Journal Logo

Research Paper

Peripheral inflammatory pain sensitisation is independent of mast cell activation in male mice

Lopes, Douglas M.*; Denk, Franziska; Chisholm, Kim I.; Suddason, Tesha; Durrieux, Camille; Thakur, Matthew; Gentry, Clive; McMahon, Stephen B.

Author Information
doi: 10.1097/j.pain.0000000000000917

1. Introduction

The cross-talk between sensory and immune systems is well recognised. Indeed, the close physical proximity of nociceptors and immune cells, particularly in peripheral tissues, makes these systems key subjects of study in both acute and chronic pain states.34,53,68,71 Though the mechanisms of interaction are not fully understood, a number of studies demonstrate that on injury, inflammation triggers the activation of resident and innate immune cells. This results in the release of proinflammatory mediators, culminating in the sensitization of nociceptors, hyperalgesia, and persistent pain.53,68,83 Growing evidence also suggests that nociceptors in turn can impact on immune cell function, modulating intracellular properties and giving rise to some long lasting conditions, such as arthritis.1,19,24,40,53

Whereas, some populations of immune cells, such as macrophages and neutrophils, have an established role in neuropathic and inflammatory pain,7,8,20,48,56,64,68,76,85 the role of mast cells (MC) as a mediator of nociceptor sensitisation is much less clear. Mast cells are known for the presence of granule-like structures (vesicles), which on activation release a variety of inflammatory mediators, including chemokines, growth factors, and neuropeptides.2,29,37,60 Beyond their well-established role in allergy due to histamine secretion, MC have also been linked to an array of chronic pathological conditions such as bladder pain syndrome, irritable bowel syndrome, and migraine.2,5,16,46,60,61 Furthermore, a few studies suggest that MC might be involved in acute peripheral inflammatory pain. It has been shown that thermal and mechanical hypersensitivity resulting from systemic administration of nerve growth factor (NGF) could be prevented if MC function was blocked.47 Since then, other studies using different inflammatory models have also proposed a role for MC in hyperalgesia and allodynia.23,25,69,81,85 Most recently, it was shown that mice with disrupted c-Kit signalling (a kinase crucial for MC development10) display altered pain thresholds.38,49 Although interesting, none of the studies to date conclusively demonstrate that the effects observed are because of MC ablation, rather than attributable to off target or compensatory effects.

Here we set out to test the role of MC in inflammatory pain using a novel tool which allows the specific ablation of these cells in an inducible manner by administration of diphtheria toxin (DTTx). In this model, DTTx treatment led to depletion of MC in the skin of Mcpt5-iDTR mice. Ablation of skin MC had no effect on mechanical hypersensitivity triggered by local injection of NGF. Furthermore, our experiments also demonstrate that loss of MC function has no effect in a long lasting acute model of inflammatory pain. Taken together, our results suggest that MC play, if any, only a very minor role in inflammatory pain.

2. Methods

2.1. Transgenic animal model

Mcpt5-iDTR mice26 were obtained from the laboratory of Axel Roers and maintained homozygous for iDTR and hemizygous for Mcpt5-Cre on a C57BL/6J background. After initial skin mast cell depletion studies (Fig. 1A–D), all experiments were conducted in male mice only. The colony was maintained and genotyped by an independent experimenter, to ensure effective blinding during any behavioural testing.

Figure 1.
Figure 1.:
Depletion of mast cells (MC) in the Mcpt5-iDTR mouse model. (A and C) Representative pictures of hairy skin (dorsal paw) from Mcpt5-iDTR and control animals (iDTR) stained with toluidine blue, after treatment with diphtheria toxin (DTTx). Quantification shows that in males (B) MC were almost entirely depleted in both hairy and glabrous skin (*P ≤ 0.05). By contrast, Mcpt5-iDTR females (C and D) only showed a mild reduction in the number of MC in comparison with their littermate controls (iDTR) (P > 0.05) (E) Behavioural evaluation demonstrates no difference in mechanical withdrawal threshold between groups before or after DTTx treatment (main effect of treatment: F (1, 11) = 0.49, P > 0.05; main effect of time: F (1, 11) = 1.38, P > 0.05). Data are means ± SEM. n = 3 to 4 per group, 1-tailed Mann–Whitney test (A and B); n = 9 (iDTR) and 6 (Mcpt5-iDTR); 2-way repeated measures ANOVA (E).

2.2. Diphtheria toxin dosing

All mice were 3 to 9 months of age when DTTx treatment commenced. Mcpt5-iDTR (Mcpt5-Cre; iDTRflox/flox) and control littermates (iDTRflox/flox) were dosed with an i.p. injection of DTTx (25 ng/g; Sigma Aldrich) once a week over 4 consecutive weeks. Before the first injection, animals were injected with H1-antagonist pyrilamine (5 μg/g; Pyrilamine Maleate Salt, Sigma Aldrich) to avoid toxicity because of mast cell degranulation. All experiments were performed in accordance with the UK Animals (Scientific Procedures) Act 1986 and Local Ethical Committee approval.

2.3. Toluidine blue staining

Mice were deeply anesthetized and transcardially perfused with 4% PFA in PBS. Plantar skin was collected and postfixed for 1 hour at room temperature. Following fixation, tissue was immersed in 30% sucrose/PBS (overnight) and then mounted in OCT. Serial sagittal sections (10 μm thick) were cut with a microtome and immediately collected onto slides (Superfrost Plus–VWR) coated with 2% gelatine. Slides were rinsed in water, dipped in 0.5% toluidine blue solution (pH 4) for 2 minutes, washed with water, and mounted with DPX. Mosaics of single plane images were captured on using Axiovision LE Software, Axioskop microscope (Zeiss, Germany) with a 20 × 1.3 NA objective. Images (at least 4 mosaics per animal) were analysed by counting positive cells and normalised by the length of the skin sample.

2.4. Inflammatory pain and nerve growth factor sensitisation models

To model inflammatory pain, 20 μL complete Freund's adjuvant (CFA) (Sigma Aldrich) was injected into the intraplantar area of the left hind paw. Nerve growth factor was injected using the same method, at the concentration of 500 ng, dissolved in saline—20 µL final volume per animal.

2.5. Behavioural testing

In all behaviour paradigms, male adult animals (3-9 months) were used. Weights were monitored and annotated periodically. All the experiments were performed by an experimenter blind to genotype.

2.6. Mechanical withdrawal threshold

Mice were placed in a Perspex chamber on a wire mesh floor and allowed to acclimatise for at least 30 minutes. Withdrawal thresholds were determined using the up and down method,15 with a range of von Frey hair forces (0.04-2 g; Touch Test, North Coast Medical, Inc.). Calibrated hairs were applied to the plantar surface of the hind paw so the fibre would bend for approximately 2 seconds or until the animal withdrew its paw. A 50% paw-withdrawal threshold was calculated as previously described.15

2.7. Randall–Selitto (paw pressure)

Noxious mechanical threshold was evaluated using mechanical pressure stimulation based on the Randall–Selitto principle.66 In brief, animals were lightly restrained, and their hind paw was placed on the Analgesy-Meter apparatus (7200; Ugo Baseline). A probe with an increasing force was placed on the dorsal surface of the hind paw and the nociceptive threshold recorded as the force at which the animal responded by paw withdrawal. A maximum of 120 g pressure was applied to prevent any tissue damage.

2.8. Thermal withdrawal threshold

Thermal threshold of the hind paw was determined using an incremental hot/cold 20 cm diameter plate (Ugo Baseline) at a constant set temperature (51°C and 10°C, for hot and cold, respectively). For the noxious hot threshold, animals were gently placed on the plate, surrounded by a transparent acrylic cylinder and timed until they flinched, licked, shook the paw, or jumped. A maximum latency of 30 seconds was set to prevent blisters or other damage to the plantar skin. For the cold threshold, animals were gently restrained and their paw was tested by placing the plantar surface on the plate. The time to withdraw from the cold surface was recorded. In this test, a maximum latency of 20 seconds was allowed to prevent any tissue damage. In both tests, responses were recorded to a precision of 0.1 second.

2.9. In vivo diphtheria toxin toxicity evaluation

C57/BL6J male mice (3-6 months old) were dosed with an i.p. injection of DTTx (25 ng/g; Sigma Aldrich) or vehicle (0.9% saline) once a week over 4 consecutive weeks. Animals were then tested on different behaviour paradigms, as described above, 24 hours after each injection. All the experiments were performed by an experimenter blind to treatment.

2.10. Purified neuronal culture and in vitro Ca++ imaging

C57/BL6J adult mice were deeply anesthetized and transcardially perfused with 1x PBS. Dorsal root ganglia (DRGs) were collected and dissociated by enzymatic digestion, followed by gentle mechanical dissociation.77 Cell suspension was exposed to biotinylated nonneuronal antibody cocktail (Miltenyi MACS Neuron Isolation Kit), followed by antibiotin microbeads (Miltenyi MACS Neuron Isolation Kit). Cells were then run through a LD exclusion column and placed in a QuadroMACS separator (Miltenyi Biotech), so only neuronal cells were eluted (>95% pure neuronal cells generated).77 Neurons were then plated on matrigel coated coverslips and cultured for 48 hours in F12 medium (5% CO2, 95% O2, at 37°C).

Following baseline measurements (3 minutes), neurons were exposed to compound 48/80 at 2 different concentrations, 10 and 100 μg/mL, and imaged for 3 minutes after each exposure. Cells were washed twice with Ca++ buffer in between treatments. Regions of interest were selected around cells and the ratio of the fluorescence intensity at 340/380 nm excitation was calculated. This fluorescence intensity ratio was normalised to the baseline ratio. The percentage of responding cells, after an application of Ca++ buffer and/or compound 48/80 at the 2 concentrations, was determined visually from ratiometric traces.

2.11. In vitro stimulation of mast cells

Bone marrow-derived MC(BMMC) were sensitized with monoclonal anti-Dinitrophenyl (DNP) immunoglobulinE, (clone SPE-7, Sigma) at 1 μg/mL overnight. The following day, BMMC were stimulated with DNP (50 ng/mL) alone or together with various agonists (UDP-glucose [1 μM], NGF [10 ng/mL]). After a 4 hours stimulation period, cell culture supernatants were collected, and cells were lysed for mRNA analysis.

2.12. Enzyme-linked immunospecific assay

Tumor necrosis factor-α (TNFα) cytokine production was measured in cell culture supernatants by standard enzyme-linked immunospecific assay (ELISA) using the mouse TNF-α DuoSet kit (R&D Systems), according to the manufacturer's instructions, and read on an ELISA plate reader (Molecular Devices) set at 450 nm.

2.13. Quantitative real-time polymerase chain reaction

Bone marrow-derived MC RNA was prepared with the RNeasy Micro kit (Qiagen) and total RNA (500 ng) was converted to cDNA using the superScript III Reverse Transcriptase kit (Thermo Fisher Scientific). Rat skin biopsies (glabrous skin) and rat DRGs (used as positive control) were collected and immediately processed using the same method as described above. Archival cDNA extracted from human skin punch biopsies was used to study the presence of NGF receptors in human skin. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed in duplicate with a SYBR green master mix (Roche Diagnostics Limited) and the appropriate gene primers (Sigma) see below. ΔCts were calculated in relation to a house keeper gene (GAPDH). Reactions were run on a Roche Lightcycler 480 PCR machine, and results analysed by the standard ΔΔCt method. All primers were checked for their efficiency and specificity.

FCεR1_F: TGTGTACTTGAATGTAACGCAAGA; FCεR1_R: TGGACTAAGACCATGTCAGCA.

TrkA_F: GAAGAATGTGACGTGCTGGG; TrkA_R: GAAGGAGACGCTGACTTGGA.

p75_F: CCGCTGACAACCTCATTCC; p75_R: GGCTGTTGGCTCCTTGTTTATTT.

Gapdh_F: GGTCCCAGCTTAGGTTCATCA; GAPDH_R: CCAATACGGCCAAATCCGTTC.

TrkA_F (Human): CAGGACTTCCAGCGTGAG; TrkA_R (Human): CGGAGGAAGCGGTTGAG.

p75_F (Human): CTGTGGTTGTGGGCCTTGT; p75_R (Human): TGGAGTTTTTCTCCCTCTGGTG.

Gapdh_F (Human): GAAGGTGAAGGTCGGAGTCAAC; GAPDH_R (Human): CAGAGTTAAAAGCAGCCCTGGT.

2.14. Statistical analysis

All data are expressed as mean ± SEM. For all sets of data, normality of variance was assessed by a Shapiro–Wilk test. If samples showed a normal distribution, parametric tests were applied; otherwise, nonparametric tests were used. Statistical analyses were performed using GraphPad Prism Software.

3. Results

We obtained mice expressing a MC protease-Cre fusion gene (Mcpt5-Cre)26 which had been crossed with ROSA-floxed-STOP-iDTR mice that contain the sequence of the human DTTx receptor (DTR) in every cell.11 The resulting Mctp5Cre-iDTR mice express DTR only in MC, where the Cre can excise the stop signal. Administration of DTTx then leads to the conditional ablation of MC while sparing all other immune cell types.11,26,68 During their first characterisation, Mcpt5-iDTR mice were shown to be almost completely depleted of MC in the peritoneal cavity, ear, and back skin after DTTx administration.26 To further characterise and determine whether MC could also be ablated in dorsal and plantar paw skin (hairy and glabrous skin, respectively), we carried out immunohistochemistry after DTTx treatment (4 i.p. injections over 4 weeks) in both male and female Mcpt5-iDTR transgenic mice. Our histology showed a considerable and significant reduction (∼95%) in the number of MC in male Mcpt5-iDTR mice in relation to their littermate controls (Fig. 1A), demonstrating a successful depletion of MC in both hairy and glabrous paw skin in transgenic males (Fig. 1B). Interestingly, in female Mcpt5-iDTR mice the number of MC only dropped by approximately 40%, a reduction which was not significant in comparison with Cre negative iDTR littermates (Fig. 1C, D).

In addition to histological characterisation, we also investigated whether loss of MC in plantar skin causes any behavioural changes in the Mcpt5-iDTR male mouse model. We found no alterations in mechanical pain threshold before or after DTTx (paw-withdrawal responses remained unaffected in a von Frey test; Fig. 1E). Furthermore, to rule out any possible effects DTTx could have on sensory neurons in vivo, we tested wildtype mice which were submitted to DTTx treatment, on different behavioural paradigms. Our results show that DTTx treatment has no acute (3 hours after first injection), long term (24 hours after first injection), or chronic effect (4 injections over 4 weeks) on mechanical (von Frey and Randall–Selitto) or thermal (hot and cold) thresholds compared with the control (vehicle) group (Supp. Fig. 1, available online as supplemental digital content at http://links.lww.com/PAIN/A405). Importantly, mechanical and thermal thresholds remain unchanged pretreatment and posttreatment (Supp. Fig. 1A–D, available online as supplemental digital content at http://links.lww.com/PAIN/A405), except on the cold plate, where both groups displayed some learning behaviour (Supp. Fig. 1D, available online as supplemental digital content at http://links.lww.com/PAIN/A405). Together these results indicate that the Mcpt5-iDTR male model is a good system to study the involvement of MC in peripheral sensitisation and inflammatory pain.

To date, most model systems used to study MC function in pain present a few drawbacks. For instance, the use of compound 48/80, known for degranulating and depleting MC, has been found to have off target effects, also acting directly on other cell types.17,51,70 To further validate the uniqueness of the Mcpt5-iDTR model to study MC in pain, and to investigate whether compound 48/80 has a direct effect in sensory neurons, we used Ca++ imaging to monitor the neuronal response and excitability on exposure to different concentrations of compound 48/80. Notably, for these experiments, purified DRG neurons were used, allowing over 95% cell purity77 and therefore, excluding any response driven by other nonneuronal cell types. We found that following baseline recording, at a lower concentration of compound 48/80 (10 μg/mL), approximately 20% of neurons show an increased excitability almost immediately after the exposure to compound 48/80 and lasting up to 3 minutes of recording (Supp. Fig. 2A, B, available online as supplemental digital content at http://links.lww.com/PAIN/A405). Remarkably, when the concentration of compound 48/80 was increased (100 μg/mL), almost 70% of the neurons responded to the treatment (Supp. Fig. 2A, B, available online as supplemental digital content at http://links.lww.com/PAIN/A405). It cannot be ruled out that at this high concentration compound 48/80 may even be toxic to neurons, as intracellular Ca++ accumulation remains constant after several minutes after the application of the drug. Nevertheless, our data clearly demonstrate that DRG neurons are capable of responding to compound 48/80, at a dose known to cause MC degranulation (10 μg/ml)13,33,58,72,75,78 and independent of the presence of any other cell type. These findings further demonstrate the unspecificity of compound 48/80 and emphasise the importance of developing new models, such as the Mcpt5-iDTR transgenic model, to study MC in context of pain.

Nerve growth factor is well known for being secreted during injury and inflammation, leading to a rapid sensitisation of peripheral nociceptors.41,52,62 Indeed, blockade of NGF signalling has been shown to attenuate allodynia in different models of persistent pain, and more recently an anti-NGF antibody has reached phase II and III clinical trials, proving to be a promising target to alleviate chronic pain.27,28,44,73 Early studies also suggested that NGF is capable of both activation and proliferation of MC in peripheral tissues.3,4,45,63 We, therefore, used the NGF sensitisation model6,22,42,43,55,80 to investigate the role of MC in acute inflammatory pain and nociceptor sensitisation. As expected, after intraplantar NGF injection, we observed increased mechanical hypersensitivity in the injected paw of control animals, as demonstrated by decreased paw-withdrawal thresholds in the von Frey test (Fig. 2A). Yet, both control and Mcpt5-iDTR groups showed the same level of sensitisation triggered by NGF, suggesting that MC do not potentiate its pronociceptive effects.

Figure 2.
Figure 2.:
Nerve growth factor (NGF) treatment has no effect on mast cells (MC). (A) Intraplantar injection of NGF shows a similar decrease in mechanical threshold in both groups of animals, 1 hour after injection and 3.5 hours after the injection (F(2,36) = 23.40; P < 0.001). Data from baseline and contralateral paw demonstrates no underlying differences between MC depleted animals and control littermates (F(1,18) = 0.05; P > 0.05). (B) FACS dot plots showing gating strategy for bone-derived MC. (C) Graph showing the quantification of tumor necrosis factor-α release (enzyme-linked immunospecific assay [ELISA]) from Bone marrow-derived MC (BMMC) after treatment with NGF, in comparison with basal levels (dinitrophenyl [DNP]) and treatment with UDP-Glucose (positive control). (D) qRT-PCR for NGF receptors on RNA extracted from BMMC (n = 3 experiments), before (DNP) and after treatment with NGF (TrkA: black bars; p75: gray bars), in comparison with basal levels of FCεR1 (white bar). Data are means ± SEM. n = 12 (iDTR) and 8 (Mcpt5-iDTR); 2-way ANOVA repeated measures (A).

Given these unexpected results, and to rule out any possible compensatory factors, we went on to investigate the direct effect of NGF on isolated BMMC in vitro. To check the quality and purity of BMMC, we first analysed our cultures by flow cytometry. We found that 98% of our cells expressed c-kit, FCεR1, and mast cell tryptase, confirming successful differentiation of bone marrow cells into MC after 4 to 6 weeks in culture (Fig. 2B). To test the effect of NGF on MC activation, we sensitised the cells using DNP and immunoglobulin E (IgE) and treated them with NGF (4 hours, 10 ng/mL). UDP-Glucose was used as positive control, as it is known to stimulate and induce production of TNFα by MC.31,36 Nerve growth factor did not induce increased secretion of TNFα when compared with DNP alone, as measured by ELISA (Fig. 2C). To clarify these findings, we checked the expression levels of the 2 NGF receptors—TrkA and p75—in BMMC via qRT-PCR. Our data demonstrate that basal levels of both NGF receptors in MC were negligible (Fig. 2D). After treatment with NGF, there was a very moderate increase in the levels of TrkA and p75 mRNA in MC (Fig. 2D). Nevertheless, levels of NGF receptors were negligible when compared with basal levels of FCεR1 (Fig. 2D). Similarly, levels of NGF receptors were also negligible in peritoneal MC (data not shown). Overall, our results demonstrate that NGF treatment has no effect on MC as these cells do not express NGF receptors.

To further explore the link between NGF and MC, and the relevance of our findings to other systems, we went on to investigate whether NGF receptors are expressed in rat and human MC. Our qRT-PCR results indicate that, similarly to mice, NGF receptors are not present in the MC of rats or humans, as levels of TrkA and p75 were negligible in the skin samples analysed (Supp. Fig. 3A, B, available online as supplemental digital content at http://links.lww.com/PAIN/A405). These results reinforce our previous findings indicating that MC do not express NGF receptors.

To rule out the possibility that our stimulus (NGF) might have been too specific or mild to lead to MC recruitment and activation, we set out to study a much stronger proinflammatory insult. For these experiments we used the well-characterised, CFA model, which induces chronic inflammation and hypersensitivity at the injection site, as well as the recruitment and activation of MC.14,50,57,59,67,82 Our experiments demonstrate that depletion of MC, using the Mcpt5-iDTR model, had no impact on mechanical and thermal hypersensitivity thresholds 24 hours after intraplantar injection of CFA. No significant differences emerged between MC depleted mice and their littermates on von Frey, Randall–Selitto, hot or cold plate tests (Fig. 3A–D). Crucially, when evaluating later stages after the acute phase (3 and 4 days after CFA injection), we still did not observe any change in mechanical or thermal hyperalgesia between the 2 groups of mice (Fig. 3A–D). Furthermore, edema (paw thickness) and temperature triggered by CFA inflammation was consistent between the groups (Fig. 4A, B), both in acute (24 hours) and longer-term inflammation (3 days). Together, our data indicate that MC contribute little to the sensitisation of peripheral nociceptors during CFA-mediated inflammation.

Figure 3.
Figure 3.:
Loss of mast cells (MC) does not reduce peripheral sensitisation during inflammation. (A) Paw withdrawal on the von Frey test showed a decreased mechanical threshold in both groups of animals after intraplantar complete Freund's adjuvant (CFA) injection (F(9,66) = 2.94; P ≤ 0.005), 24 hours, 72 hours and 4 days after injection (F(3,66) = 12.30; P < 0.001). Baseline and contralateral paw-withdrawal thresholds demonstrated no underlying differences between groups (F(3,22) = 2.45; P > 0.05). (B) Paw withdrawal on the Randall–Selitto test further demonstrated a sensitisation to a noxious mechanical stimuli after CFA injection (F(6,52) = 6.10; P < 0.001), both 24 and 72 hours after injection (F(2,52) = 25.41; P < 0.001). (C) CFA treatment equally changes thermal hypersensitivity on the hot plate (F(2,26) = 4.47, P < 0.05) and cold plate (F(2,26) = 25.41; P < 0.001) (D). Data are means ± SEM. n = 9 (iDTR) and 6 (Mcpt5-iDTR); 2-Way repeated measures ANOVA.
Figure 4.
Figure 4.:
Depletion of mast cells has no impact on gross physiological changes triggered by inflammation. (A) Measuring of edema after complete Freund's adjuvant (CFA) injection shows a significant swelling in comparison with baseline (F(9,78) = 75.47; P < 0.001), but no difference between groups (F(1,13) = 1.69; P > 0.05). (B) Similarly, paw temperature in the injected area increased after inflammation (F(2,52) = 74.22; P < 0.001), but was very similar in iDTR and Mcpt5-iDTR animals (F(26,52) = 0.56; P > 0.05). Data are means ± SEM. n = 9 (iDTR) and 6 (Mcpt5-iDTR); 2-way repeated measures ANOVA.

4. Discussion

In this study, we have analysed the role of MC in the sensitisation of peripheral nociceptors during acute inflammation. Our evidence indicates that MC appear to not be essential for this process; in the Mcpt5-iDTR mouse model, where almost complete depletion of MC in glabrous skin was achieved, animals still displayed normal levels of mechanical hypersensitisation after local injection of NGF. This was further supported by our in vitro studies, demonstrating that NGF alone had no effect on the level of TNFα secreted by MC. Similarly, when challenged with a strong inflammatory stimulus (CFA), Mcpt5-iDTR mice still presented the same levels of mechanical and thermal hyperalgesia as their control littermates, both in acute and longer-term phases (3-4 days) of inflammation. Sensitisation of peripheral nociceptors during inflammation is, therefore, likely to be mediated and potentiated by immune cells other than MC.

Evidence for the contribution of MC to acute inflammatory sensitisation of nociceptors is not strong. Previous studies have implied that loss of MC function could be implicated in pain, and induction of this process could, therefore, represent a potential target for alleviating acute peripheral neuronal sensitisation23,25,38,47,49,69,81,85. However, most of these studies suffered from many confounding factors due to their experimental design. For instance, compound 48/80, which is broadly used to acutely degranulate and deplete MC, has been found to have a profound impact on other immune cells, including neutrophils and eosinophils17,51 and directly affects sensory neuron excitability, as shown in this study, and previously suggested by Schemann et al.70 Furthermore, interpretation from studies using more refined techniques such as MC transgenic lines have equally proven to be ambiguous, in particular those using c-kit transgenics. Recent findings have shown that constitutive disruption of c-kit signalling has significant consequences for the function and number of many immune cell types other than MC, such as erythrocytes and neutrophils.30,39 Crucially, beyond the immune system, it has been shown that c-kit is expressed in spinal cord neurons and nociceptors,54,74 a result which is further supported by recent RNA sequencing data.77,79

To overcome these limitations, in our study we used an established transgenic line (Mcpt5-iDTR), where MC deficiency can be induced by administration of DTTx11,26 and has no impact on other immune cell populations.26,39 We have shown almost complete depletion of MC in the paw skin of this Mcpt5-iDTR model, and the reduction in the number of cells was comparable in size with that reported in other tissues in this same transgenic system.26

We also found sex differences when attempting to deplete MC, with MC counts in female mice remaining almost unaffected by DTTx treatment. It is likely that this observation is because of the role that female hormones play in MC behaviour, affecting their number and degranulation, as previously reported.9,35,84 These findings mean that we cannot comment on the role of MC in female mice because of the specifics of our experimental design. More importantly, they also imply that particular care has to be taken when designing future investigations into the role of MC in pain, particularly in females.

Acute NGF response, MC and hypersensitisation: a cross-talk pathway? NGF has a well-established role in the adult nociceptive system, mediating and modulating pain, as well as causing changes in gene expression, particularly in persistent pain states.41,52,65 Acute NGF treatment leads to mechanical and thermal hyperalgesia,6,22,42,43,55,80 an effect that was believed to be directly linked to MC activation.3,4,45,47,63,69,81 Surprisingly, our results revealed that depletion of MC in vivo does not reduce acute NGF-induced peripheral sensitisation. In addition, our in vitro experiments further supplemented these findings and demonstrated that NGF does not activate MC. We were also able to show that MC express neither of the 2 NGF receptors, TrkA or p75, explaining their lack of response on exposure to NGF. Importantly, our results are in line with recent RNA-seq data which show that bone marrow-derived, peritoneal and intestinal MC have none or negligible levels of TrkA and p75.12,18 In addition, we also show similar results in samples from rat and human skin, with our data once more replicating previously published RNA-seq data.21 Although a dilution effect cannot be excluded when studying MC in skin, the overwhelming majority of recent expression data support our conclusion that MC play an inconsequential role in NGF-mediated nociceptor sensitisation, primarily because they lack NGF receptors. Naturally, it cannot be ruled out that more chronic inflammatory conditions eventually upregulate NGF receptors on MC, rendering them directly sensitive to this particular pain mediator. Or indeed, it could be that long-term exposure to NGF has an indirect effect on MC function, increasing other important inflammatory mediators in these cells that then go on to impact sensory neurons or other immune cell types.

Do MC play a role in the inflammatory response? Our results demonstrate that MC have no evident immediate role in NGF or CFA triggered sensitisation, including its more persistent phases. These results are supported by a recent study which demonstrates that CFA-induction and maintenance of mechanical and thermal hyperalgesia are primarily dependent on specific populations of myeloid cells, particularly macrophages.32 These findings imply that pursuing MC as a target to alleviate mechanical and thermal allodynia, as well as to attenuate edema and other physiological changes that arise immediately after inflammation, might not be the most appropriate approach to tackle pain during inflammation. Although we show no obvious function for MC at early to mid-term stages of sensitisation, we speculate that during long-term inflammatory conditions MC may get primed to potentiate inflammatory responses, and therefore, may have a potential impact on nociceptors in a chronic pain scenario. According to this view, sensitisation would occur as a result of more complex transcriptional and molecular alterations. Future studies exploring whether MC can directly sensitise afferents during long periods of inflammation will be necessary to fully understand their role–if any–in more persistent pain conditions.

Conflict of interest statement

The authors have no conflict of interest to declare.

Acknowledgements

The authors thank Prof Axel Roers from the Institute of Immunology at TU Dresden and Prof Ari Waisman at the Institute for Molecular Medicine in Mainz for kindly providing us with the Mcpt5-iDTR mice. This work was supported by the Wellcome Trust and Panion Limited.

Appendix A. Supplemental Digital Content

Supplemental Digital Content associated with this article can be found online at http://links.lww.com/PAIN/A405.

References

[1]. Ahmed M, Bjurholm A, Srinivasan GR, Lundeberg T, Theodorsson E, Schultzberg M, Kreicbergs A. Capsaicin effects on substance P and CGRP in rat adjuvant arthritis. Regul pept 1995;55:85–102.
[2]. Aich A, Afrin LB, Gupta K. Mast cell-mediated mechanisms of nociception. Int J Mol Sci 2015;16:29069–92.
[3]. Aloe L, Levi-Montalcini R. Mast cells increase in tissues of neonatal rats injected with the nerve growth factor. Brain Res 1977;133:358–66.
[4]. Aloe L, Skaper SD, Leon A, Levi-Montalcini R. Nerve growth factor and autoimmune diseases. Autoimmunity 1994;19:141–50.
[5]. Anand P, Singh B, Jaggi AS, Singh N. Mast cells: an expanding pathophysiological role from allergy to other disorders. Naunyn-Schmiedeberg's Arch Pharmacol 2012;385:657–70.
[6]. Andresen T, Nilsson M, Nielsen AK, Lassen D, Arendt-Nielsen L, Drewes AM. Intradermal injection with nerve growth factor: a reproducible model to induce experimental allodynia and hyperalgesia. Pain pract 2016;16:12–23.
[7]. Austin PJ, Berglund AM, Siu S, Fiore NT, Gerke-Duncan MB, Ollerenshaw SL, Leigh SJ, Kunjan PA, Kang JW, Keay KA. Evidence for a distinct neuro-immune signature in rats that develop behavioural disability after nerve injury. J neuroinflammation 2015;12:96.
[8]. Austin PJ, Kim CF, Perera CJ, Moalem-Taylor G. Regulatory T cells attenuate neuropathic pain following peripheral nerve injury and experimental autoimmune neuritis. PAIN 2012;153:1916–31.
[9]. Aydin Y, Tuncel N, Gurer F, Tuncel M, Kosar M, Oflaz G. Ovarian, uterine and brain mast cells in female rats: cyclic changes and contribution to tissue histamine. Comparative biochemistry and physiology Part A, Mol Integr Physiol 1998;120:255–62.
[10]. Besmer P. The kit ligand encoded at the murine Steel locus: a pleiotropic growth and differentiation factor. Curr Opin Cel Biol 1991;3:939–46.
[11]. Buch T, Heppner FL, Tertilt C, Heinen TJ, Kremer M, Wunderlich FT, Jung S, Waisman AA. Cre-inducible diphtheria toxin receptor mediates cell lineage ablation after toxin administration. Nat Methods 2005;2:419–26.
[12]. Calero-Nieto FJ, Ng FS, Wilson NK, Hannah R, Moignard V, Leal-Cervantes AI, Jimenez-Madrid I, Diamanti E, Wernisch L, Gottgens B. Key regulators control distinct transcriptional programmes in blood progenitor and mast cells. EMBO J 2014;33:1212–26.
[13]. Carlos D, Sa-Nunes A, de Paula L, Matias-Peres C, Jamur MC, Oliver C, Serra MF, Martins MA, Faccioli LH. Histamine modulates mast cell degranulation through an indirect mechanism in a model IgE-mediated reaction. Eur J Immunol 2006;36:1494–503.
[14]. Carollo M, Hogaboam CM, Kunkel SL, Delaney S, Christie MI, Perretti M. Analysis of the temporal expression of chemokines and chemokine receptors during experimental granulomatous inflammation: role and expression of MIP-1alpha and MCP-1. Br J Pharmacol 2001;134:1166–79.
[15]. Chaplan SR, Bach FW, Pogrel JW, Chung JM, Yaksh TL. Quantitative assessment of tactile allodynia in the rat paw. J Neurosci Methods 1994;53:55–63.
[16]. Chatterjea D, Martinov T. Mast cells: versatile gatekeepers of pain. Mol Immunol 2015;63:38–44.
[17]. Chatterjea D, Wetzel A, Mack M, Engblom C, Allen J, Mora-Solano C, Paredes L, Balsells E, Martinov T. Mast cell degranulation mediates compound 48/80-induced hyperalgesia in mice. Biochem biophysical Res Commun 2012;425:237–43.
[18]. Chen CY, Lee JB, Liu B, Ohta S, Wang PY, Kartashov AV, Mugge L, Abonia JP, Barski A, Izuhara K, Rothenberg ME, Finkelman FD, Hogan SP, Wang YH. Induction of interleukin-9-producing mucosal mast cells promotes susceptibility to IgE-mediated experimental food allergy. Immunity 2015;43:788–802.
[19]. Colpaert FC, Donnerer J, Lembeck F. Effects of capsaicin on inflammation and on the substance P content of nervous tissues in rats with adjuvant arthritis. Life Sci 1983;32:1827–34.
[20]. Cui JG, Holmin S, Mathiesen T, Meyerson BA, Linderoth B. Possible role of inflammatory mediators in tactile hypersensitivity in rat models of mononeuropathy. PAIN 2000;88:239–48.
[21]. Dawes JM, Antunes-Martins A, Perkins JR, Paterson KJ, Sisignano M, Schmid R, Rust W, Hildebrandt T, Geisslinger G, Orengo C, Bennett DL, McMahon SB. Genome-wide transcriptional profiling of skin and dorsal root ganglia after ultraviolet-B-induced inflammation. PLoS One 2014;9:e93338.
[22]. De Angelis F, Marinelli S, Fioretti B, Catacuzzeno L, Franciolini F, Pavone F, Tata AM. M2 receptors exert analgesic action on DRG sensory neurons by negatively modulating VR1 activity. J Cell Physiol 2014;229:783–90.
[23]. De Toni LG, Menaldo DL, Cintra AC, Figueiredo MJ, de Souza AR, Maximiano WM, Jamur MC, Souza GE, Sampaio SV. Inflammatory mediators involved in the paw edema and hyperalgesia induced by batroxase, a metalloproteinase isolated from bothrops atrox snake venom. Int Imunopharmacol 2015;28:199–207.
[24]. Donaldson LF, McQueen DS, Seckl JR. Neuropeptide gene expression and capsaicin-sensitive primary afferents: maintenance and spread of adjuvant arthritis in the rat. J Physiol 1995;486(pt 2):473–82.
[25]. Drummond PD. The effect of cutaneous mast cell degranulation on sensitivity to heat. Inflamm Res 2004;53:309–15.
[26]. Dudeck A, Dudeck J, Scholten J, Petzold A, Surianarayanan S, Kohler A, Peschke K, Vohringer D, Waskow C, Krieg T, Muller W, Waisman A, Hartmann K, Gunzer M, Roers A. Mast cells are key promoters of contact allergy that mediate the adjuvant effects of haptens. Immunity 2011;34:973–84.
[27]. Ekman EF, Gimbel JS, Bello AE, Smith MD, Keller DS, Annis KM, Brown MT, West CR, Verburg KM. Efficacy and safety of intravenous tanezumab for the symptomatic treatment of osteoarthritis: 2 randomized controlled trials versus naproxen. J Rheumatol 2014;41:2249–59.
[28]. Evans RJ, Moldwin RM, Cossons N, Darekar A, Mills IW, Scholfield D. Proof of concept trial of tanezumab for the treatment of symptoms associated with interstitial cystitis. J Urol 2011;185:1716–21.
[29]. Galli SJ, Borregaard N, Wynn TA. Phenotypic and functional plasticity of cells of innate immunity: macrophages, mast cells and neutrophils. Nat Immunol 2011;12:1035–44.
[30]. Galli SJ, Tsai M, Marichal T, Tchougounova E, Reber LL, Pejler G. Approaches for analyzing the roles of mast cells and their proteases in vivo. Adv Immunol 2015;126:45–127.
[31]. Gao ZG, Ding Y, Jacobson KA. UDP-glucose acting at P2Y14 receptors is a mediator of mast cell degranulation. Biochem Pharmacol 2010;79:873–9.
[32]. Ghasemlou N, Chiu IM, Julien JP, Woolf CJ. CD11b+Ly6G- myeloid cells mediate mechanical inflammatory pain hypersensitivity. Proc Natl Acad Sci U S A 2015;112:E6808–6817.
[33]. Gong L, Li J, Tang Y, Han T, Wei C, Yu X, Li J, Wang R, Ma X, Liu K, Geng L, Liu S, Yan B, Liu C. The antinociception of oxytocin on colonic hypersensitivity in rats was mediated by inhibition of mast cell degranulation via Ca(2+)-NOS pathway. Sci Rep 2016;6:31452.
[34]. Grace PM, Hutchinson MR, Maier SF, Watkins LR. Pathological pain and the neuroimmune interface. Nat Rev Immunol 2014;14:217–31.
[35]. Jensen F, Woudwyk M, Teles A, Woidacki K, Taran F, Costa S, Malfertheiner SF, Zenclussen AC. Estradiol and progesterone regulate the migration of mast cells from the periphery to the uterus and induce their maturation and degranulation. PLoS One 2010;5:e14409.
[36]. Jokela TA, Karna R, Makkonen KM, Laitinen JT, Tammi RH, Tammi MI. Extracellular UDP-glucose activates P2Y14 receptor and induces signal transducer and activator of transcription 3 (STAT3) Tyr705 phosphorylation and binding to hyaluronan synthase 2 (HAS2) promoter, stimulating hyaluronan synthesis of keratinocytes. J Biol Chem 2014;289:18569–81.
[37]. Joulia R, Gaudenzio N, Rodrigues M, Lopez J, Blanchard N, Valitutti S, Espinosa E. Mast cells form antibody-dependent degranulatory synapse for dedicated secretion and defence. Nat Commun 2015;6:6174.
[38]. Karlsen TV, Bletsa A, Gjerde EA, Reed RK. Lowering of interstitial fluid pressure after neurogenic inflammation in mouse skin is partly dependent on mast cells. Am J Physiol Heart circ Physiol 2007;292:H1821–1827.
[39]. Katz HR, Austen KF. Mast cell deficiency, a game of kit and mouse. Immunity 2011;35:668–70.
[40]. Keeble J, Blades M, Pitzalis C, Castro da Rocha FA, Brain SD. The role of substance P in microvascular responses in murine joint inflammation. Br J Pharmacol 2005;144:1059–66.
[41]. Kelleher JH, Tewari D, McMahon SB. Neurotrophic factors and their inhibitors in chronic pain treatment. Neurobiol Dis;2016.
[42]. Khan N, Smith MT. Neurotrophins, neuropathic pain: role in pathobiology. Molecules 2015;20:10657–88.
[43]. Khodorova A, Nicol GD, Strichartz G. The p75NTR signaling cascade mediates mechanical hyperalgesia induced by nerve growth factor injected into the rat hind paw. Neuroscience 2013;254:312–23.
[44]. Kivitz AJ, Gimbel JS, Bramson C, Nemeth MA, Keller DS, Brown MT, West CR, Verburg KM. Efficacy and safety of tanezumab versus naproxen in the treatment of chronic low back pain. PAIN 2013;154:1009–21.
[45]. Kritas SK, Saggini A, Cerulli G, Caraffa A, Antinolfi P, Pantalone A, Frydas S, Rosati M, Tei M, Speziali A, Saggini R, Pandolfi F, Conti P. Neuropeptide NGF mediates neuro-immune response and inflammation through mast cell activation. J Biol Regul Homeost Agents 2014;28:177–81.
[46]. Levy D, Burstein R, Kainz V, Jakubowski M, Strassman AM. Mast cell degranulation activates a pain pathway underlying migraine headache. PAIN 2007;130:166–76.
[47]. Lewin GR, Rueff A, Mendell LM. Peripheral and central mechanisms of NGF-induced hyperalgesia. Eur J Neurosci 1994;6:1903–12.
[48]. Liou JT, Lee CM, Lin YC, Chen CY, Liao CC, Lee HC, Day YJ. P-selectin is required for neutrophils and macrophage infiltration into injured site and contributes to generation of behavioral hypersensitivity following peripheral nerve injury in mice. PAIN 2013;154:2150–9.
[49]. Lopes F, Graepel R, Reyes JL, Wang A, Petri B, McDougall JJ, Sharkey KA, McKay DM. Involvement of mast cells in alpha7 nicotinic receptor agonist exacerbation of Freund's complete adjuvant-induced monoarthritis in mice. Arthritis Rheumatol 2016;68:542–52.
[50]. Magnusson SE, Pejler G, Kleinau S, Abrink M. Mast cell chymase contributes to the antibody response and the severity of autoimmune arthritis. FASEB journal 2009;23:875–82.
[51]. Martins MA, Pasquale CP, e Silva PM, Pires AL, Ruffie C, Rihoux JP, Cordeiro RS, Vargaftig BB. Interference of cetirizine with the late eosinophil accumulation induced by either PAF or compound 48/80. Br J Pharmacol 1992;105:176–80.
[52]. McMahon SB. NGF as a mediator of inflammatory pain. Philos Trans R Soc Lond B Biol Sci 1996;351:431–40.
[53]. McMahon SB, La Russa F, Bennett DL. Crosstalk between the nociceptive and immune systems in host defence and disease. Nat Rev Neurosci 2015;16:389–402.
[54]. Milenkovic N, Frahm C, Gassmann M, Griffel C, Erdmann B, Birchmeier C, Lewin GR, Garratt AN. Nociceptive tuning by stem cell factor/c-Kit signaling. Neuron 2007;56:893–906.
[55]. Mills CD, Nguyen T, Tanga FY, Zhong C, Gauvin DM, Mikusa J, Gomez EJ, Salyers AK, Bannon AW. Characterization of nerve growth factor-induced mechanical and thermal hypersensitivity in rats. Eur J pain 2013;17:469–79.
[56]. Moalem G, Xu K, Yu L. T lymphocytes play a role in neuropathic pain following peripheral nerve injury in rats. Neuroscience 2004;129:767–77.
[57]. Moriyama M, Sato T, Inoue H, Fukuyama S, Teranishi H, Kangawa K, Kano T, Yoshimura A, Kojima M. The neuropeptide neuromedin U promotes inflammation by direct activation of mast cells. J Exp Med 2005;202:217–24.
[58]. Nakamura Y, Ishimaru K, Shibata S, Nakao A. Regulation of plasma histamine levels by the mast cell clock and its modulation by stress. Sci Rep 2017;7:39934.
[59]. Oliani SM, Ciocca GA, Pimentel TA, Damazo AS, Gibbs L, Perretti M. Fluctuation of annexin-A1 positive mast cells in chronic granulomatous inflammation. Inflamm Res 2008;57:450–6.
[60]. Otsuka A, Kabashima K. Mast cells and basophils in cutaneous immune responses. Allergy 2015;70:131–40.
[61]. Pang X, Marchand J, Sant GR, Kream RM, Theoharides TC. Increased number of substance P positive nerve fibres in interstitial cystitis. Br J Urol 1995;75:744–50.
[62]. Patapoutian A, Tate S, Woolf CJ. Transient receptor potential channels: targeting pain at the source. Nat Rev Drug Discov 2009;8:55–68.
[63]. Pearce FL, Thompson HL. Some characteristics of histamine secretion from rat peritoneal mast cells stimulated with nerve growth factor. J Physiol 1986;372:379–93.
[64]. Perry VH, Brown MC, Gordon S. The macrophage response to central and peripheral nerve injury. A possible role for macrophages in regeneration. J Exp Med 1987;165:1218–23.
[65]. Pezet S, McMahon SB. Neurotrophins: mediators and modulators of pain. Annu Rev Neurosci 2006;29:507–38.
[66]. Randall LO, Selitto JJ. A method for measurement of analgesic activity on inflamed tissue. Arch Int Pharmacodyn Ther 1957;111:409–19.
[67]. Ren K, Dubner R. Inflammatory models of pain and hyperalgesia. ILAR J 1999;40:111–18.
[68]. Ren K, Dubner R. Interactions between the immune and nervous systems in pain. Nat Med 2010;16:1267–76.
[69]. Rueff A, Mendell LM. Nerve growth factor NT-5 induce increased thermal sensitivity of cutaneous nociceptors in vitro. J Neurophysiol 1996;76:3593–6.
[70]. Schemann M, Kugler EM, Buhner S, Eastwood C, Donovan J, Jiang W, Grundy D. The mast cell degranulator compound 48/80 directly activates neurons. PLoS One 2012;7:e52104.
[71]. Scholz J, Woolf CJ. The neuropathic pain triad: neurons, immune cells and glia. Nat Neurosci 2007;10:1361–8.
[72]. Sinniah A, Yazid S, Perretti M, Solito E, Flower RJ. The role of the Annexin-A1/FPR2 system in the regulation of mast cell degranulation provoked by compound 48/80 and in the inhibitory action of nedocromil. Int immunopharmacol 2016;32:87–95.
[73]. Spierings EL, Fidelholtz J, Wolfram G, Smith MD, Brown MT, West CR. A phase III placebo- and oxycodone-controlled study of tanezumab in adults with osteoarthritis pain of the hip or knee. PAIN 2013;154:1603–12.
[74]. Sun YG, Gracias NG, Drobish JK, Vasko MR, Gereau RW, Chen ZF. The c-kit signaling pathway is involved in the development of persistent pain. PAIN 2009;144:178–86.
[75]. Taketomi Y, Sunaga K, Tanaka S, Nakamura M, Arata S, Okuda T, Moon TC, Chang HW, Sugimoto Y, Kokame K, Miyata T, Murakami M, Kudo I. Impaired mast cell maturation and degranulation and attenuated allergic responses in Ndrg1-deficient mice. J Immunol 2007;178:7042–53.
[76]. Thacker MA, Clark AK, Marchand F, McMahon SB. Pathophysiology of peripheral neuropathic pain: immune cells and molecules. Anesth analgesia 2007;105:838–47.
[77]. Thakur M, Crow M, Richards N, Davey GI, Levine E, Kelleher JH, Agley CC, Denk F, Harridge SD, McMahon SB. Defining the nociceptor transcriptome. Front Mol Neurosci 2014;7:87.
[78]. Tomoe S, Iwamoto I, Tomioka H, Yoshida S. Comparison of substance P-induced and compound 48/80-induced neutrophil infiltrations in mouse skin. Int Arch Allergy Immunol 1992;97:237–42.
[79]. Usoskin D, Furlan A, Islam S, Abdo H, Lonnerberg P, Lou D, Hjerling-Leffler J, Haeggstrom J, Kharchenko O, Kharchenko PV, Linnarsson S, Ernfors P. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat Neurosci 2015;18:145–53.
[80]. Watanabe T, Ito T, Inoue G, Ohtori S, Kitajo K, Doya H, Takahashi K, Yamashita T. The p75 receptor is associated with inflammatory thermal hypersensitivity. J Neurosci Res 2008;86:3566–74.
[81]. Woolf CJ, Ma QP, Allchorne A, Poole S. Peripheral cell types contributing to the hyperalgesic action of nerve growth factor in inflammation. J Neurosci 1996;16:2716–23.
[82]. Yu JC H, Wang L, Zhang Y, Feng J, Yang J. Mechanism of peripheral mast cells in a rat model of inflammatory hyperalgesia. Acta Acad Med 2008;881:733–6.
[83]. Zhang J, Echeverry S, Lim TK, Lee SH, Shi XQ, Huang H. Can modulating inflammatory response be a good strategy to treat neuropathic pain? Curr Pharm Des 2015;21:831–9.
[84]. Zierau O, Zenclussen AC, Jensen F. Role of female sex hormones, estradiol and progesterone, in mast cell behavior. Front Immunol 2012;3:169.
[85]. Zuo Y, Perkins NM, Tracey DJ, Geczy CL. Inflammation and hyperalgesia induced by nerve injury in the rat: a key role of mast cells. PAIN 2003;105:467–79.
Keywords:

Mast cell; Pain; Inflammation; NGF; Neuroimmunology

Supplemental Digital Content

Copyright © 2017 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the International Association for the Study of Pain.