffer (312.5 mM Tris HCl, 10% sodium dodecyl sulfate). Membranes were rinsed 4 × 5 minutes at room temperature, and then reblocked and probed as before.

Membranes were scanned and immunoreactivities quantified using NIH Image-J shareware. Experiments were conducted with minimum of 3 trials, and quantified results were analyzed for significance by 2-way analysis of variance with Bonferroni correction ad hoc.

Back to Top | Article Outline

2.6. Immunohistochemistry

Dorsal root ganglia from male Sprague-Dawley rats were obtained by surgical resection from adults 225 to 250 g in weight and processed/prepared as we have described previously.8 Individual sections from 3 different rats were stained with antibodies specific to SRF (1:400; Cell Signaling Technologies22), AKAP79/150 (1:100; Santa Cruz Biotechnology9), and TRPV1 (1:2000; Neuromics [GP14103]17). Species-appropriate Alexa Fluor secondary antibodies (Molecular Probes at 1:200 dilution) were used to visualize TRPV1 (Alexa Fluor 488), AKAP79/150 (Alexa Fluor 633), and SRF (Alexa Fluor 568). Immunofluorescence was evaluated, and images were obtained with the use of a Nikon 90i microscope equipped with a C1si laser scanning confocal imaging system (Nikon, Melville, NY). Images were processed for illustration purposes with Adobe Photoshop CS2 (Adobe, San Jose, CA) and are representative of 3 individual animals.

For quantification, 8 DRG images were chosen randomly, and an unbiased observer quantified positively stained cells. Image J (NIH) was used for identifying positive expression against a background-quantified low threshold.

Back to Top | Article Outline

2.7. Hyperalgesic priming behavior

Antisense oligonucleotides were designed against rat SRF DNA, using custom-design shareware available on invitrogen.com. The AS sequence created and used was as follows: 5′—GCG TGA AGA TCA AGA TGG. The mismatch (MM) sequence created and used was as follows: 5′—GGC TCT TCT AGT TCC AGC. Antisense and MM oligonucleotides (ODNs) were dissolved in sterile-filtered PBS and stored at −20°C. Rats were briefly anesthetized with 2.5% isoflurane before a 28 1/2-gauge needle insulin syringe was inserted intrathecally on the midline between vertebrae L5 and L6. Injection location at the level of the cauda equine was confirmed by tail flick.14 Thirty microgram of ODN in 20 μL sterile PBS was administered once daily for 3 consecutive days. Behavioral testing was completed the following day within 24 hours of the final injection. After behavioral testing and within 24 hours of the final ODN administration, L4 to L6 DRG were bilaterally harvested. Dorsal root ganglia were homogenized in homogenization buffer containing 1% Triton X-100, cleared by centrifugation at 1000g for 1 minute, quantified using the Bradford method, with 50 μg aliquots resolved by SDS-PAGE.

All injections were given intraplantarly in 50 μL volumes using a 28-gauge needle inserted through the lateral footpad just under the skin to minimize tissue damage. Drug doses were taken from previous work by Aley et al.1 Drug stocks were dissolved in PBS. For rat priming experiments, rats were tested for baseline responses before injections, and then injected with carrageenan (50 μL of a 0.1% solution in PBS) or vehicle (PBS) on day 1. On days 2, 3, and 4, rats were injected intrathecally with AS and MM oligonucleotides. Rats were tested again on day 5 for baseline responses, and then injected with PGE2 (100 ng) followed by repeated mechanical threshold testing at 15 minutes, 30 minutes, 2 hours, and 4 hours post-PGE2 injection.

Back to Top | Article Outline

2.8. Serum response element–GFP reporter assay

Rat DRG were cultured in 48-well plates, grown for 5 days, and transfected with cDNA for the SRE-green fluorescent protein reporter, negative control (no promoter-GFP cDNA) or positive control (CMV-GFP cDNA), following manufacturer's instructions (Qiagen), serum starved for 18 hours, and then treated with serum-free media, fetal calf serum (serum media, SM), (RS)-3,5-dihydroxyphenylglycine (group 1 mGluR agonist, DHPG), DHPG + 2-Methyl-6-(phenylethynyl) pyridine hydrochloride (noncompetitive antagonist of mGlur5, MPEP), DHPG + GF 109203X (PKCα, β1, δ, ε, and ζ isoform inhibitor, GFX), or Phorbol 12-myristate 13-acetate (PKC activator, PMA) for 24 hours. The assay was then performed following manufacturer's instructions, and GFP fluorescence was quantified on a Tecan SpectraFluor Plus (488 nm excitation and 530 nm emission). Negative control emission values were subtracted from each experimental condition, and reported values were quantified as a percentage of the positive control (CMV-GFP). Results represent mean ± SEM from 6 individual samples per treatment, with significance determined by 1-way analysis of variance with the Tukey multiple comparisons correction.

Representative images were generated from similar transfection and treatment conditions using an EVOS FL Color Imaging Systems transmitted light microscope (Life Technologies Corp, Bothell, WA). Combined DIC and GFP-fluorescence images were collected with a 10× objective to provide optimal analysis of cell types expressing GFP. Images are representative of 3 individual trials per transfection/treatment condition.

Back to Top | Article Outline

3. Results

Serum response factor controls the developmental phenotypes of multiple tissues and cell types, including embryonic DRG neurons.29 Immunohistochemical analysis of intact rat DRG identifies coexpression with AKAP150 in both TRPV1(+) and TRPV1(−) neurons (Fig. 1A–D). When quantified, SRF was expressed in 37 ± 5.9% of AKAP(+) positive neurons, and in 13.5% of TRPV1(+) neurons (Fig. 1E, F). Importantly, SRF was expressed in both neuronal and nonneuronal cells, indicating a potential role in pain processes transduced by primary afferents as well as glial support cells.

Figure 1

Figure 1

Serum response factor phosphorylation by PKC simulates translocation of the transcription factor to the nucleus to associate with DNA SREs.25 Cultured sensory neurons from DRG were treated with phorbol 12-myristate 13-acetate (PMA), a PKC activator, and lysed for Western blot measurement of SRF phosphorylation at Ser162. In both intact and cultured DRG, SRF phosphorylation at Ser162 increased after PKC activation by PMA (1 μM, Fig. 2A). Metabotropic glutamate receptors, including group 1 mGluR1/5 are expressed in sensory neurons and signal through Gαq-coupled mechanisms to increase PKC activity in DRG cultures.12 Therefore, we set out to determine whether receptor-mediated PKC activation could also drive SRF phosphorylation. In Figure 2B, treatment of DRG cultures with mGluR5-specific agonist (S)-3,5-dihydroxyphenylglycine (DHPG) resulted in a 2-fold increase in SRF phosphorylation at Ser162, in a manner sensitive to PKC inhibition by GF 109203X (GFX). As a control, nuclear preparations of cultured DRG neurons were also collected and monitored for SRF phosphorylation at Ser162, showing an increase in nuclear localization of the phosphorylated protein in nuclei after DHPG treatment, when normalized to nuclear pore complex protein 98 (NUP98) expression (Fig. 2C).

Figure 2

Figure 2

To confirm that mGluR5 activation was driving PKC-mediated SRF activation of SRE-containing genetic material, we used an SRE-driven Green Fluorescent Protein reporter construct transfected into DRG cultures. After transfection, cultures were maintained in serum-free media for 18 hours to baseline GFP expression, then treated with DHPG vehicle (DMSO, 0.01%), DHPG, DHPG + mGluR5-specific antagonist 2-Methyl-6-(phenylethynyl) pyridine (MPEP), DHPG + GFX, PMA, or placed in serum-containing media (10% fetal calf serum), and incubated for 24 hours. GFP expression was quantified by the spectrofluorometric measurement, revealing induction of GFP fluorescence in cultures treated with DHPG (Fig. 3). The increase in GFP-reporter expression appears to have occurred predominantly in neurons, although several glial also demonstrate GFP–fluorescence (Panel H). This increase was blocked by cotreatment with either MPEP or GFX, whereas both PMA and serum-media exposure produced increased GFP fluorescence, as expected (positive controls). Taken together, these data suggest that mGluR5 activation drives PKC-dependent SRF-transcription in cultured sensory neurons.

Figure 3

Figure 3

Serum response factor and AKAP150 are coexpressed in DRG neurons (Fig. 1), prompting us to investigate whether the promoter region 5′ to the AKAP150 start site on chromosome 14 in rats contains SREs for SRF-stimulated transcription. As depicted in Figure 4A, 2 SREs exist 5′ of the AKAP150 start codon, although one is closer than the other. Unfortunately, we were unable to delineate any exon/intron inclusion in the sequence analysis, so we next investigated the hypothesis that SRF positively upregulates AKAP150 expression. First, we used 2 custom-designed, SRF-specific siRNA sequences, identified as SRF siRNA-1 and siRNA-2. In Figure 4B, SRF siRNA-2 inhibited SRF expression in transfected DRG cultures. We next investigated whether mGluR5 activation, which was previously demonstrated to stimulate SRF-dependent DNA transcription, could stimulate an increase in AKAP150 expression in DRG neurons. Indeed, 24-hour treatment of DRG cultures with mGluR5-specific agonist DHPG increased AKAP150 protein expression in a manner sensitive to PKC-inhibition by GFX (Fig. 4C), suggesting a functional transcriptional link between SRF and AKAP150. To confirm this deduction, we repeated the experiment in the presence of SRF-siRNA-2, or MM (negative control) siRNA. As shown in Figure 4D, DHPG-stimulated AKAP150 upregulation was blocked in cultures pretreated with siRNA specific for SRF. Collectively, these results intimate that mGluR5 activation can stimulate SRF-dependent upregulation of AKAP150 protein expression in DRG cultures.

Figure 4

Figure 4

The in vitro analyses of SRF transcriptional control of AKAP150 expression prompted us to turn our investigation towards functional in vivo analyses. Given the important role of AKAP150 to mechanical hyperalgesic priming,4,24 we questioned whether SRF is also involved. To develop this experiment, we used an oligonucleotide approach to knock down in vivo SRF through intrathecal injections, as we have described previously.3 The SRF-siRNA-2 sequence previously used in Figure 3 was used to create an SRF oligonucleotide for in vivo injection. As depicted in Figure 5A, intrathecal injection of the SRF oligonucleotide reduces SRF protein expression in extracted DRG lysates over those animals treated with an MM oligonucleotide. With this verification of specificity, we proceeded to divide adult male rats into 4 groups to analyze mechanical hyperalgesic priming, as we and others have performed.1,24 Importantly, we used a chronic mechanical rodent behavior model that uses carrageenan priming because carrageenan-induced hyperalgesia is inhibited by mGluR5 antagonism.27 The 4 groups included animals with no treatment, carrageenan (Cg) priming, Cg-primed animals that received MM oligonucleotide injections, and Cg-primed rats that received SRF-oligonucleotide (AS) injections. Rats were randomly selected to receive intrathecal injections during the 3 days between vehicle/Cg and PGE2 intraplantar injections into the same hind paw. As we have demonstrated previously, Cg-priming extends mechanical hypersensitivity after PGE2 in a manner that mimics persistent pain (Fig. 5B). However, oligonucleotide knock down of SRF expression reversed the persistent mechanical hypersensitivity phenotype, indicating a functional, in vivo importance for the transcription factor.

Figure 5

Figure 5

Back to Top | Article Outline

4. Discussion

Chronic pain is considered a multifactorial phenomenon. Numerous publications have identified not only specific signaling pathways that contribute to the generation and maintenance of chronic pain, but also anatomical structures that support pain persistence. The difficulty in treating chronic pain effectively and without contributing to the opioid-use epidemic is identifying singular targets for pharmaceutical development that can address both peripheral and central afferent sensitization. However, the understanding that peripheral sensitization predicates central would suggest that addressing the mechanisms of initial peripheral sensitization could prevent eventual central sensitization. In this article, we identify a transcriptional process that could explain how a number of signaling pathways contribute to the “chronification” of pain.

AKAP150 scaffolding protein has been identified as important in the efficient organization of signaling kinases and their targets within nociceptors, contributing to neuronal sensitization and reduced TRP receptor thresholds.4,9,10,18,31 Here, we have identified how extended glutamate exposure may upregulate AKAP150 expression through the transcription factor SRF. In this mechanism, activation of mGluR5/PKC signaling pathway stimulates SRF transcription and the upregulation of AKAP150 expression. Furthermore, oligonucleotide-mediated knock down of SRF in rat DRG in vivo reduced persistent mechanical hypersensitivity in a model of carrageenan-induced hyperalgesic priming. A signal transduction model in Figure 6 illustrates these findings, and provides a mechanism by which extended glutamate exposure could stimulate an accumulation of AKAP150 scaffolding protein, thereby enabling the potential for increased TRP channel responsivity and peripheral afferent depolarization.

Figure 6

Figure 6

Previous work by our group has identified AKAP150 as an important component of hyperalgesic priming.4 Here, experimental results indicate that SRF also plays a role (Fig. 4). Although it may appear that our main hypothesis would be supported more so by performing the same experiment in AKAP150 WT and KO mice, or vice versa (AKAP150 oligonucleotide knock down in SRF WT and KO mice), both of these avenues would likely produce confounding results. First, AKAP150 modulates multiple receptors and channels that are likely involved in the persistent hypersensitivity associated with mechanical hyperalgesic priming, including TRPA1,4 TRPV1,28 and potentially other glutamatergic ionotropic channels.7 Second, SRF likely mediates the transcription of other molecules such as c-fos that are possibly associated with persistent pain.13,19 Of course, applying AKAP150 oligonucleotide knock down in this behavioral model, although possible, would not provide much information in an SRF knock out mouse, given that the genomic ablation of SRF is embryonic lethal.2 Taken together, our approach falls short in identifying that SRF-mediated upregulation of AKAP150 contributes to hyperalgesic priming, but does provide evidence that the transcription factor contributes to persistent mechanical hypersensitivity. Indeed, GFP-fluorescence in Panel H of Figure 3 could indicate that expression of mGluR5 in peripheral glia could open up new roles for accumulated glutamate in the periphery in respects to persistent inflammatory hypersensitivity. Furthermore, the tenet between these behavioral results and our biochemical data agrees that SRF-mediated upregulation of AKAP150 could contribute to mechanical hypersensitivity associated with persistent pain.

The involvement of SRF-dependent transcription in pain behaviors is a potentially important phenomenon that bears additional investigation. The phosphorylation of SRF at Ser162 by PKC is a mechanism that could be considered downstream of many inflammatory signaling systems. For this study, we used the broad-spectrum PKC inhibitor GF 109203X (GFX), given that multiple isoforms are believed to stimulate SRF transcription,21 and that even more isoforms are expressed in sensory neuronal systems and involved in pain. Although a drawback with using broad-spectrum PKC inhibitors are the nonspecific effects on other kinases at high concentrations, the data presented here support the direct signaling mechanism stimulated from mGluR5-Gαq-PKC-SRF.

Transcriptional regulation of pain behavior is a field of research that has been studied previously. From Runx1-mediated upregulation of TRPV1 expression in DRG neurons,26 to transcription factor EB-mediated lysosomal activation in nerve injury pain,11 many transcription factors have been localized and studied individually. Here, our studies focused on SRF, as a positive modulator of AKAP150 gene transcription in rat DRG neurons. As results presented herein identify a relationship between SRF and pain, it is important to remember that SRF likely promotes transcription of multiple genes in sensory neurons. These other proteins likely contribute to the variation between hyperalgesic priming behavior in control vs SRF oligonucleotide–treated animals. However, the findings from this work will stimulate future studies into the role of SRF, as it pertains to not only persistent pain but other models that lack definitive treatment targets for analgesia.

Back to Top | Article Outline

Disclosures

The authors have no conflict of interest to declare.

This work was supported by funding from the National Institutes of Health NINDS, NS0827465 (N.A.J.). The authors extend their gratitude to Annibal Diogenes, DDS, PhD, for assistance in collecting SRF-GFP reporter images.

Back to Top | Article Outline

Supplemental digital content

Supplemental digital content associated with this article can be found online at http://links.lww.com/PR9/A19.

Back to Top | Article Outline

References

[1]. Aley KO, Messing RO, Mochly-Rosen D, Levine JD. Chronic hypersensitivity for inflammatory nociceptor sensitization mediated by the epsilon isozyme of protein kinase C. J Neurosci 2000;20:4680–5.
[2]. Arsenian S, Weinhold B, Oelgeschlager M, Ruther U, Nordheim A. Serum response factor is essential for mesoderm formation during mouse embryogenesis. EMBO J 1998;17:6289–99.
[3]. Brackley AD, Gomez R, Akopian AN, Henry MA, Jeske NA. GRK2 constitutively governs peripheral delta opioid receptor activity. Cell Rep 2016;16:2686–98.
[4]. Brackley AD, Gomez R, Guerrero KA, Akopian AN, Glucksman MJ, Du J, Carlton SM, Jeske NA. A-kinase anchoring protein 79/150 scaffolds transient receptor potential a 1 phosphorylation and sensitization by metabotropic glutamate receptor activation. Sci Rep 2017;7:1842.
[5]. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248–54.
[6]. Coletti D, Daou N, Hassani M, Li Z, Parlakian A. Serum response factor in muscle tissues: from development to ageing. Eur J Transl Myol 2016;26:6008.
[7]. Gangadharan V, Wang R, Ulzhofer B, Luo C, Bardoni R, Bali KK, Agarwal N, Tegeder I, Hildebrandt U, Nagy GG, Todd AJ, Ghirri A, Haussler A, Sprengel R, Seeburg PH, MacDermott AB, Lewin GR, Kuner R. Peripheral calcium-permeable AMPA receptors regulate chronic inflammatory pain in mice. J Clin Invest 2011;121:1608–23.
[8]. Henry MA, Freking AR, Johnson LR, Levinson SR. Increased sodium channel immunofluorescence at myelinated and demyelinated sites following an inflammatory and partial axotomy lesion of the rat infraorbital nerve. PAIN 2006;124:222–33.
[9]. Jeske NA, Diogenes A, Ruparel NB, Fehrenbacher JC, Henry M, Akopian AN, Hargreaves KM. A-kinase anchoring protein mediates TRPV1 thermal hyperalgesia through PKA phosphorylation of TRPV1. PAIN 2008;138:604–16.
[10]. Jeske NA, Patwardhan AM, Ruparel NB, Akopian AN, Shapiro MS, Henry MA. A-kinase anchoring protein 150 controls protein kinase C-mediated phosphorylation and sensitization of TRPV1. PAIN 2009;146:301–7.
[11]. Jung J, Uesugi N, Jeong NY, Park BS, Konishi H, Kiyama H. Increase of transcription factor EB (TFEB) and lysosomes in rat DRG neurons and their transportation to the central nerve terminal in dorsal horn after nerve injury. Neuroscience 2016;313:10–22.
[12]. Lee JS, Ro JY. Peripheral metabotropic glutamate receptor 5 mediates mechanical hypersensitivity in craniofacial muscle via protein kinase C dependent mechanisms. Neuroscience 2007;146:375–83.
[13]. Lehner M, Taracha E, Skorzewska A, Wislowska A, Zienowicz M, Maciejak P, Szyndler J, Bidzinski A, Plaznik A. Sensitivity to pain and c-Fos expression in brain structures in rats. Neurosci Lett 2004;370:74–9.
[14]. Mestre C, Pelissier T, Fialip J, Wilcox G, Eschalier A. A method to perform direct transcutaneous intrathecal injection in rats. J Pharmacol Toxicol Methods 1994;32:197–200.
[15]. Olson EN, Nordheim A. Linking actin dynamics and gene transcription to drive cellular motile functions. Nat Rev Mol Cell Biol 2010;11:353–65.
[16]. Posern G, Treisman R. Actin' together: serum response factor, its cofactors and the link to signal transduction. Trends Cell Biol 2006;16:588–96.
[17]. Rowan MP, Szteyn K, Doyle AP, Gomez R, Henry MA, Jeske NA. beta-arrestin-2-biased agonism of delta opioid receptors sensitizes transient receptor potential vanilloid type 1 (TRPV1) in primary sensory neurons. Mol Pain 2014;10:50.
[18]. Schnizler K, Shutov LP, Van Kanegan MJ, Merrill MA, Nichols B, McKnight GS, Strack S, Hell JW, Usachev YM. Protein kinase A anchoring via AKAP150 is essential for TRPV1 modulation by forskolin and prostaglandin E2 in mouse sensory neurons. J Neurosci 2008;28:4904–17.
[19]. Selvaraj A, Prywes R. Expression profiling of serum inducible genes identifies a subset of SRF target genes that are MKL dependent. BMC Mol Biol 2004;5:13.
[20]. Shan J, Donelan W, Hayner JN, Zhang F, Dudenhausen EE, Kilberg MS. MAPK signaling triggers transcriptional induction of cFOS during amino acid limitation of HepG2 cells. Biochim Biophys Acta 2015;1853:539–48.
[21]. Soh JW, Lee EH, Prywes R, Weinstein IB. Novel roles of specific isoforms of protein kinase C in activation of the c-fos serum response element. Mol Cell Biol 1999;19:1313–24.
[22]. Speight P, Kofler M, Szaszi K, Kapus A. Context-dependent switch in chemo/mechanotransduction via multilevel crosstalk among cytoskeleton-regulated MRTF and TAZ and TGFbeta-regulated Smad3. Nat Commun 2016;7:11642.
[23]. Sun Q, Chen G, Streb JW, Long X, Yang Y, Stoeckert CJ Jr, Miano JM. Defining the mammalian CArGome. Genome Res 2006;16:197–207.
[24]. Szteyn K, Rowan MP, Gomez R, Du J, Carlton SM, Jeske NA. A-kinase anchoring protein 79/150 coordinates metabotropic glutamate receptor sensitization of peripheral sensory neurons. PAIN 2015;156:2364–72.
[25]. Ueyama T, Kawashima S, Sakoda T, Hirata KI, Ohashi Y, Yamochi W, Akita H, Yokoyama M. Transforming growth factor-beta1 and protein kinase C synergistically activate the c-fos serum response element in myocardial cells. J Mol Cell Cardiol 1998;30:551–62.
[26]. Ugarte GD, Diaz E, Biscaia M, Stehberg J, Montecino M, van Zundert B. Transcription of the pain-related TRPV1 gene requires Runx1 and C/EBPbeta factors. J Cell Physiol 2013;228:860–70.
[27]. Walker K, Reeve A, Bowes M, Winter J, Wotherspoon G, Davis A, Schmid P, Gasparini F, Kuhn R, Urban L. mGlu5 receptors and nociceptive function II. mGlu5 receptors functionally expressed on peripheral sensory neurones mediate inflammatory hyperalgesia. Neuropharmacology 2001;40:10–19.
[28]. Walker KM, Urban L, Medhurst SJ, Patel S, Panesar M, Fox AJ, McIntyre P. The VR1 antagonist capsazepine reverses mechanical hyperalgesia in models of inflammatory and neuropathic pain. J Pharmacol Exp Ther 2003;304:56–62.
[29]. Wickramasinghe SR, Alvania RS, Ramanan N, Wood JN, Mandai K, Ginty DD. Serum response factor mediates NGF-dependent target innervation by embryonic DRG sensory neurons. Neuron 2008;58:532–45.
[30]. Woolf CJ, Salter MW. Neuronal plasticity: increasing the gain in pain. Science 2000;288:1765–9.
[31]. Zhang X, Li L, McNaughton PA. Proinflammatory mediators modulate the heat-activated ion channel TRPV1 via the scaffolding protein AKAP79/150. Neuron 2008;59:450–61.
Keywords:

Pain; Plasticity; AKAP; Nociceptor; SRF

Supplemental Digital Content

Back to Top | Article Outline
© 2018 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of The International Association for the Study of Pain.