1 Introduction
Hawthorn (Crataegus pinnatifida Bunge) belongs to the Rosaceae plant family. In China, it is mainly distributed in Shandong, Anhui, Henan, Jiangsu, Shanxi, Zhejiang, and Jilin. Hawthorn is a traditional Chinese medicine, and its extracts are capable of ameliorating liver disease; inhibiting inflammation; regulating blood lipid levels, blood pressure, and hypoxia; increasing coronary flow; and protecting the ischemic myocardium.[1,2] Substances found in hawthorn include flavones, flavonoids, cellulose, tannins, flavanes and their polymers, organic acids, steroids, and triterpenes. Among these substances, flavonoids are the main active components of hawthorn.[3,4] Vitexin, an important class of flavonoids extracted from hawthorn leaves, is the active ingredient of hawthorn and has been previously demonstrated to have a protective effect against liver disease. However, the molecular mechanism of this effect is unclear.[5,6]
DNA damage includes breakage, mutations, and rearrangements, and causes permanent genetic damage by changing DNA sequences. The result of DNA damage is cell death or canceration, and alcohol is an important inducer of DNA damage.[7,8] Hepatocytes are vulnerable to alcohol damage. Alcoholic liver disease, which is the most common cause of liver cirrhosis, is caused by long-term heavy drinking. Alcoholic liver disease has been estimated to account for 48% of all deaths from cirrhosis.[9] Flavonoids, a common active ingredient of Chinese herbal medicines, have various pharmacological effects, such as antibacterial, anti-inflammatory, and antitumor effects. Flavonoids can protect liver cells by reducing damage and improving activity. However, few studies on the effect of hawthorn vitexin on alcohol-induced DNA damage and its mechanism are available.[10–13]
The effect of hawthorn vitexin on ethanol-injured BRL-3A hepatocytes was determined via the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Single-cell gel electrophoresis was used to calculate the Olive tail moment and analyze DNA damage. Physiological and biochemical indexes, such as superoxide dismutase (SOD) activity, malondialdehyde (MDA) content, and glutathione peroxidase (GSH-PX) activity, were detected by using kits. Real-time quantitative polymerase chain reaction was applied to detect the mRNA expression of the SOD gene. This study provided a theoretical basis for the application of hawthorn vitexin in medicine and the prevention and treatment of liver diseases.
2 Materials and methods
2.1 Cell and reagents
Rat hepatocyte line BRL-3A (ATCC) was used. DMEM (DuIbecco's modified eagIe's medium) high glucose medium, fetal bovine serum, Trypsin, and PBS (phosphate buffered solution) were purchased from Gibco (Grand Island, NY). Detection kits of SOD, MDA, and GSH-PX were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Cell culture bottle and 96-well plate were obtained from Corning (NY, USA). Thiazolam was purchased from Amresco (Washington, USA).
2.2 Isolation and purification of hawthorn vitexin
Vitexin was extracted from 1 g of hawthorn leaves with 50 mL of ethanol–water (60:40, v/v) for 30 min in an ultrasonic bath. Extraction was repeated twice with 25 mL of ethanol–water. The crude extract of hawthorn vitexin was obtained with HPD-600 macroreticular resin (Cangzhou Baoen Chemical Co. LTD, China) and ethanol as the eluent.[14,15] Finally, high performance liquid chromatography (HPLC, Agilent 1260, Palo Alto, CA) was performed to obtain hawthorn vitexin. A Waters C18 column (4.6 mm × 250 mm, 5 μm) was used. The mobile phase consisted of acetonitrile/tetrahydrofuran/0.2% formic acid solution (20:1:129, v/v/v), and the flow rate was 1.0 mL min−1. The column temperature was 32°C, and the detection wavelength was 360 nm.[16,17] Standard vitexin extracted from hawthorn leaves was purchased from Shanghai Yuanye Biological Technology Co., LTD (Shanghai, China).
2.3 Cytotoxicity of hawthorn vitexin to BRL-3A hepatocytes
DMEM culture medium containing 10% fetal bovine serum was used to culture BRL-3A hepatocytes, and the concentration of cells in the logarithmic growth phase was controlled to 1 × 105 mL−1. The cells were inoculated into a cell culture flask at 37°C in a 5% CO2 incubator (Thermo, Waltham, MA). The cells were digested with trypsin when they grew to 80% confluence. After centrifugation, the cells were suspended in DMEM containing serum, and their concentration was controlled to 5 × 104 mL−1 to prepare a single-cell suspension. The single-cell suspension was inoculated into a 96-well plate. After adherent culture for 24 h, hawthorn vitexin was added into each well at the concentrations of 0.1, 1, 10, and 100 mg mL−1. At the same time, the control group without hawthorn vitexin and the zeroing well without cells and hawthorn vitexin were set. Six replicates were set for each group, and the cells were cultured for 24 hours. Subsequently, the absorbance at 490 nm of each well was detected via the MTT method by using a Multiskan GO microplate spectrophotometer (Thermo, Waltham, MA). Then, cell survival rates were calculated[18–20] as follows: survival rate = . This study was approved by the ethical committees of Zaozhuang University.
2.4 Effects of ethanol on the survival rate of BRL-3A hepatocytes
The single-cell suspension that was prepared as described in Section “Cytotoxicity of hawthorn vitexin to BRL-3A hepatocytes” was inoculated into a 96-well plate. Then, ethanol was added to each well at the concentrations of 25, 50, 75, and 100 mmol L−1. The control group and zeroing well were also established as reported in Section “Cytotoxicity of hawthorn vitexin to BRL-3A hepatocytes.” Six replicates were set for each group, and the cells were cultured for 12 hours. Subsequently, the cell survival rate was detected via the MTT method. The ethanol concentration corresponding to 50% survival rate was selected as the test concentration.
2.5 Effects of hawthorn vitexin on the survival rate of ethanol-injured BRL-3A hepatocytes
The prepared single-cell suspension was inoculated into a 96-well plate and cultured for 24 hours. 100 mmol·L−1 ethanol was added, and cells were cultured for another 12 hours. Then, ethanol was removed by the change of the culture medium. Hawthorn vitexin was added at the concentrations of 0.2, 0.4, and 0.8 mg mL−1 to each group for 24 hours. Finally, cell survival rates were detected via the MTT method to investigate the effect of hawthorn vitexin on the proliferation of ethanol-injured hepatocytes. The damage model control group (with ethanol) and the normal group (without ethanol and hawthorn vitexin) were set simultaneously.
2.6 Effects of hawthorn vitexin on the SOD activity, MDA content, and GSH-PX activity of ethanol-injured BRL-3A hepatocytes
The method used in this experiment was the same as that reported in Section “Effects of hawthorn vitexin on the survival rate of ethanol-injured BRL-3A hepatocytes.” After the end of culture, the cells were lysed, and SOD activity, MDA content, and GSH-PX activity were detected by using kits.
2.7 Single-cell gel electrophoresis
The method used in this experiment was the same as that presented in Section “Effects of hawthorn vitexin on the survival rate of ethanol-injured BRL-3A hepatocytes.” The cells were collected, and 100 μL of 1% normal melting point agarose (NMA) was spread on a frosted glass slide. The gel was flattened with a cover slide to avoid the formation of air bubbles. The agarose was solidified at 4°C. Then, the cover slide was removed. A total of 10 μL of cell suspension (1 × 105 mL−1) was mixed with 90 μL of 1% low melting point agarose (LMA). The mixture was spread on the NMA and flattened with a cover slide. The gelatinized frosted glass slide was placed in precooled lysate for lysis at 4°C for 2 hours in the dark. The slides were removed from the lysate and soaked thrice in precooled deionized water for 5 minutes. Electrophoresis was performed at 25 V for 30 minutes. At the end of electrophoresis, the slides were removed from the electrophoresis tank and soaked thrice in precooled neutralization solution for 5 minutes. After staining with 0.5 mg·L−1 propidium iodide, the DNA of a single cell was observed by using a fluorescence microscope (Olympus BX51, Tokyo, Japan). Image analysis was conducted with Comet Assay Software Project (CASP 1.2.3, Wroclaw, Poland).[21–23]
2.8 Real-time quantitative polymerase chain reaction
The method used in this experiment was the same as that reported in Section “Effects of hawthorn vitexin on the survival rate of ethanol-injured BRL-3A hepatocytes,” and the cells were collected after treatment. The total RNA of the cells in each treatment group was extracted, and the purity and content of RNA were detected by using NanoDrop One Microvolume UV-Vis spectrophotometers (Thermo, USA). Then, RNA was transcribed into cDNA with a RevertAid First Strain cDNA Synthesis kit (#K1622, Fermantas, EU, Waltham, MA). Real-time quantitative polymerase chain reaction using SYBR Green I (Applied Biosystems, Foster City, CA) was performed for the absolute quantitative detection of the mRNA expression of the SOD gene, and the β-actin gene was used as the internal control. The primers of the SOD gene were AAGGCCTGCATGGATTCCA and TTGGCCCACCGTGTTCT, and the primers of the β-actin gene were GCTCGTCGTCGTCGACAACGGCTC and CAAACATGATCTGGGTCATCTTCTC.
2.9 Statistical methods
SPSS statistical software 22.0 was used for paired sample T test. P < .05 was considered to be statistically significant.
3 Results
3.1 Isolation and purification of hawthorn vitexin
Vitexin is a flavonoid, and its chemical structural formula is 8-β-D-glucopyranosyl-5,7-dihydroxy-2-(4-hydroxyphenyl)-4H-1-Benzopyran-4-one) (Fig. 1A).[14,15] Hawthorn vitexin in the crude extract was collected by HPLC in accordance with the elution time of the standard substance, and its purity was determined to exceed 95%. The withdrawal rate of purified vitexin was 0.47% (Fig. 1B–D).
Figure 1: HPLC chromatograms of hawthorn vitexin. (A) Chemical structural formula of vitexin; (B) standard substance; (C) crude extract of hawthorn vitexin; (D) purified vitexin.
3.2 Hepatotoxicity of hawthorn vitexin
The results showed that 0 to 1 mg·mL−1 hawthorn vitexin had no significant cytotoxicity against the survival of hepatocytes (P > .05), Cell activity decreased significantly when the concentration of hawthorn vitexin reached 10 and 50 mg·mL−1, indicating significant cytotoxicity (P < .01). Therefore, the concentration of hawthorn vitexin in this study was set as 0 to 1 mg·mL−1 (Fig. 2).
Figure 2: Effects of different concentrations of hawthorn vitexin on the survival rates of BRL-3A hepatocytes. Compared with the control group, ∗∗ P < .01.
3.3 Effects of ethanol on BRL-3A hepatocyte proliferation
The results showed that the cell survival rate of each treatment group was significantly different from that of the control group. The lethal rate of the hepatocytes was 52.7% when the ethanol concentration was 100 mmol·L−1. Therefore, 100 mmol·L−1, which was chosen as the median lethal concentration, was used as the experimental concentration in subsequent experiments in this study (Fig. 3).
Figure 3: Effects of ethanol on the survival rates of BRL-3A hepatocytes. Compared with the control group, ∗ P < .05, ∗∗ P < .01.
3.4 Effect of hawthorn vitexin on the survival rate of ethanol-injured BRL-3A hepatocytes
The results showed that the cell survival rate of the ethanol model group was considerably lower than that of the normal control group, indicating that the model of ethanol-injured hepatocytes was successfully constructed. Compared with the ethanol control treatment, 0.2 mg·mL−1 hawthorn vitexin could significantly improve the survival rate of injured hepatocytes (P < .05), and treatment with 0.4 and 0.8 mg·mL−1 hawthorn vitexin could remarkably improve the survival rate of injured hepatocytes (P < .01) (Fig. 4).
Figure 4: Effects of different concentrations of hawthorn vitexin on the survival rates of ethanol-injured BRL-3A hepatocytes. Compared with the normal control group, ΔΔ P < .01. Compared with the ethanol control group, ∗ P < .05, ∗∗ P < .01.
3.5 Effects of hawthorn vitexin on DNA damage in ethanol-injured hepatocytes
Under the fluorescence microscope, DNA was stained orange red by propidium iodide, and the DNA of normal cells showed round bright spots without trailing after electrophoresis (Fig. 5A). The ethanol-injured DNA had a comet-like appearance. Severe DNA injury was reflected by long comet's tails (Fig. 5B). Treatment with 0.2, 0.4, and 0.8 mg·mL−1 hawthorn vitexin could improve ethanol-induced DNA damage in hepatocytes and shorten comet tails. Moreover, high hawthorn vitexin concentrations were associated with obvious improvement (Fig. 5C, D, and E).
Figure 5: Effects of different concentrations of hawthorn vitexin on the DNA damage of ethanol-injured BRL-3A hepatocytes. (A) Normal group; (B) alcohol-injured model group; (C) 0.2 mg·mL−1 hawthorn vitexin group; (D) 0.4 mg·mL−1 hawthorn vitexin group; (E) 0.8 mg·mL−1 hawthorn vitexin group (400×).
The Olive tail moment of ethanol-injured hepatocytes showed a decreasing trend with the increase in hawthorn vitexin concentration. When the hawthorn vitexin concentration reached 0.8 mg·mL−1, the Olive tail moment of the injured cells decreased to 15.0 ± 3.1 μm. This result further demonstrated the repairing effect of hawthorn vitexin on alcohol-injured hepatocytes, and that this effect was dose-dependent (Fig. 6).
Figure 6: Effects of different concentrations of hawthorn vitexin on the Olive tail moment of ethanol-injured BRL-3A hepatocytes. Compared with the normal control group, ΔΔ P < .01. Compared with the ethanol control group, ∗ P < .05, ∗∗ P < .01.
3.6 Effects of hawthorn vitexin on SOD activity, MDA content, GSH-Px activity, and SOD gene expression in ethanol-injured BRL-3A hepatocytes
Comparison with the normal control group revealed that ethanol could significantly reduce SOD and GSH-PX activity and increase MDA content in BRL-3A hepatocytes. Compared with the same indexes in the ethanol-injured group, the antioxidant indexes of injured cells in the 0.2, 0.4, and 0.8 mg·mL−1 hawthorn vitexin treatment groups had significantly improved. Specifically, SOD and GSH-Px activity increased and MDA content decreased in the hepatocytes in the 0.2 mg·mL−1 group (P< .05), and SOD and GSH-Px activity remarkably increased and MDA content decreased in the 0.4 and 0.8 mg·mL−1 groups (P< .01) (Table 1).
Table 1 -
Effects of different concentrations of hawthorn vitexin on SOD activity, MDA content, and GSH-Px activity in ethanol-injured BRL-3A hepatocytes.
Group |
SOD/kU·g−1 pro |
MDA/μmol·g−1 pro |
GSH-Px/kU·g−1 pro |
Normal control |
5.98 ± 0.66 |
1.12 ± 0.18 |
16.74 ± 2.03 |
Ethanol control |
1.95 ± 0.24ΔΔ
|
3.51 ± 0.39ΔΔ
|
6.02 ± 1.01ΔΔ
|
0.2 mg/mL hawthorn vitexin |
2.83 ± 0.32∗∗
|
3.16 ± 0.35∗
|
8.64 ± 3.08∗
|
0.4 mg/mL hawthorn vitexin |
4.45 ± 0.57∗∗
|
2.28 ± 0.42∗∗
|
13.36 ± 4.22∗∗
|
0.8 mg/mL hawthorn vitexin |
5.09 ± 0.51∗∗
|
1.91 ± 0.26∗∗
|
15.07 ± 3.15∗∗
|
Compared with the normal control group, ΔΔP < .01. Compared with the ethanol control group, ∗P < .05, ∗∗P < .01.
Comparison with the normal control group revealed that 100 mmol·L−1 ethanol could significantly decrease the mRNA expression of the SOD gene in cells. Compared with that in the ethanol injured group, the expression of the SOD gene in the hepatocytes in the 0.2, 0.4, and 0.8 mg·mL−1 hawthorn vitexin groups had significantly increased in a dose-dependent manner (Fig. 7).
Figure 7: Effects of different concentrations of hawthorn vitexin on the mRNA expression of SOD gene in ethanol-injured BRL-3A hepatocytes. Compared with the normal control group, ΔΔ P < .01. Compared with the ethanol control group, ∗∗ P < .01.
4 Discussion
DNA damage plays an important role in pathophysiological processes, such as tumorigenesis, aging, and inflammation, as well as in diabetes and neurodegenerative diseases. Oxidative stress, lipid peroxidation, glycosylation, and other cellular processes result in DNA damage by inducing the formation of highly active endogenous aldehydes, which directly react with DNA and form aldehyde-derived DNA adducts. Unrepaired DNA damage induced by aldehyde-derived DNA adducts causes the dysregulation of cell homeostasis and results in the predisposition to the formation and accumulation of disease phenotypes. High levels of some highly active aldehydes, such as 4-hydroxynonenal, MDA, acrolein, crotonaldehyde, and methylglyoxal, are associated with cell death, mutation, and cancer. When mice are fed with diluted alcohol (ethanol), their bodies metabolize the alcohol into acetaldehyde, which breaks and damages the DNA in hematopoietic stem cells.[7,8]
The model of ethanol-injured hepatocytes was prepared by adding ethanol into the culture medium. The damage mechanism that accounted for the hepatotoxic effect of ethanol was as follows: in hepatocytes, ethanol was metabolized into toxic acetaldehyde and produced a variety of reactive oxygen radicals that could attack polyunsaturated fatty acids in the cell membrane, result in lipid peroxidation, produce a large number of lipid peroxides, and cause extensive damage.[16,24] In this study, 100 mg·mL−1 ethanol inhibited the survival rate of BRL-3A hepatocytes, injured the DNA of the cells, significantly decreased the activity of SOD and GSH-Px in the cells, and increased the content of MDA. Different concentrations of hawthorn vitexin could alleviate inhibition and damage. Hawthorn vitexin could repair the DNA damage caused by ethanol through an antioxidant effect, which was closely related to the upregulated expression of the SOD gene.
The extraction rate of vitexin, an effective component in hawthorn, can reach 0.87%.[14,15] Experiments on alcoholic liver injury in mice have demonstrated that hawthorn extracts can reduce alcohol-induced liver injury, TNF-α (tumor necrosis factor-α) levels, and cell apoptosis.[25,26] The present study showed that hawthorn vitexin could repair ethanol-injured DNA in vitro. Given the increasing use of hawthorn vitexin in liver injury treatment, the comprehensive study and utilization of hawthorn warrant further development.
5 Conclusions
Hawthorn vitexin could significantly repair hepatocyte growth and ethanol-induced DNA damage via antioxidative effects and showed potential applications in the treatment of liver injury.
Author contributions
Data curation: Yingxia Zhang.
Formal analysis: Chengshi Ding.
Funding acquisition: Chengshi Ding, Jinglong Wang, Deya Wang.
Methodology: Zhongjing Tian, Meiling Kang, Jing Ma, Qing He.
Writing – original draft: Chengshi Ding, Henglun Shen, Yingxia Zhang.
Writing – review & editing: Chengshi Ding, Henglun Shen, Jinglong Wang, Yingxia Zhang, Yanmei Deng, Deya Wang.
References
[1]. Lin BS, Luo MC. Production of composite healthy beverage of Cordyceps militaris and hawthorn. Food Sci 2013;34:293–7.
[2]. Wu M, Liu LT, Xing YW, Yang SJ, Li H, Cao Y. Roles and mechanisms of hawthorn and its extracts on atherosclerosis: a review. Front Pharmacol 2020;11:118.
[3]. Zhang LL, Zhang LF, Xu JG. Chemical composition, antibacterial activity and action mechanism of different extracts from hawthorn (Crataegus pinnatifida Bge.). Sci Rep 2020;10:8876.
[4]. Wu PP, Li FJ, Zhang JY, Yang B, Ji ZJ, Chen WD. Phytochemical compositions of extract from peel of hawthorn fruit, and its antioxidant capacity, cell growth inhibition, and acetylcholinesterase inhibitory activity. BMC Complement Altern Med 2017;17:151.
[5]. Li CJ, Chen Y, Yuan X, et al. Vitexin ameliorates chronic stress plub high fat diet-induced nonalcoholic fatty liver disease by inhibiting inflammation. Eur J Pharmacol 2020;882:173264.
[6]. Lu CC, Xu YQ, Wu JC, et al. Vitexin protects against cardiac hypertrophy via inhibiting calcineurin and CaMKII signaling pathways. Naunyn-Schmiedeberg Arch Pharmacol 2013;386:747–55.
[7]. Garaycoechea GI, Crossan GP, Langevin F, et al. Alcohol and endogenous aldehydes damage chromosomes and mutate stem cells. Nature 2018;553:171–7.
[8]. Voulgaridou GP, Anestopoulos I, Franco R, Panayiotidis MI, Pappa A. DNA damage induced by endogenous aldehydes: current state of knowledge. Mutat Res 2011;711:13–27.
[9]. Liangpunsakul S, Haber P, McCaughan G. Alcoholic liver disease in Asia, Europe, and North America. Gastroenterology 2016;150:1786–97.
[10]. Rashid MI, Fareed MI, Rashid H, et al. Flavonoids and their biological secrets. Plant Hum Health 2019;2:579–605.
[11]. Tian CL, Chang Y, Zhang ZH, et al. Extraction technology, component analysis, antioxidant, antibacterial, analgesic and anti-inflammatory activities of flavonoids fraction from Tribulus terrestris L. leaves. Heliyon 2019;5:e02234.
[12]. Huang WZ, Wang YJ, Jiang XY, Sun YY, Zhao ZX, Li SY. Protective effect of flavonoids from Ziziphus jujuba cv. Jinsixiaozao against acetaminophen-induced liver injury by inhibiting oxidative stress and inflammation in mice. Molecules 2017;22:1781.
[13]. Zakaryan H, Arabyan E, Oo A, Zandi K. Flavonoids: promising natural compounds against viral infections. Arch Virol 2017;162:2539–51.
[14]. Hu GX, Yu HJ, Shao YD, Fang LJ. The content of Vindicum in hawthorn leaves determined by RP-HPLC. Chin Tradit Herbal Drugs 2001;10:905–6.
[15]. Wang CH, Wang YX, Liu HJ. Validation and application by HPLC for simultaneous determination of vitexin-2“-O-glucoside, vitexin-2”-O-rhamnoside, rutin, vitexin, and hyperoside. Pharm Anal 2011;4:291–6.
[16]. Teng FF, Hu XF, Liu CC, Yang ZS, Huang FF, Ding GF. To establish and research liver cell injury model induced by LPS. J Anhui Agri Sci 2014;42:1071–3.
[17]. Guo YX, Li N, Zhang YL, Hao CQ. Purification process of total flavonoids of Crataegus leaves with macroreticular resin. Chin Tradit Pat Med 2006;28:23–6.
[18]. He YF, Zhu QJ, Chen M, et al. The changing 50% inhibitory concentration (IC50) of cisplatin: a pilot study on the artifacts of the MTT assay and the precise measurement of density-dependent chemoresistance in ovarian cancer. Oncotarget 2016;7:70803–21.
[19]. Śliwka L, Wiktorska K, Suchocki P, et al. The comparison of MTT and CVS assays for the assessment of anticancer agent interactions. PLoS One 2016;11:e0155772.
[20]. Yedjou CG, Tchounwou PB. In-vitro cytotoxic and genotoxic effects of arsenic trioxide on human leukemia (HL-60) cells using the MTT and alkaline single cell gel electrophoresis (Comet) assays. Mol Cell Biochem 2007;301:123–30.
[21]. Bansal SS, Goel M, Aqil F, Vadhanam MV, Gupta RC. Advanced drug delivery systems of curcumin for cancer chemoprevention. Cancer Prev Res 2011;4:1158–71.
[22]. Barnaby SN, Yu SM, Tsiola A, Fath KR, Banerjee IA. pH dependent spontaneous growth of ellagicacid assemblies for targeting HeLa cells. J Nanosci Nanotechnol 2011;11:7579–86.
[23]. Wang HK, Zhang YX, Tian ZJ, et al. Preparation of β-CD-Ellagic acid microspheres and their effects on HepG2 cell proliferation. Molecules 2017;22:2175.
[24]. Yan GM, Dai M, Xuan ZH, Li YY. The protective effect of paeonol on acute hepatocyte injury. Chin Tradit Pat Med 2015;37:854–8.
[25]. Liu G, Zhang YX, Liu CC, et al. Luteolin alleviates alcoholic liver disease induced by chronic and binge ethanol feeding in mice. J Nutr 2014;144:1009–15.
[26]. Babenko NA, Shakhova EG. Effects of flavonoids on sphingolipid turnover in the toxin-damaged liver and liver cells. Lipids Health Dis 2008;7:01.