Secondary Logo

Haploinsufficiency of the brain-derived neurotrophic factor gene is associated with reduced pain sensitivity

Sapio, Matthew R.a; Iadarola, Michael J.a,*; LaPaglia, Danielle M.a; Lehky, Tanyab; Thurm, Audrey E.c; Danley, Kristen M.d; Fuhr, Shannon R.d; Lee, Mark D.d; Huey, Amanda E.d; Sharp, Stephen J.e; Tsao, Jack W.e,f,g,h; Yanovski, Jack A.i; Mannes, Andrew J.a; Han, Joan C.c,d,h,i,j,k

doi: 10.1097/j.pain.0000000000001485
Research Paper
Free
SDC
Editor's Choice

Rare pain-insensitive individuals offer unique insights into how pain circuits function and have led to the development of new strategies for pain control. We investigated pain sensitivity in humans with WAGR (Wilms tumor, aniridia, genitourinary anomaly, and range of intellectual disabilities) syndrome, who have variably sized heterozygous deletion of the 11p13 region. The deletion region can be inclusive or exclusive of the brain-derived neurotrophic factor (BDNF) gene, a crucial trophic factor for nociceptive afferents. Nociceptive responses assessed by quantitative sensory testing demonstrated reduced pain sensitivity only in the WAGR subjects whose deletion boundaries included the BDNF gene. Corresponding behavioral assessments were made in heterozygous Bdnf knockout rats to examine the specific role of Bdnf. These analogous experiments revealed impairment of Aδ- and C-fiber-mediated heat nociception, determined by acute nociceptive thermal stimuli, and in aversive behaviors evoked when the rats were placed on a hot plate. Similar results were obtained for C-fiber-mediated cold responses and cold avoidance on a cold-plate device. Together, these results suggested a blunted responsiveness to aversive stimuli. Our parallel observations in humans and rats show that hemizygous deletion of the BDNF gene reduces pain sensitivity and establishes BDNF as a determinant of nociceptive sensitivity.

Haploinsufficiency of BDNF in humans with WAGR syndrome and in rats with a specific heterozygous Bdnf disruption has reduced sensitivity to pain.

aDepartment of Perioperative Medicine, Clinical Center, National Institutes of Health (NIH), Bethesda, MD, United States

bElectromyography Section, National Institute of Neurological Disorders and Stroke, NIH, Bethesda, MD, United States

cPediatrics and Developmental Neuropsychiatry Branch, National Institute of Mental Health (NIH), Bethesda, MD, United States

dUnit on Metabolism and Neuroendocrinology, Eunice Kennedy Shriver National Institute of Child Health and Human Development (NICHD), NIH, Bethesda, MD, United States

eDepartent of Neurology, Uniformed Services University, Bethesda, MD, United States

fDepartment of Neurology, University of Tennessee Health Science Center, Memphis, TN, United States

gDepartment of Neurology, Memphis Veterans Affairs Medical Center, Memphis, TN, United States

hChildren's Foundation Research Institute, Le Bonheur Children's Hospital, Memphis, TN, United States

iSection on Growth and Obesity, NICHD, NIH, Bethesda, MD, United States

Departments of jPediatrics and

kPhysiology, University of Tennessee Health Science Center, Memphis, TN, United States

Corresponding author. Address: Department of Perioperative Medicine, Clinical Center Building 10, Room 2C401, 10 Center Dr, MSC 1510, National Institutes of Health, Bethesda, MD 20892-1510, United States. Tel.: 301-496-2758. E-mail address: miadarol@cc.nih.gov (M.J. Iadarola).

Sponsorships or competing interests that may be relevant to content are disclosed at the end of this article.

Supplemental digital content is available for this article. Direct URL citations appear in the printed text and are provided in the HTML and PDF versions of this article on the journal's Web site (www.painjournalonline.com).

M.R. Sapio and M.J. Iadarola contributed equally to this manuscript.

Received October 01, 2018

Received in revised form December 04, 2018

Accepted December 09, 2018

Back to Top | Article Outline

1. Introduction

The ability to sense and respond to potentially damaging stimuli is a fundamental role of the nervous system, conserved in all animals. Dedicated peripheral sensory neurons, called “nociceptors,” respond to tissue damage, transducing the stimuli into neural impulses, and are the first neuron in the pain pathway. However, in the central nervous system (CNS), the registration and interpretation of these sensory inputs involves complex circuitry some of which feeds back to modulate primary afferent nociceptive inputs in the dorsal spinal cord.49 Although there is variation in pain sensitivity across normal individuals, there are also rare outliers; at one extreme are people with congenital insensitivities to pain. Such people generally harbor mutations that inactivate or destroy the nociceptive apparatus in the peripheral nervous system, leading to profound loss of pain sensation.13,52 Such rare mutations have led to a greater understanding of pain transmission, development of pain circuits, and ultimately to new approaches to control pain.16,25

The present report focuses on patients with Wilms tumor‐aniridia‐genitourinary anomaly‐range of developmental delays (WAGR) syndrome that is caused by a variable-length heterozygous deletion in 11p13 and is associated with clinical heterogeneity and a large number of phenotypic presentations that include kidney tumors (nephroblastoma), aniridia, genitourinary anomalies (eg, cryptorchidism), and intellectual disabilities. In part, clinical heterogeneity is driven by the variable genetic defect that can be inclusive or exclusive of several genes, including the brain-derived neurotrophic factor (BDNF) gene. Based on parental reports of pain insensitivity in WAGR syndrome patients with BDNF deletion on one chromosome, as well as a large existing preclinical literature on the relationship between BDNF and pain,38,40,49 we systematically investigated pain sensitivity in individuals with WAGR syndrome. We show that haploinsufficiency of the BDNF gene is associated with a strong reduction in pain sensitivity in these individuals that was evident using quantitative sensory testing (QST) and via parental reports. Similarly, a rat model that specifically isolates the Bdnf haploinsufficiency also revealed impairment of cold and hot thermonociception. In our transcriptomic examinations of the first 2 elements of the nociceptive circuit, dorsal root ganglion (DRG) and dorsal spinal cord, we see more genes differentially regulated at the level of the second-order spinal neurons, suggestive of pain modulation, rather than abolition of the primary afferent nociceptive apparatus. Our observations in humans and rats establish corresponding phenotypic evidence that BDNF haploinsufficiency is associated with altered nociceptive sensitivity in both species, and have potential implications for future pharmacologic modulation of pain sensitivity.

Back to Top | Article Outline

2. Materials and methods

2.1. Subjects

Subjects with WAGR syndrome were recruited through the International WAGR Syndrome Association. All procedures were approved by the NICHD Institutional Review Board. Parents/legal guardians provided consent for minors and adults with intellectual disability. Testing was performed at the NIH Clinical Center in Bethesda, MD. A detailed, standardized clinical neurological examination was performed by board-certified neurologists on all subjects.

Back to Top | Article Outline

2.2. Demographics, neurological examination, and genotyping of WAGR subjects

11p13 deletion boundaries for the WAGR subjects were determined by microarray comparative genomic hybridization.23 The mapping of the WAGR hemideletion allowed the patient population to be split based on deletion boundaries. Of the 32 patients in the present study, 12 were able to complete sensory testing. Of these 12, 6 harbored heterozygous deletion of BDNF, whereas 6 retained 2 copies of this gene (Fig. 1A). These 2 groups of patients were not significantly different in intelligence, age, tumor status, chemotherapy treatment (Fig. 1B), or in nerve conduction velocity (supplementary Tables 1, 2; available at http://links.lww.com/PAIN/A732). Both groups of patients were 2/3 females. Parental reports of these patients indicated a potential pain insensitivity phenotype, and were recorded formally (Fig. 1C, further annotated in supplementary Figure 1, available at http://links.lww.com/PAIN/A732), and investigated with experimental thermal pain stimuli using QST (Figs. 1D and E). Most WAGR syndrome subjects are intellectually impaired, and deletion of BDNF is associated with reduced general cognitive functioning.24 Due to this impairment, criteria for eligibility included ability to rate thermal stimuli and complete QST. intelligence quotient (IQ) Sensitivity analysis was performed to rule out IQ as a confounding variable in the interpretation of QST results (Supplementary Figure 2, available at http://links.lww.com/PAIN/A732). In addition, clinical neurological examination demonstrated normal peripheral motor and sensory findings consistent with normal conduction velocity measurements on multiple peripheral nerves. Nerve conduction measurements are shown for the cohort in supplementary tables 1 and 2 (available at http://links.lww.com/PAIN/A732).

Figure 1

Figure 1

Back to Top | Article Outline

2.3. Quantitative sensory testing of human subjects with WAGR syndrome

Testing was performed with the Medoc Thermal Sensory Analyzer (Medoc Ltd Advanced Medical Systems, Durham, NC) using a 1.6 × 1.6-cm contact thermode placed on the volar forearm. This protocol was derived from a prior study conducted at the NIH in adults.33 Subjects, who were masked with regard to the temperature of the stimulus, were asked to rate the thermal pain intensity of each target temperature using a 6-point Wong–Baker FACES Pain Rating Scale, which has been validated in children as young as age 3 years.61 The experimenter administering the test to WAGR subjects was not informed of the patient's BDNF deletion status, and efforts were made to blind the experimenter to BDNF deletion status. However, experimenters could have been cued to the subject's genotype by phenotypic presentations,23 as well as familiarity with medical records associated with each patient, which contained information about deletion boundaries of the patients, but not BDNF deletion status directly. Experimenters were also involved in the clinical care of these subjects.

Back to Top | Article Outline

2.4. Genotyping of Bdnf+/+ and +/− rats

Animal experiments were conducted under a protocol approved by the Clinical Center Animal Care and Use Committee. Rats were genotyped by 2 separate methods in an unbiased manner. Frozen liver samples were collected and sent to TransnetYX for genotyping to detect the 7 bp deletion (SD-Bdnftm1sage; Horizon Discovery, Cambridge, United Kingdom). Genotyping was performed using real-time PCR with a TaqMan reporter probe and the following primers: Fwd GATGCCGCAAACATGTCTATGAG; Rev CCACTCGCTAATACTGTCACACA; Reporter CCCCGCCCGCCGTG. All animals corresponded to the expected genotype as determined by the vendor (SAGE Labs) before shipment of the animals. Two cohorts of N = 5 per group male Bdnf+/+ and Bdnf+/− rats were assessed in the current study. The genotype was corroborated by RNA-Seq analyses performed on the DRG in 5/10 animals of each genotype and on the dorsal spinal cord for 10 animals. Using a grep-based search strategy, reads were extracted in an alignment-independent fashion surrounding the deletion, identifying all but one animal as the expected genotype based on the absence or presence of reads containing the deletion. This classification is imperfect due to the possibility that an mRNA containing the deletion may not be detected if the coverage is poor. For the one animal for which RNA-Seq did not detect reads containing the deletion, 3 samples of the animal's liver were sent to TransnetYX, all 3 of which confirmed the correct genotype. This confirms that misclassification by the RNA-Seq method was due to lack of coverage at the deletion locus. Overall, transcript levels of Bdnf did not differ between Bdnf+/+ and Bdnf+/− animals, suggesting that the mutant transcript is stable (supplementary Figure 3, available at http://links.lww.com/PAIN/A732).

Back to Top | Article Outline

2.5. Radiant thermal and noxious cold stimulation

All behavioral assessments were performed by an experimenter who was blinded to the genotype at the time of testing. Sample sizes were determined based on previous experience with similar testing paradigms. Rats were enclosed in individual boxes on a 2.5-mm-thick elevated glass plate, and radiant heat stimulation was applied to the plantar surface of the hind paw using a focused infrared halogen bulb (Plantar Test; Ugo Basille, Monvalle VA, Italy).28,45 Heating was terminated when the animal withdrew the hind limb, and behavior was scored as the latency to withdraw. To determine temperature over time, the same radiant heat stimulus was delivered to awake animals while standing on a thermistor wire (type K) connected to a USB universal thermocouple connector (Omega Engineering Inc, Stamford, CT) to measure the temperature at the skin's surface. Temperature-over-time curves were used to convert latency measurements into temperature of withdrawal.

Measurements of acute cold pain were based on a similar method published previously.7 Powdered dry ice was compacted into the barrel of a 12-mm diameter plastic syringe and used to deliver a cold stimulus to the plantar surface.7 Briefly, animals were enclosed in individual clear plastic boxes on an elevated glass platform that was 2.5-mm thick, and cold stimulation was delivered to the animal's plantar hind paw from below. Care was taken to ensure a smooth surface of the dry ice, and light pressure was applied to make contact between the dry ice and the glass. Withdrawal latency and thermistor measurements were made in the same manner as for radiant thermal stimulation.

Back to Top | Article Outline

2.6. Hot- and cold-plate behavioral assessment

To determine behavioral response to noxious heat, animals were placed on a hot plate set to 48°C until they licked their hind paw twice and latency to first and second hind paw licks were recorded.1 This temperature was chosen because it is at the low end of the noxious range usually used to perform this test, where we hypothesized the greatest likelihood of differentiating the 2 groups. To assess responses to noxious cold, animals were placed on the same plate, and behaviors were recorded for 5 minutes using an iPhone 6 (Apple, Cupertino, CA). Behaviors were scored manually, and values were checked for agreement by 3 observers, one of whom was blinded to experimental conditions. During the cold-plate assay, the rats displayed avoidance behaviors by lifting their tail off the surface of the plate. The sum of the duration of avoidance episodes was determined from the video recordings by observers blinded to the genotype.

Back to Top | Article Outline

2.7. Aδ stimulation using 100-ms infrared diode laser pulse

Animals were set on the same glass platform as for noxious cold stimulation, and an infrared diode laser (LASS-10 M; Lasmed, Mountain View, CA) with an output wavelength of 980 nm was used to deliver 100-ms thermal stimuli of approximately 1.6-mm diameter to the heel and plantar surface of the rat hind paw. This stimulus has previously been shown to selectively activate Aδ-fiber-mediated nociceptors.41,58 Laser stimulator was operated as described previously41,42 with an output between 3000 and 5500 mA to obtain a stimulus-response function. After delivering a stimulus, animals were scored for behavior according to the following rubric: 0 = no response, 1 = simple withdrawal, 2 = paw shake, 3 = orient towards paw, and 4 = paw lick. Statistics were performed on average behavioral values using the Mann–Whitney U test to account for ordinal rank orders. Response ratios were calculated by considering 0s vs all responses regardless of severity.

Back to Top | Article Outline

2.8. RNA extraction and sequencing

RNA extraction was performed using a bead-beating homogenizer (MP Biomedicals, Santa Ana, CA) and the RNeasy Lipid Tissue Mini Kit as described previously.34,48 Sequencing was performed at the NIH Intramural Sequencing Center, as described previously.48 Briefly, mRNA libraries were constructed starting from 1-µg total RNA using the Illumina TruSeq RNA Sample Prep Kits, version 2. The resulting cDNA was fragmented using a Covaris E210. Library amplification was performed for 10 cycles to minimize the risk of overamplification. Unique barcode adapters were applied to each library. Libraries were pooled in an equimolar ratio and sequenced together on a HiSeq 2500 with ver 4 flow cells and sequencing reagents. A minimum of 70 million 125-base read pairs were generated for each DRG library, and a minimum of 23 million 125-base read pairs were generated for each dorsal horn library.

Back to Top | Article Outline

2.9. Transcriptomic analyses

Several data sets were mined from previous publications.50 Mouse brain neural and non-neural cell population RNA expression data were mined from a previous database64 and used to categorize significantly regulated genes.48 Heatmap data were constructed from expression data mined from the human GTEx database and plotted as a ratio of expression per gene to identify tissue enrichment for genes of interest.8,50 Rat DRG and dorsal spinal cord data sets generated for this manuscript were aligned and quantified using MAGIC34,63 and a rat genome with annotations built based on rn6.34 Gene expression values are represented using significant fragments per kilobase of transcript per million aligned reads (sFPKM), a MAGIC-specific quantification method.34,63 Significantly differential genes were determined by controlling the false discovery rate at 5% after comparing against 80 orthogonally scrambled iterations of sample groupings to control for variance.34,48 In the dorsal horn data set, which was collected after the DRG data set, several candidate genes were examined using uncorrected Mann–Whitney U tests based on previous observations in the DRG. Gene expression and fold changes were analyzed for interactions using Ingenuity Pathway Analysis (Qiagen, Hilden, Germany).

Back to Top | Article Outline

2.10. Data availability

Rat sequencing data from the DRG and dorsal horn of Bdnf+/+ and Bdnf+/− animals have been deposited into the Sequence Read Archive under BioProject number (to be released upon publication of this manuscript).

Back to Top | Article Outline

2.11. Statistical analyses

Linear mixed-effects models were constructed in SAS 9.4 (SAS Institute Inc, Cary, NC) for human sensory testing data (Figs. 1D and E) using rating, temperature, baseline response, and IQ as fixed effects, with individual as a random effect. In these models, temperature was considered as a factor to account for nonlinearity in temperature ratings. Sensitivity analysis was performed to examine the effect of IQ on thermal ratings from QST (supplementary Figure 2, available at http://links.lww.com/PAIN/A732). A similar linear mixed-effects model was constructed for the cold-plate assay (tail lifting) using temperature and genotype as fixed effects and animal number as a random effect. For all models, least square means tests are reported for each measurement. Mann–Whitney U tests and Student T tests were performed in Prism 7 (GraphPad Software, LaJolla, CA). Full results from all statistical tests are reported in the supplementary data files (available at http://links.lww.com/PAIN/A732). For RNA-Seq data sets, statistical analyses were performed using MAGIC.34 Gene ontology terms and related statistics were calculated in DAVID 6.8 (https://david.ncifcrf.gov/).

Back to Top | Article Outline

3. Results

3.1. Parental reports

Parents of BDNF+/− WAGR subjects were significantly more likely to provide descriptions of their child's pain insensitivity in the optional comments section of the Non-Communicating Children's Pain Checklist–Revised6,23 (Fig. 1C; supplementary Figure 1, available at http://links.lww.com/PAIN/A732). These reports contained striking details of severely reduced pain sensitivity resembling those observed in cases of complete pain insensitivity syndromes: (1) “Got his toe caught in our gate and it ripped a big 1/2-inch gouge in it. It was bleeding pretty heavily and the skin was just hanging off. He also broke a bone in his hand while riding a bike, we didn't notice the bruise until the next day.” (2) “I believe there are many times when I know nothing. She had a punctured ear drum once that I only discovered from the discharge coming out. Took her to the doctor and asked her if her ear hurt and she said, “not really.” (3) “When she complains of having pain or not feeling well, it is so rare for her to do so that now we always know to listen. Another time she was trying to sit on a lunch table bench at school, missed, and hit her collar bone: they examined her at school, but since she hardly complained they let her finish out the day. When she came home, we weren't sure ourselves, but decided to have her checked out for reasons previously stated—sure enough: broken clavicle.” These reports are consistent with an impairment in nociception and/or increased pain tolerance, but not complete lack of pain sensation as is observed in patients with mutations in NGF,9,11,17TRKA,30 or PRDM1213 genes, all of which lead to developmental loss of entire subpopulations of primary afferent nociceptors and, consequently, cause a complete loss of painful sensations.10,19,35 These parental reports prompted further investigation of pain insensitivity using QST.

Back to Top | Article Outline

3.2. Quantitative sensory testing

Based on the parental reports, we tested the hypothesis that BDNF hemizygosity may lead to an impairment in nociceptive processing. We performed QST to determine the ability of BDNF+/− subjects to rate hot and cold stimuli. Subjects were asked to rate pain intensity of each temperature delivered using a 6-point Wong–Baker FACES Pain Rating Scale,61 which has been validated in children as young as 3 years of age; the youngest subject in our study was 6 years old (Fig. 1B). The average rating of 4 replicates for each temperature (2 on the right forearm and 2 on the left forearm) was used for analyses. Figures 1D and E show the average rating for all subjects (black and red lines) and the average data for each patient (black and red circles) at each temperature. Quantitative sensory testing showed comparable ratings for non-noxious warm (35°C) and cool (29°C) temperatures (P = 0.49 and P = 0.18, respectively). However, when tested over a range of hot (43-49°C) and cold (14-2°C) stimuli, BDNF+/− WAGR subjects rated these stimuli as significantly less painful (Figs. 1D and E).

Back to Top | Article Outline

3.3. Bioinformatic analysis of WAGR gene deletion locus

Several genes are located at the deletion boundary that separates the 2 groups of individuals in this study (Fig. 2A), and several of these genes are expressed in pain circuit tissues (supplementary Figure 4, available at http://links.lww.com/PAIN/A732). Despite the large number of genes in the WAGR locus, a substantially smaller subset of genes is located in the subregion of the locus that differentiates the 2 groups of WAGR subjects. Of this subset of genes, BDNF expression is most highly enriched in pain circuit tissues such as the DRG (Fig. 2B) as compared to other regions of the human body.

Figure 2

Figure 2

Back to Top | Article Outline

3.4. Heterozygous knockout rat

To assess the role of BDNF haploinsufficiency specifically, we performed nociceptive testing on rats harboring a loss of function frameshift mutation within the Bdnf gene on one allele (Bdnf+/−; SD-Bdnftm1sage, Horizon Discovery, Cambridge, United Kingdom).56 Expression from both alleles, and in wild-type (WT) rats, was assessed by RNA-Seq, revealing equal levels of Bdnf transcripts; however, approximately half of the transcript from the +/− animals contained the deletion, which introduced a frameshift and stop codon shortly after the propeptide cleavage site (supplementary Figure 3, available at http://links.lww.com/PAIN/A732). Previous studies in the same strain have showed that serum levels of BDNF are reduced by approximately 50%.56 All behavioral assessments in rats were performed by an individual blinded to the genotype. Heat was delivered to the hind paw by a focused halogen bulb, terminating when the animal withdrew its hind limb28,45 (Plantar Test; Ugo Basille) and calibrated using the thermistor wire (see Methods). Bdnf+/− rats exhibited a significantly increased latency to withdrawal corresponding to a higher temperature of withdrawal (44.6°C for +/+ vs 46.5°C for +/−; Figs. 3A and B).

Sensitivity to noxious cold was tested by measuring withdrawal latency upon application of an aversive cold stimulus to the hind paw as described by Brenner et al.7 using a compacted dry ice stimulus. Relative to Bdnf+/+ rats, Bdnf+/− rats exhibited a significantly longer latency to withdraw from the cold stimulus, corresponding to a colder temperature of withdrawal (18.5°C for +/+ vs 12.9°C for +/−; Figs. 3C and D).

Figure 3

Figure 3

Heat sensitivity was also examined using the hot-plate test (48°C) and measuring the latency to hind paw licking behavior.1 The lower temperature was chosen because it is at the low end of the noxious range commonly used, where we hypothesized the greatest chance of seeing a behavioral difference between groups. Bdnf+/− rats exhibited significantly longer latencies to lick their hind paws on the hot plate compared with the Bdnf+/+ littermates (for Bdnf+/− compared with WT, respectively: 95.4 ± 49.3 vs 45.2 ± 10.6 seconds for the first lick, and 118.2 ± 47.2 vs 68.2 ± 15.3 seconds for the second lick; Fig. 3E).

Cold sensitivity was assessed further by recording spontaneous cold avoidance behaviors using a cold plate. Animals were tested at plate temperatures of 34, 23, 10, 8, 6, and 4°C (Fig. 3F). From blinded evaluation of video recordings of this test, we observed that, in response to noxious cold temperatures, WT rats raised their tail to avoid contact with the cold surface. Quantification of this endpoint showed that Bdnf+/− animals exhibited significantly less total duration of tail lifting (genotype effect, P = 0.0006, Fig. 3G), indicating a reduced, but not abolished, avoidance of noxious cold temperatures.

In addition to the hot plate and C-fiber noxious heat-mediated responses, Bdnf+/− rats were tested for responsiveness to Aδ-mediated3 hind limb withdrawal to short (100 ms) heat pulses delivered by an infrared diode laser. Animals were tested over a range of laser intensities on both the heel and plantar surfaces of the hind paw42,48 (Fig. 4). Relative to Bdnf+/+ rats, Bdnf+/− animals showed a reduction in responsiveness to the short thermal Aδ stimuli relative to WT littermates. Although their responses are reduced, the rats approach 100% response rates at the highest level of intensity on the more sensitive midplantar area of skin (Fig. 4D), indicating an ability to respond to sufficiently strong stimulation.

As a nonthermal behavioral assay, both groups of rats were tested using von Frey filaments, with the Bdnf+/− rats requiring larger filaments (more force) to evoke a withdrawal response (supplementary Figure 5, available at http://links.lww.com/PAIN/A732).

Figure 4

Figure 4

Back to Top | Article Outline

3.5. Dorsal root ganglion and dorsal spinal cord transcriptomic analyses

Using RNA-Seq, we examined gene expression in Bdnf+/− and Bdnf+/+ rats in both the DRG and dorsal spinal cord. In the DRG, our results indicated no reduction in molecular markers for any specific sensory cell type or functional modality. We previously validated this method to detect deletion vs preservation of specific neuronal subtypes within the DRG.51 Our quantification includes examination of genes encoding ion channels such as Trpv1 and Trpm8, which transduce hot and cold thermal stimuli (Fig. 5A; supplementary Fig. 6, available at http://links.lww.com/PAIN/A732), which were not differential in the DRG. In the dorsal horn of the spinal cord, the overall number of significantly differential genes was greater than in the DRG (Fig. 5B). We did not observe alterations in known markers of spinal second-order nociceptive neurons. Markers of these cells were examined because deletion of cells expressing the substance P/neurokinin1 receptor (Tacr1) is known to cause profound pain insensitivity.29,39 Of the genes that are altered, we see some evidence that neuropeptide signaling may be modified in Bdnf+/− rats (supplementary Figures 6, 7; available at http://links.lww.com/PAIN/A732), with the gene encoding corticotrophin-releasing hormone (Crh) strongly reduced in the deleted animals in both tissues examined (supplementary Figure 8, available at http://links.lww.com/PAIN/A732). This is consistent with other reports where decreased Bdnf expression, or that of its receptor, was associated with decreased Crh expression.31 However, this gene is not highly expressed, and it is unclear to what extent Crh signaling contributes to the Bdnf+/− phenotype. Based on sequencing experiments of glia and other non-neural nervous system cells,64 many of the significantly differential genes are expressed in astrocytes and microglia (Figs. 5C and D), pointing to changes in gene expression programs within glial cells, perhaps responding to, or driven by altered neuronal signaling in the spinal cord (supplementary Figure 9, available at http://links.lww.com/PAIN/A732). Ingenuity Pathway Analysis was performed to identify common hub genes based on the observed gene changes. Based on these analyses, many of the genes observed to be altered in Bdnf+/− animals are related to interferon signaling, and all of them are upregulated (Fig. 5E; supplementary Figure 10, available at http://links.lww.com/PAIN/A732). In addition, 2 of the most strongly differential genes in our data set have also been observed in another report using transcriptomics to examine genes that regulate sensitivity in a rat neuropathic pain model,59 as discussed below.

Figure 5

Figure 5

Back to Top | Article Outline

4. Discussion

Most human genetic pain insensitivity syndromes described to date affect primary afferent neurons, leading to inability to transduce noxious stimuli.52 This study supports the finding that Bdnf haploinsufficiency leads to modulation of pain sensitivity without loss of primary afferent neurons, a result consistent with previous studies showing unaltered DRG nociceptor populations in conditional homozygous Bdnf knockout mice.26,65 Behavioral results from thermal testing of both human WAGR subjects and Bdnf+/− rats point to a model where BDNF haploinsufficiency produces an elevated pain threshold that can be superseded by sufficiently strong stimulation. Our transcriptomic evidence points to a broader alteration in gene expression from Bdnf haploinsufficiency in the dorsal spinal cord than in the DRG (Fig. 5). In concert with our behavioral battery, this suggests a system where transmission in peripheral afferent nociceptors is intact, but the synaptic transmission of these signals to spinal second-order neurons, or transmission of the signals by second-order neurons to higher CNS regions, is potentially disrupted, requiring abnormally strong stimuli to elicit responses.40 In part, this may be attributable to altered synaptic efficacy between components of the nociceptive circuitry, which has been reported at a number of synapses throughout the CNS.5,54 Given the lack of gene signatures indicative of DRG neuronal disruption, the results are suggestive of congenital indifference to pain,47 although parsing indifference vs insensitivity in WAGR subjects is challenging due to their rarity, young age, and intellectual disabilities.

Previous experiments using Bdnf knockout mice to examine basal pain sensitivity have yielded conflicting results, with at least one study showing sensitization to some forms of thermal stimulation in DRG-specific Bdnf−/− mice.65 At least one other study using Bdnf+/− mice showed no difference in baseline thermal pain sensitivity.62 To add to these apparently conflicting results, reduced sensitivity to thermal sensations has been observed using a hot-plate test in both Bdnf+/− mice and DRG-specific Bdnf−/− mice36,53 consistent with our results in the rat. Overall, strain and species differences as well as technical elements may have contributed to some differences in findings. However, based on mouse studies, it has generally been accepted that BDNF plays a role in the transition from acute to chronic pain, and not in the determination of pain sensitivity.53 The Bdnf gene is strongly upregulated by persistent inflammatory pain38 (supplementary Figure 11, available at http://links.lww.com/PAIN/A732), supporting its role in the plasticities that occur in the transition between acute and chronic pain.49 Our results point to actions of Bdnf in the spinal cord or other pain modulatory circuit regions, such as the brainstem,49 and are consistent with earlier studies in rats which indicated a CNS site of action.32 It has also been suggested that spinal BDNF contributes to hyperalgesia by sensitizing second-order dorsal horn neurons.4,20 BDNF secretion from glial cells has been implicated in regulating many functions related to learning and memory55 and has been implicated in modulation of pain states.14 Based on these aggregated findings, BDNF most likely acts at a variety of different sites throughout the neuraxis to modulate pain sensitivity.

However, it seems likely that BDNF does modulate the activity of glial and/or immune-like cells in the spinal cord, based on the relatively large number of regulated genes in the spinal cord that are differentially expressed in response to Bdnf haploinsufficiency. Within this gene set, the most prominent changes are related to interferon signaling, which is known to participate in neuron–glia interactions, and which has been shown to regulate pain states.57 In addition to this, it is notable that 2 of the most highly regulated and most highly expressed genes in our data set (Serpina3n and Fam111a) are the only 2 genes identified by a microarray-based study examining high and low pain-sensitive animals after a sciatic nerve ligation model of neuropathic pain.59 Of particular interest, Serpina3n, a secreted serine protease inhibitor, was posited by the authors of that study to participate in the intercellular communication between neurons and immune cells. Relatedly, treatment of leukocytes with Serpina3n prevented neuronal killing in a neurodegeneration context.22 In the context of the present article, it is perhaps more likely that the biological process engaged has to do with the formation of appropriate synapses and/or removal or pruning of synapses, as this process is known to involve Bdnf, neuron–glia interactions, and interferon signaling.2 A working model could be that a reduced Bdnf signaling alters pruning of synapses through neuroimmune recruitment, and ultimately a deficit in processing of incoming painful sensations, and is an area that is being actively investigated.44,46

The significance of BDNF as a pain modulatory gene is evident based on the magnitude and penetrance of the observed reduction in pain sensitivity phenotype. Pain drives individuals to seek medical intervention. In the specific case of WAGR syndrome, these patients are at risk of developing pancreatitis,18 which is frequently accompanied by severe abdominal pain. Diagnosis and treatment of painful medical emergencies can be delayed in patients with pain insensitivity37 such as that observed in WAGR syndrome, emphasizing a need for close monitoring of patient symptoms. In terms of translational potential for analgesia, our data suggest that BDNF may be part of a larger gene network that modulates the complex trait of pain sensitivity in the general population.52 Additional studies may further elucidate the relationship between BDNF and nociceptive sensitivity, a topic that has been investigated in a limited manner with regard to the relatively common Val66Met polymorphism.15,60 In addition, although this study did not specifically examine a potential role of pro-BDNF in pain, recent work has investigated its role in hippocampal plasticity.21,43 Ultimately, a greater understanding of these pain regulatory circuits may aid in the development of new analgesic approaches.

Back to Top | Article Outline

Conflict of interest statement

JCH is a principal investigator for clinical trials sponsored by Rhythm Pharmaceuticals and Insys Therapeutics. The remaining authors have no conflict of interest to declare.

Back to Top | Article Outline

Acknowledgements

The authors thank Matthew Tsang, Miriya Tune, Kyra Jefferson-George, and Jamila Crossman for technical assistance. The authors also thank the families of the International WAGR Syndrome Association for promotion and participation in the clinical studies. Data presented in this manuscript were collected under a registered clinical trial (NCT00758108). The authors thank Xiaobai Li for assistance with statistical analyses.

This research was supported by the Intramural Research Program of NICHD, NIMH, and the NIH Clinical Center with supplemental funding from the NIH Bench-to-Bedside Program to J.C. Han and to M.J. Iadarola from NCCIH and the Office of Behavioral and Social Sciences.

Author Contributions: M.R. Sapio designed experiments, performed behavioral testing and RNA-Seq analyses on animals, performed statistics, constructed figures, and analyzed and interpreted the data. D.M. LaPaglia analyzed the data, constructed figures, and extracted RNA. T. Lehky performed and interpreted nerve conduction measurements for human subjects. A.E. Thurm performed and interpreted cognitive testing in human subjects, and assisted in designing and interpreting the pain assessments for human subjects. K.M. Danley, S.R. Fuhr, M.D. Lee, and A.E. Huey directly performed or supervised research assistants in pain testing of human subjects. S.J. Sharp and J.W. Tsao performed and interpreted neurological examinations on human subjects. M.J. Iadarola analyzed the data and supervised behavioral assessments. J.C. Han designed human pain testing methods adapted for visual impairment, performed statistics, and analyzed the human subject data. M.J. Iadarola, J.A. Yanovski, A.J. Mannes, and J.C. Han supervised the overall project and management. M.J. Iadarola, J.A. Yanovski, and J.C. Han conceived the project. M.R. Sapio, M.J. Iadarola, and J.C. Han prepared the manuscript.

Back to Top | Article Outline

Supplemental digital content

Supplemental digital content associated with this article can be found online at http://links.lww.com/PAIN/A732 and http://links.lww.com/PAIN/A731.

Back to Top | Article Outline

Supplemental video content

Video content associated with this article can be found online at http://links.lww.com/PAIN/A731.

Back to Top | Article Outline

References

[1]. Barrot M. Tests and models of nociception and pain in rodents. Neuroscience 2012;211:39–50.
[2]. Bialas AR, Presumey J, Das A, van der Poel CE, Lapchak PH, Mesin L, Victora G, Tsokos GC, Mawrin C, Herbst R, Carroll MC. Microglia-dependent synapse loss in type I interferon-mediated lupus. Nature 2017;546:539–43.
[3]. Blivis D, Haspel G, Mannes PZ, O'Donovan MJ, Iadarola MJ. Identification of a novel spinal nociceptive-motor gate control for Adelta pain stimuli in rats. Elife 2017;6:e23584.
[4]. Boyce VS, Park J, Gage FH, Mendell LM. Differential effects of brain-derived neurotrophic factor and neurotrophin-3 on hindlimb function in paraplegic rats. Eur J Neurosci 2012;35:221–32.
[5]. Bramham CR, Messaoudi E. BDNF function in adult synaptic plasticity: the synaptic consolidation hypothesis. Prog Neurobiol 2005;76:99–125.
[6]. Breau LM, McGrath PJ, Camfield CS, Finley GA. Psychometric properties of the non-communicating children's pain checklist-revised. PAIN 2002;99:349–57.
[7]. Brenner DS, Golden JP, Gereau RW. A novel behavioral assay for measuring cold sensation in mice. PLoS One 2012;7:e39765.
[8]. Burbelo PD, Iadarola MJ, Alevizos I, Sapio MR. Transcriptomic segregation of human autoantigens useful for the diagnosis of autoimmune diseases. Mol Diagn Ther 2016;20:415–27.
[9]. Capsoni S, Covaceuszach S, Marinelli S, Ceci M, Bernardo A, Minghetti L, Ugolini G, Pavone F, Cattaneo A. Taking pain out of NGF: a “painless” NGF mutant, linked to hereditary sensory autonomic neuropathy type V, with full neurotrophic activity. PloS One 2011;6:e17321.
[10]. Carroll SL, Silos-Santiago I, Frese SE, Ruit KG, Milbrandt J, Snider WD. Dorsal root ganglion neurons expressing trk are selectively sensitive to NGF deprivation in utero. Neuron 1992;9:779–88.
[11]. Carvalho OP, Thornton GK, Hertecant J, Houlden H, Nicholas AK, Cox JJ, Rielly M, Al-Gazali L, Woods CG. A novel NGF mutation clarifies the molecular mechanism and extends the phenotypic spectrum of the HSAN5 neuropathy. J Med Genet 2011;48:131–5.
[12]. Charlesworth G, Plagnol V, Holmström KM, Bras J, Sheerin UM, Preza E, Rubio-Agusti I, Ryten M, Schneider SA, Stamelou M, Trabzuni D, Abramov AY, Bhatia KP, Wood NW. Mutations in ANO3 cause dominant craniocervical dystonia: ion channel implicated in pathogenesis. Am J Hum Genet 2012;91:1041–50.
    [13]. Chen YC, Auer-Grumbach M, Matsukawa S, Zitzelsberger M, Themistocleous AC, Strom TM, Samara C, Moore AW, Cho LT, Young GT, Weiss C, Schabhüttl M, Stucka R, Schmid AB, Parman Y, Graul-Neumann L, Heinritz W, Passarge E, Watson RM, Hertz JM, Moog U, Baumgartner M, Valente EM, Pereira D, Restrepo CM, Katona I, Dusl M, Stendel C, Wieland T, Stafford F, Reimann F, von Au K, Finke C, Willems PJ, Nahorski MS, Shaikh SS, Carvalho OP, Nicholas AK, Karbani G, McAleer MA, Cilio MR, McHugh JC, Murphy SM, Irvine AD, Jensen UB, Windhager R, Weis J, Bergmann C, Rautenstrauss B, Baets J, De Jonghe P, Reilly MM, Kropatsch R, Kurth I, Chrast R, Michiue T, Bennett DL, Woods CG, Senderek J. Transcriptional regulator PRDM12 is essential for human pain perception. Nat Genet 2015;47:803–8.
    [14]. Coull JA, Beggs S, Boudreau D, Boivin D, Tsuda M, Inoue K, Gravel C, Salter MW, De Koninck Y. BDNF from microglia causes the shift in neuronal anion gradient underlying neuropathic pain. Nature 2005;438:1017–21.
    [15]. Di Lorenzo C, Di Lorenzo G, Daverio A, Pasqualetti P, Coppola G, Giannoudas I, Barone Y, Grieco GS, Niolu C, Pascale E, Santorelli FM, Nicoletti F, Pierelli F, Siracusano A, Seri S. The Val66Met polymorphism of the BDNF gene influences trigeminal pain-related evoked responses. J Pain 2012;13:866–73.
    [16]. Dib-Hajj SD, Cummins TR, Black JA, Waxman SG. From genes to pain: Na v 1.7 and human pain disorders. Trends Neurosciences 2007;30:555–63.
    [17]. Einarsdottir E, Carlsson A, Minde J, Toolanen G, Svensson O, Solders G, Holmgren G, Holmberg D, Holmberg M. A mutation in the nerve growth factor beta gene (NGFB) causes loss of pain perception. Hum Mol Genet 2004;13:799–805.
    [18]. Fischbach BV, Trout KL, Lewis J, Luis CA, Sika M. WAGR syndrome: a clinical review of 54 cases. Pediatrics 2005;116:984–8.
    [19]. Fitzgerald M. The development of nociceptive circuits. Nat Rev Neurosci 2005;6:507–20.
    [20]. Garraway SM, Petruska JC, Mendell LM. BDNF sensitizes the response of lamina II neurons to high threshold primary afferent inputs. Eur J Neurosci 2003;18:2467–76.
    [21]. Giza JI, Kim J, Meyer HC, Anastasia A, Dincheva I, Zheng CI, Lopez K, Bains H, Yang J, Bracken C, Liston C, Jing D, Hempstead BL, Lee FS. The BDNF Val66Met prodomain disassembles dendritic spines altering fear extinction circuitry and behavior. Neuron 2018;99:163–78 e166.
    [22]. Haile Y, Carmine-Simmen K, Olechowski C, Kerr B, Bleackley RC, Giuliani F. Granzyme B-inhibitor serpina3n induces neuroprotection in vitro and in vivo. J Neuroinflammation 2015;12:157.
    [23]. Han JC, Liu QR, Jones M, Levinn RL, Menzie CM, Jefferson-George KS, Adler-Wailes DC, Sanford EL, Lacbawan FL, Uhl GR, Rennert OM, Yanovski JA. Brain-derived neurotrophic factor and obesity in the WAGR syndrome. N Engl J Med 2008;359:918–27.
    [24]. Han JC, Thurm A, Golden Williams C, Joseph LA, Zein WM, Brooks BP, Butman JA, Brady SM, Fuhr SR, Hicks MD, Huey AE, Hanish AE, Danley KM, Raygada MJ, Rennert OM, Martinowich K, Sharp SJ, Tsao JW, Swedo SE. Association of brain-derived neurotrophic factor (BDNF) haploinsufficiency with lower adaptive behaviour and reduced cognitive functioning in WAGR/11p13 deletion syndrome. Cortex 2013;49:2700–10.
    [25]. Hefti FF, Rosenthal A, Walicke PA, Wyatt S, Vergara G, Shelton DL, Davies AM. Novel class of pain drugs based on antagonism of NGF. Trends Pharmacol Sci 2006;27:85–91.
    [26]. Heppenstall PA, Lewin GR. BDNF but not NT-4 is required for normal flexion reflex plasticity and function. Proc Natl Acad Sci United States America 2001;98:8107–12.
    [27]. Huang F, Wang X, Ostertag EM, Nuwal T, Huang B, Jan YN, Basbaum AI, Jan LY. TMEM16C facilitates Na(+)-activated K+ currents in rat sensory neurons and regulates pain processing. Nat Neurosci 2013;16:1284–90.
      [28]. Iadarola MJ, Douglass J, Civelli O, Naranjo JR. Differential activation of spinal cord dynorphin and enkephalin neurons during hyperalgesia: evidence using cDNA hybridization. Brain Res 1988;455:205–12.
      [29]. Iadarola MJ, Sapio MR, Wang X, Carrero H, Virata-Theimer ML, Sarnovsky R, Mannes AJ, FitzGerald DJ. [EXPRESS]Analgesia by deletion of spinal neurokinin 1 receptor expressing neurons using a bioengineered substance P-Pseudomonas exotoxin conjugate. Mol pain 2017;13:1744806917727657.
      [30]. Indo Y, Tsuruta M, Hayashida Y, Karim MA, Ohta K, Kawano T, Mitsubuchi H, Tonoki H, Awaya Y, Matsuda I. Mutations in the TRKA/NGF receptor gene in patients with congenital insensitivity to pain with anhidrosis. Nat Genet 1996;13:485–8.
      [31]. Jeanneteau FD, Lambert WM, Ismaili N, Bath KG, Lee FS, Garabedian MJ, Chao MV. BDNF and glucocorticoids regulate corticotrophin-releasing hormone (CRH) homeostasis in the hypothalamus. Proc Natl Acad Sci USA 2012;109:1305–10.
      [32]. Kerr BJ, Bradbury EJ, Bennett DL, Trivedi PM, Dassan P, French J, Shelton DB, McMahon SB, Thompson SW. Brain-derived neurotrophic factor modulates nociceptive sensory inputs and NMDA-evoked responses in the rat spinal cord. J Neurosci 1999;19:5138–48.
      [33]. Kim H, Neubert JK, Rowan JS, Brahim JS, Iadarola MJ, Dionne RA. Comparison of experimental and acute clinical pain responses in humans as pain phenotypes. J Pain 2004;5:377–84.
      [34]. LaPaglia DM, Sapio MR, Burbelo PD, Thierry-Mieg J, Thierry-Mieg D, Raithel SJ, Ramsden CE, Iadarola MJ, Mannes AJ. RNA-Seq investigations of human post-mortem trigeminal ganglia. Cephalalgia 2018;38:912–32.
      [35]. Lewin GR, Mendell LM. Nerve growth factor and nociception. Trends Neurosci 1993;16:353–9.
      [36]. MacQueen GM, Ramakrishnan K, Croll SD, Siuciak JA, Yu G, Young LT, Fahnestock M. Performance of heterozygous brain-derived neurotrophic factor knockout mice on behavioral analogues of anxiety, nociception, and depression. Behav Neurosci 2001;115:1145–53.
      [37]. Mannes A, Iadarola M. Potential downsides of perfect pain relief. Nature 2007;446:24.
      [38]. Mannion RJ, Costigan M, Decosterd I, Amaya F, Ma QP, Holstege JC, Ji RR, Acheson A, Lindsay RM, Wilkinson GA, Woolf CJ. Neurotrophins: peripherally and centrally acting modulators of tactile stimulus-induced inflammatory pain hypersensitivity. Proc Natl Acad Sci USA 1999;96:9385–90.
      [39]. Mantyh PW, Rogers SD, Honore P, Allen BJ, Ghilardi JR, Li J, Daughters RS, Lappi DA, Wiley RG, Simone DA. Inhibition of hyperalgesia by ablation of lamina I spinal neurons expressing the substance P receptor. Science 1997;278:275–9.
      [40]. Merighi A, Salio C, Ghirri A, Lossi L, Ferrini F, Betelli C, Bardoni R. BDNF as a pain modulator. Prog Neurobiol 2008;85:297–317.
      [41]. Mitchell K, Bates BD, Keller JM, Lopez M, Scholl L, Navarro J, Madian N, Haspel G, Nemenov MI, Iadarola MJ. Ablation of rat TRPV1-expressing Adelta/C-fibers with resiniferatoxin: analysis of withdrawal behaviors, recovery of function and molecular correlates. Mol Pain 2010;6:94.
      [42]. Mitchell K, Lebovitz EE, Keller JM, Mannes AJ, Nemenov MI, Iadarola MJ. Nociception and inflammatory hyperalgesia evaluated in rodents using infrared laser stimulation after Trpv1 gene knockout or resiniferatoxin lesion. PAIN 2014;155:733–45.
      [43]. Mizui T, Ishikawa Y, Kumanogoh H, Lume M, Matsumoto T, Hara T, Yamawaki S, Takahashi M, Shiosaka S, Itami C, Uegaki K, Saarma M, Kojima M. BDNF pro-peptide actions facilitate hippocampal LTD and are altered by the common BDNF polymorphism Val66Met. Proc Natl Acad Sci U S A 2015;112:E3067–3074.
      [44]. Mogil JS. Sex-based divergence of mechanisms underlying pain and pain inhibition. Curr Opin Behav Sci 2018;23:113–17.
      [45]. Montagne-Clavel J, Oliveras JL. The “plantar test” apparatus (Ugo Basile Biological Apparatus), a controlled infrared noxious radiant heat stimulus for precise withdrawal latency measurement in the rat, as a tool for humans? Somatosens Mot Res 1996;13:215–23.
      [46]. Moy JK, Szabo-Pardi T, Tillu DV, Megat S, Pradhan G, Kume M, Asiedu MN, Burton MD, Dussor G, Price TJ. Temporal and sex differences in the role of BDNF/TrkB signaling in hyperalgesic priming in mice and rats. Neurobiol Pain 2018. .
      [47]. Nagasako EM, Oaklander AL, Dworkin RH. Congenital insensitivity to pain: an update. PAIN 2003;101:213–9.
      [48]. Raithel SJ, Sapio MR, LaPaglia DM, Iadarola MJ, Mannes AJ. Transcriptional changes in dorsal spinal cord persist after surgical incision despite preemptive analgesia with peripheral resiniferatoxin. Anesthesiology 2018;128:620–35.
      [49]. Ren K, Dubner R. Pain facilitation and activity-dependent plasticity in pain modulatory circuitry: role of BDNF-TrkB signaling and NMDA receptors. Mol Neurobiol 2007;35:224–35.
      [50]. Sapio MR, Goswami SC, Gross JR, Mannes AJ, Iadarola MJ. Transcriptomic analyses of genes and tissues in inherited sensory neuropathies. Exp Neurol 2016;283:375–95.
      [51]. Sapio MR, Neubert JK, LaPaglia DM, Maric D, Keller JM, Raithel SJ, Rohrs EL, Anderson EM, Butman JA, Caudle RM, Brown DC, Heiss JD, Mannes AJ, Iadarola MJ. Pain control through selective chemo-axotomy of centrally projecting TRPV1+ sensory neurons. J Clin Invest 2018;128:1657–70.
      [52]. Sexton JE, Cox JJ, Zhao J, Wood JN. The genetics of pain: implications for therapeutics. Annu Rev Pharmacol Toxicol 2018;58:123–42.
      [53]. Sikandar S, Minett MS, Millet Q, Santana-Varela S, Lau J, Wood JN, Zhao J. Brain-derived neurotrophic factor derived from sensory neurons plays a critical role in chronic pain. Brain 2018;141:1028–39.
      [54]. Snider WD. Functions of the neurotrophins during nervous system development: what the knockouts are teaching us. Cell 1994;77:627–38.
      [55]. Song M, Martinowich K, Lee FS. BDNF at the synapse: why location matters. Mol Psychiatry 2017;22:1370–5.
      [56]. St Laurent R, Helm SR, Glenn MJ. Reduced cocaine-seeking behavior in heterozygous BDNF knockout rats. Neurosci Lett 2013;544:94–9.
      [57]. Tsuda M, Masuda T, Kitano J, Shimoyama H, Tozaki-Saitoh H, Inoue K. IFN-gamma receptor signaling mediates spinal microglia activation driving neuropathic pain. Proc Natl Acad Sci USA 2009;106:8032–7.
      [58]. Tzabazis A, Klyukinov M, Manering N, Nemenov MI, Shafer SL, Yeomans DC. Differential activation of trigeminal C or Adelta nociceptors by infrared diode laser in rats: behavioral evidence. Brain Res 2005;1037:148–56.
      [59]. Vicuna L, Strochlic DE, Latremoliere A, Bali KK, Simonetti M, Husainie D, Prokosch S, Riva P, Griffin RS, Njoo C, Gehrig S, Mall MA, Arnold B, Devor M, Woolf CJ, Liberles SD, Costigan M, Kuner R. The serine protease inhibitor SerpinA3N attenuates neuropathic pain by inhibiting T cell-derived leukocyte elastase. Nat Med 2015;21:518–23.
      [60]. Wei SY, Chao HT, Tu CH, Lin MW, Li WC, Low I, Shen HD, Chen LF, Hsieh JC. The BDNF Val66Met polymorphism is associated with the functional connectivity dynamics of pain modulatory systems in primary dysmenorrhea. Sci Rep 2016;6:23639.
      [61]. Wong DL, Baker CM. Smiling faces as anchor for pain intensity scales. PAIN 2001;89:295–300.
      [62]. Yajima Y, Narita M, Usui A, Kaneko C, Miyatake M, Narita M, Yamaguchi T, Tamaki H, Wachi H, Seyama Y, Suzuki T. Direct evidence for the involvement of brain-derived neurotrophic factor in the development of a neuropathic pain-like state in mice. J Neurochem 2005;93:584–94.
      [63]. Zhang W, Yu Y, Hertwig F, Thierry-Mieg J, Zhang W, Thierry-Mieg D, Wang J, Furlanello C, Devanarayan V, Cheng J, Deng Y, Hero B, Hong H, Jia M, Li L, Lin SM, Nikolsky Y, Oberthuer A, Qing T, Su Z, Volland R, Wang C, Wang MD, Ai J, Albanese D, Asgharzadeh S, Avigad S, Bao W, Bessarabova M, Brilliant MH, Brors B, Chierici M, Chu TM, Zhang J, Grundy RG, He MM, Hebbring S, Kaufman HL, Lababidi S, Lancashire LJ, Li Y, Lu XX, Luo H, Ma X, Ning B, Noguera R, Peifer M, Phan JH, Roels F, Rosswog C, Shao S, Shen J, Theissen J, Tonini GP, Vandesompele J, Wu PY, Xiao W, Xu J, Xu W, Xuan J, Yang Y, Ye Z, Dong Z, Zhang KK, Yin Y, Zhao C, Zheng Y, Wolfinger RD, Shi T, Malkas LH, Berthold F, Wang J, Tong W, Shi L, Peng Z, Fischer M. Comparison of RNA-seq and microarray-based models for clinical endpoint prediction. Genome Biol 2015;16:133.
      [64]. Zhang Y, Chen K, Sloan SA, Bennett ML, Scholze AR, O'Keeffe S, Phatnani HP, Guarnieri P, Caneda C, Ruderisch N, Deng S, Liddelow SA, Zhang C, Daneman R, Maniatis T, Barres BA, Wu JQ. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. J Neurosci 2014;34:11929–47.
      [65]. Zhao J, Seereeram A, Nassar MA, Levato A, Pezet S, Hathaway G, Morenilla-Palao C, Stirling C, Fitzgerald M, McMahon SB, Rios M, Wood JN, London Pain C. Nociceptor-derived brain-derived neurotrophic factor regulates acute and inflammatory but not neuropathic pain. Mol Cell neurosciences 2006;31:539–48.
      Keywords:

      BDNF; Pain sensitivity; Nociception; Nerve growth factor; RNA-Seq

      Supplemental Digital Content

      Back to Top | Article Outline
      © 2019 International Association for the Study of Pain