Secondary Logo

Journal Logo

Organization of the CYP1A cluster on human chromosome 15: implications for gene regulation

Corchero, Javier; Pimprale, Satish; Kimura, Shioko; Gonzalez, Frank J.

Original Article
Free

The sequence and organization of the CYP1A cluster on human chromosome 15 was determined. A human genomic clone from a BAC library, containing both CYP1A1 and CYP1A2 genes, was isolated and sequenced. The results of Southern blot analysis using human genomic DNA were compatible with the structure of the BAC clone. The CYP1A1 and CYP1A2 genes are separated by a 23 kb segment that contains no other open reading frames. The CYP1A1 and CYP1A2 genes are in opposite orientation, revealing that the 5′ flanking region is in common between the two genes. Analysis of the sequence obtained revealed the presence of xenobiotic response elements (XREs) previously reported for CYP1A1 and CYP1A2 and several additional consensus sequences for putative XREs. The presence of all the XREs upstream of both genes suggest that some of the regulatory elements known to control CYP1A1 gene expression, could also control CYP1A2 gene expression.

Laboratory of Metabolism, National Cancer Institute, National Institutes of Health, Bethesda, MD, USA

Received 10 May 1999; accepted 19 June 2000

Correspondence to Frank J. Gonzalez, Laboratory of Metabolism, National Cancer Institute, National Institutes of Health, Building 37, Room 3E24, Bethesda, MD 20892, USA Tel: +1 301 496 9067; fax: +1 301 496 8419; e-mail: fjgonz@helix.nih.gov GenBank accession number: AF253322

Back to Top | Article Outline

Introduction

Cytochrome P450s (CYP450) constitute a superfamily of hemeproteins that play an important role in the metabolism of xenobiotics, including drugs, toxins and chemical carcinogens. Of these xenobiotic-metabolizing P450s, the CYP1A family oxidizes polycyclic aromatic hydrocarbons (PAHs) such as 7,12-dimethylbenz[a]anthracene, and arylamine carcinogens such as 2-aminofluorene and 4-aminobiphenyl (Yang, 1988). In addition to being substrates, PAHs are also inducers of the CYP1A1 and CYP1A2 genes (Sogawa & Fujii-Kuriyama, 1993).

The mechanisms of transcriptional regulation of the two CYP1A genes are different. CYP1A1 is not constitutively expressed. While CYP1A1 expression has been demonstrated in liver, kidney, lung and skin only after inducer treatment, CYP1A2 is constitutively expressed in the liver (Kimura et al., 1986).

CYP1A1 gene regulation has been extensively studied. Inducers such as 2,3,7,8-tetrachlorodibezodioxin (TCDD) or 3-methylcholantrene (MC) bind to the aryl hydrocarbon receptor (AHR), which translocates to the nucleus, dimerizes with the AHR nuclear translocator (ARNT), and interacts with cis-acting elements termed xenobiotic responsible elements (XREs, also called DREs and AhREs) located upstream of the CYP1A1 gene. In the human CYP1A1 gene, the 5′ upstream flanking region contains at least seven XREs within the first 1300 bp (Fisher et al., 1990;Kubota et al., 1991).

In contrast to CYP1A1, regulation of the CYP1A2 gene is not as clearly understood. While TCDD and MC also induce the CYP1A2 gene expression, only one XRE was identified at position –2903 of the CYP1A2 5′ flanking region (Quattrochi & Tukey, 1989). This suggests that regulatory elements of the CYP1A2 gene may exist further upstream than 2.9 kb.

The CYP1A1 and CYP1A2 loci are found on human chromosome 15q22-qter (Jaiswal et al., 1987). However, it is not known whether these genes are independent or form a cluster and, if so, how this cluster is organized. Understanding cluster organization and relative orientation of CYP1A1 and CYP1A2 may lead to a better understanding of the mechanisms of regulation of these genes.

Back to Top | Article Outline

Materials and methods

A bacterial artificial chromosome (BAC) genomic library constructed from Hind III partially digested DNA ligated to the Hind III site of the pBeloBAC11 vector (Genome Systems, St Louis, MO, USA), was screened with the human CYP1A1 and CYP1A2 cDNAs (Jaiswal et al., 1985a, 1986). A single clone, which was positive for both CYP1A1 and CYP1A2, was isolated, subjected to restriction analysis mapping and compared with human genomic DNA. The restriction fragments were separated by electrophoresis on a 0.3% agarose gel and transferred on to a nylon membrane (Gene Screen Plus, NEN-Dupont, Boston, MA, USA). The membranes were hybridized with 32P labelled CYP1A1 and CYP1A2 cDNAs or oligonucleotide probes at 42 °C overnight, washed in 2 × SSC and 0.5% SDS at 65 °C for 10 min and exposed to a phosphoimaging screen (Molecular Dynamics, Mountain View, CA, USA) for 2–4 h. The oligonucleotide probes used are as follows:CYP1A1 promoter GGTAGGAACTCAGATGGGTT, CYP1A1 intron 1 CGAGTCCTACCCACCACACT, and CYP1A1 exon 7 GATTGACAGAGAAGGGAA CA, CYP1A2 promoter ACCCTGCCAATCTCAAGCAC, CYP1A2 exon 1 TCCTTCGCT ACCTGCCTAAC and CYP1A2 exon 7 GCATCATCT TCTCACTCAAG.

The BAC clone was sequenced by shotgun cloning into pUC18 and dideoxy chain termination methods by Lark Technologies Inc. (Houston, TX, USA). Nucleotide alignment and analysis of nucleotide data were examined by Mac Vector Software (Oxford Molecular Group Inc., Campbell, CA, USA). The Genbank accession number for the CYP1A cluster is AF253322.

The consensus sequences used for analysing DNA binding sites were as follows: XRE: 5′-TNGCGTG-3′ (Whitlock et al., 1996), HNF-1: degenerated palindrome 5′-GTTAAT-3′ (Tronche et al., 1994), HNF-3: 5′-VAWTRTTKRYTY-3′ (Costa, 1994) and HNF-4: 5′-GGGTCAAAGGTCA-3′ (Sladek, 1994).

Back to Top | Article Outline

Results and discusion

The CYP1A1 and CYP1A2 genes are separated by 23 kb (Fig. 1a). There is no other open reading frame in between the genes. The two genes are orientated in opposite directions with respect to each other, and thus share a common 5′ flanking region. The southern blot data (Fig. 1b) depicts the expected restriction size fragments after digestion with Sac II, Bam HI, Kpn I and Bgl II, and probing with oligonucleotide probes specifically designed to identify CYP1A1 intron 1 and the CYP1A2 promoter, respectively. The size of the bands corresponds exactly with the predicted sizes calculated from the sequence of the CYP1A cluster. Additionally, the results of southern blot analysis using human genomic DNA were compatible with the structure of the BAC clone, indicating that the BAC clone reflects native human DNA and had no longer deletions, insertions or rearrangements (Fig. 1c). The structure of the human CYP1A cluster supports the notion that a gene duplication event led to CYP1A1 and CYP1A2 formation from a common ancestral gene, which is estimated to have occurred between 300 and 350 million years ago (Heilmann et al., 1988). The fact that exons 2, 4, 6 and especially 5 are highly conserved between the two genes also supports this hypothesis (Ikeya et al., 1989).

Fig. 1.

Fig. 1.

The gene structure of CYP1A1 coincides with the previously reported human CYP1A1 gene, isolated from genomic DNA from a human breast carcinoma cell line, MCF-7 (Jaiswal et al., 1985b), with the exception of the first intron. However, the intron 1 sequence is the same as that reported by Kawajiri et al. (1986).

The CYP1A2 gene structure is identical to that described (Ikeya et al., 1989). The sequence of 3700 base pairs of the CYP1A2 5′ flanking region was previously reported (Quattrochi & Tukey, 1989). In the present study, the entire sequence of CYP1A2 5′ flanking region was obtained. Recently, two new genetic polymorphisms for the CYP1A2 gene were reported in humans, exhibiting both higher (Sachse et al., 1999) and lower (Nakajima et al., 1999) activity for caffeine metabolism, respectively, compared to the wild-type. The sequence presented in this work corresponds to the wild-type genotype (Ikeya et al., 1989;Quattrochi & Tukey, 1989).

CYP1A1 gene regulation has been extensively studied (for a review, see Whitlock, 1999). In contrast, the mechanisms for regulation of the CYP1A2 gene remain obscure. The relative orientation of the CYP1A1 and CYP1A2 genes could explain, at least in part, the differences in the regulation of transcription for these two genes. Analysis of both 5′ flanking regions revealed the presence of previously reported XREs for the CYP1A1 gene (Fisher et al., 1990;Kubota et al., 1991) and one XRE at 2.9 kb upstream of the CYP1A2 gene (Quattrochi & Tukey, 1989). Several additional putative XREs were also found upstream of the CYP1A2 gene, suggesting that significant regulatory elements of the CYP1A2 gene may reside even further upstream than 2.9 kb (Table 1). Since all of the XREs are upstream of both genes, it remains a possibility that some of these elements control the expression of both CYP1A1 and CYP1A2 genes (Fig. 2) .

Fig. 2.

Fig. 2.

Table 1

Table 1

Sequence analysis also uncovered the presence of DNA binding sequences for hepatic transcription factors including hepatic nuclear factors HNF-1, HNF-3 and HNF-4 (Fig. 2). Potentially, multiple HNF-1 and HNF-3 binding sites are found within 4 kb of CYP1A2 upstream region, which could explain, at least in part, why CYP1A2 is constitutively expressed in liver (Gonzalez, 1993).

The results of the present study provide new insight into the mechanisms of action of polycyclic aromatic hydrocarbons and other toxins through induction of CYP1A gene expression, which may impact public health issues concerning human carcinogenesis and risk assessment.

Back to Top | Article Outline

References

1. Costa RH. Hepatocyte nuclear factor 3/forkhead protein family: mammalian transcription factors that possess divergent celullar expression patterns and binding specificities. In: Tronche F, Yaniv M, editors. Liver gene expression. Austin, TX: RG Landes Company; 1994, pp. 183 –206.
2. Fisher JM, Wu L, Denison MS, Whitlock JP Jr. Organization and function of a dioxin-responsive enhancer. J Biol Chem 1990; 265: 9676 –9681.
3. Gonzalez FJ. Cytochrome P450 in humans. In: Schenkman JB, Greim H, editors. Cytochrome P450. Berlin, Heildelberg: Springer-Verlag; 1993, pp. 239 –257.
4. Heilmann LJ, Sheen YY, Bigelow SW, Nebert DW. Trout P450IA1: cDNA and deduced protein sequence, expression in liver, and evolutionary significance. DNA 1988; 6: 379 –387.
5. Ikeya K, Jaiswal AK, Owens RA, Jones JE, Nebert DW, Kimura S. Human CYP1A2: sequence, gene structure, comparison with the mouse and rat orthologous gene, and differences in liver 1A2 mRNA expression. Mol Endocrinol 1989; 3: 1399 –1408.
6. Jaiswal AK, Gonzalez FJ, Nebert DW. Human dioxin-inducible cytochrome P1-450: complementary DNA and amino acid sequence. Science 1985a; 228: 80 –83.
7. Jaiswal AK, Gonzalez FJ, Nebert DW. Human P1-450 gene sequence and correlation of mRNA with genetic differences in benzo[a]pyrene metabolism. Nucleic Acids Res 1985b; 13: 4503 –4520.
8. Jaiswal AK, Nebert DW, Gonzalez FJ. Human P3 (450): cDNA and complete amino acid sequence. Nucleic Acids Res 1986; 14: 6773 –6774.
9. Jaiswal AK, Nebert DW, McBride OW, Gonzalez FJ. Human P3-450: cDNA and complete protein sequence, repetitive Alu sequences in the 3′ nontranslated region, and localization of gene to chromosome 15. J Exp Pathol 1987; 3: 1 –7.
10. Kawajiri K, Watanabe J, Gotoh O, Tagashira Y, Sogawa K, Fujii-Kuriyama Y. Structure and drug inducibility of the human cytochrome P-450c gene. Eur J Biochem 1986; 159: 219 –225.
11. Kimura S, Gonzalez FJ, Nebert DW. Tissue-specific expression of the mouse dioxin-inducible P1450 and P3450 genes: differential transcriptional activation and mRNA stability in liver and extrahepatic tissues. Mol Cell Biol 1986; 6: 1471 –1477.
12. Kubota M, Sogawa K, Kaizu Y, Sawaya T, Watanabe J, Kawajiri K. et al. Xenobiotic responsive element in the 5′-upstream region of the human P-450c gene. J Biochem 1991; 110: 232 –236.
13. Nakajima M, Yokoi T, Mizutani M, Kinoshita M, Funayama M, Kamataki T. Genetic polymorphism in the 5′-flanking region of human CYP1A2 gene: effect on the CYP1A2 inducibility in humans. J Biochem 1999; 125: 803 –808.
14. Quattrochi LC, Tukey RH. The human cytochrome Cyp1A2 gene contains regulatory elements responsive to 3-methylcholanthrene. Mol Pharmacol 1989; 36: 66 –71.
15. Sachse C, Brockmöller J, Bauer S, Roots I. Functional significance of a C to A polymorphism in intron 1 of the cytochrome P450 CYP1A2 gene tested with caffeine. Br J Clin Pharmacol 1999; 47: 445 –449.
16. Sladek FM. Hepatocyte nuclear factor (HNF4). In: Tronche F, Yaniv M, editors. Liver gene expression. Austin TX: RG Landes Company; 1994, pp. 207 –230.
17. Sogawa K, Fujii-Kuriyama Y. Regulation of cytochrome P450 expression. In: Schenkman JB, Greim H, editors. Cytochrome P450. Berlin, Heilderberg: Springer-Verlag; 1993, pp. 493 –501.
18. Tronche F, Bach I, Chouard T, Davied-Wattine B, Pontoglio M, Ringeisen F. et al. Hepatocyte nuclear factor 1 (NHF1) and liver gene expression. In: Tronche F, Yaniv M, editors. Liver gene expression. Austin, TX: RG Landes Company; 1994, pp. 155 –182.
19. Whitlock JP Jr, Okino ST, Dong L, Ko HP, Clarke-Katzenberg R, Ma Q, Li H. Cytochrome P450 5: induction of cytochrome P4501A1: a model for analyzing mammalian gene transcription. FASEB J 1996; 10: 809 –818.
20. Whitlock JP Jr. Induction of cytochrome P4501A1. Ann Rev Pharmacol Toxicol 1999; 39: 103 –125.
21. Yang SK. Stereoselectivity of cytochrome P-450 isozymes and epoxide hydrolase in the metabolism of polycyclic aromatic hydrocarbons. Biochem Pharmacol 1988; 37: 61 –70.
Keywords:

cytochromes P450; CYP1A gene cluster; CYP1A1; CYP1A2; XRE; xenobiotics

© 2001 Lippincott Williams & Wilkins, Inc.