Aberrant Distributions of Collagen I, III, and IV in Hirschsprung Disease

Abstract

Background: 

Hirschsprung disease (HSCR) is the most common congenital gut motility disorder, involving a severe anomaly of the enteric nervous system, and is characterized by functional intestinal obstruction due to lack of intrinsic innervation (aganglionosis) in the distal bowel.

Objective: 

The aim of this study was to examine the distribution patterns of collagens I (Col I), III (Col III), and IV (Col IV) in the enteric nervous system of HSCR patients, to determine whether or not collagen levels are altered in the aganglionic bowel.

Methods: 

We measured the expression levels of Col I, Col III, and Col IV in colonic muscle from 129 children with HSCR. The localizations of the 3 collagens and myenteric ganglia were assessed morphologically by immunofluorescence staining. western blots and real-time fluorescence quantitative polymerase chain reaction were performed to examine the relative levels of these collagens in aganglionic, transitional, and ganglionic colon segments.

Results: 

Immunoreactivities of Col I and Col III were high around and within myenteric ganglia in the ganglionic segment, moderate in the transitional segment, and weak in the aganglionic segment. Col IV immunoreactivity showed the opposite pattern, being lowest in the ganglionic segment and highest in the aganglionic segment.

Conclusion: 

Col I and Col III are decreased and Col IV is increased in the distal colon of patients with HSCR.

What Is Known/What Is New

What Is Known

• The extracellular matrix is involved in the pathogenesis of Hirschsprung disease, influencing gut colonization by enteric neural crest cells.
• Collagens are the main components of extracellular matrix and are the most abundant proteins in mammals.

What Is New

• Hirschsprung disease is associated with abnormal collagen levels in the aganglionic bowel.
• Col I and Col III levels in or around the myenteric ganglia increase in going from aganglionic, to transitional, to ganglionic colonic segments, whereas Col IV shows the opposite pattern.

The enteric nervous system (ENS) is predominantly derived from the vagal neural crest, and from other precursors including sacral neural crest ^(1–4). The myenteric plexus is 1 of 2 main plexuses within the gut wall, whose key role is to control gastrointestinal motility ⁽²⁾. In the development of human embryos, vagal neural crest cells enter the foregut dorsolaterally from the neural tube at week 4 and then migrate in a rostral-caudal direction to colonize the full length of the gut at week 7; consequently, if colonization is arrested early, an aganglionic segment is left ⁽⁵⁾. Indeed, defective colonization of neural crest-derived cells in humans can result in the complete absence of the ENS in the distal region of the gastrointestinal tract, forming an aganglionic segment ⁽⁶⁾. Such a failure of colonization of the distal gut by ENS precursors during embryonic development is thought to be the cause of Hirschsprung disease (HSCR), which results in a life-threatening bowel obstruction in approximately 1 in 5000 live births ⁽⁷⁾. HSCR is the most common congenital gut motility disorder. It can result in constipation, vomiting, abdominal distension, and growth failure, but patients may also present with intractable constipation or Hirschsprung-associated enterocolitis in childhood ⁽⁸⁾. Although surgical management is available, constipation and fecal incontinence are common even after pull through surgery in childhood.

Currently known genetic factors appear to account for less than one-third of HSCR cases ⁽⁹⁾, so it is plausible that aberrant composition of the extracellular matrix (ECM) also contributes to the pathogenesis by influencing the gut colonization by enteric neural crest cells. Collagens are the main components of ECM and are the most abundant proteins in mammals; there are 28 different types, forming 8 different classes ⁽¹⁰⁾. Among them, collagen IV (Col IV) is a major component of the basal lamina, and plays a role in maintaining epithelial integrity, gut morphology, and intestinal function ⁽¹¹⁾. Collagen I (Col I) is one of the most abundant ECM proteins, but increased levels of Col I are associated with increased aggressiveness of many solid tumors ^(11,12). Collagen III (Col III) is a diagnostic and prognostic marker of colorectal cancer, often in association with Col I ^(13,14).

Here, to determine whether alterations in the expression and/or location of Col I, Col III, and Col IV occur in people with HSCR, we examined the mRNA and protein levels of these collagens in aganglionic, transitional, and ganglionic colon segments from children with HSCR by means of western blotting (WB), real-time polymerase chain reaction (RT-PCR), and immunofluorescence staining. Our results establish that aberrant patterns of collagen expression occur in the aganglionic bowel of HSCR patients.

METHODS

Human Samples

All studies were approved by the ethics committee of Qilu Hospital, Shandong University (No. 12025). Human samples were taken from discarded tissues excised during surgical operation for HSCR. Permission was given by family members of patients to use these samples for research purposes.

From January 2014 to December 2019, excised colon tissues were collected from 129 children with HSCR (ages from 19 days to 12 years old, 97 boys and 32 girls) treated at the Department of Pediatric Surgery of Qilu Hospital, and colon tissues from 30 children were randomly selected for the present study. All samples obtained from aganglionic, transitional, and ganglionic segments were >100 mg in weight, and were stored at −80°C. In addition, 3 cm of colon tissue from each of the 3 segments was fixed in 4% paraformaldehyde for immunohistochemical staining.

All samples used in this experiment were stripped of the mucosa and submucosa, leaving only the muscle layer (Table 1).

TABLE 1: Clinical data of HSCR cases

Western Blots

Samples were lysed in ice-cold complete lysis buffer (RIPA: PMSF: protease inhibitor cocktail = 100:1:1, Beyotime, Shanghai, China). Protein concentrations were determined with a BCA Protein Assay Kit (Beyotime, Shanghai, China). Protein lysates (20 μg) were separated by SDS-PAGE on 8% polyacrylamide gels (Beyotime, Shanghai, China) and blotted onto polyvinylidene difluoride membrane (Millipore, Germany). Membranes were incubated overnight at 4°C with the primary antibodies, and then incubated for 2 hours at room temperature with horseradish peroxidase-conjugated secondary antibodies (ZSGB-BIO, China). Detection was performed by chemiluminescence (BIORAD ChemiDoc). The antibodies are listed in Table 2.

TABLE 2: Antibodies used in this work

Real-time Fluorescence Quantitative Polymerase Chain Reaction

For RNA extraction, 20 mg tissue samples were lysed in Trizol reagent (Invitrogen, USA, 15596-026), and processed according to the manufacturer's instructions. cDNA products were generated with PrimeScript RT Master Mix kit reverse transcriptase (Takara, Shiga, Japan) and analyzed by qRT-PCR with a SYBR Premix Ex Taq II (Tli RNaseH Plus) quantitative fluorescence kit (Takara, Shiga, Japan) and a Roche LightCycler 480 system. Data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression.

The following primers were used: Col I (forward: TTGGATGGTGCCAAGGGAG; reverse: CACCATCATTTCCACGAGCA); Col III (forward: CGCCCTCCTAATGGTCAAGG; reverse: TTCTGAGGACCAGTAGGGCA); Col IV (forward: TTGCACTCACAACGGACACT; reverse: GTAACAGCCAACCACGGGAG); GAPDH (forward: AGAAGGCTGGGGCTCATTTG; reverse: AGGGGCCATCCACAGTCTTC).

Immunofluorescence Double Staining

Immunofluorescence studies of aganglionic, transitional, and ganglionic segments of colon from patients with HSCR were conducted using standard methodology. Slices 5 μm thick were incubated with 4% paraformaldehyde solution (pH 7.4), blocked with normal goat serum (AR0009, Boster, China), incubated overnight at 4°C with the primary antibodies in 0.1% Triton X-100 (P0096, Beyotime, China), and finally incubated with Alexa Fluor-594 nm and 498 nm secondary antibodies (Invitrogen) at 1:200 for 1 h at 37°C. All antibody incubation, Triton X-100 solution preparation and washing steps were performed in phosphate-buffered saline at pH 7.4. Images were acquired with a fluorescence microscope (Olympus DP 72, Tokyo, Japan) and CellSens Dimension Software image acquisition system equipped with appropriate filters for the secondary antibodies. For graphic display of densitometric analyses, the average intensity of positive staining (Green staining) was measured using Image-Pro Plus 6.0 image analysis software (Media Cybernetics, Bethesda, MD) according to the manufacturer's instructions. This is a semiquantitative analysis based on the intensities and areas of myenteric ganglia and intermyenteric space.

Statistical Analysis

Data are presented as the mean ± standard error of the mean. Statistical analyses were performed using Graphpad Prism 8.0 software. The significance of differences between groups was evaluated using one-way analysis of variance. Differences were considered statistically significant at P < 0.05.

RESULTS

Expression of Col I, Col III, and Col IV in Colon Segments

Ganglionic, transitional, and aganglionic colonic segments of HSCR patients were examined by WB and RT-PCR to determine the protein and mRNA levels of Col I, Col III, and Col IV. The results are shown as relative values with respect to the expression of the house-keeping gene encoding GAPDH (Fig. 1  and Fig. S1, Supplemental Digital Content, https://links.lww.com/MPG/B768). Col I and Col III both showed marked decreases in going from ganglionic to transitional to aganglionic colonic segments of HSCR patients, whereas Col IV showed the opposite pattern, increasing from the ganglionic to aganglionic segments (Fig. 1  A, B and Fig. S1, Supplemental Digital Content, https://links.lww.com/MPG/B768).

FIGURE 1: Expression of Col I, Col III, and Col IV in aganglionic, transitional, and ganglionic colonic segments of 30 randomly selected HSCR patients. A, Western blots of colonic segments incubated with Col I, Col III, and Col IV antibodies. B, Results of quantitation of the band densities in A, showing significant decreases in Col I and Col III and a significant increase in Col IV from the ganglionic to the aganglionic segment. C, The changes of mRNA levels of the 3 collagens determined by real-time polymerase chain reaction (RT-PCR). The differences among the 3 groups are all statistically significant: ^∗, P < 0.05; ^∗∗, P < 0.01; ^∗∗∗∗, P < 0.0001. GAPDH = glyceraldehyde-3-phosphate dehydrogenase.

FIGURE 1 (Continued): Expression of Col I, Col III, and Col IV in aganglionic, transitional, and ganglionic colonic segments of 30 randomly selected HSCR patients. A, Western blots of colonic segments incubated with Col I, Col III, and Col IV antibodies. B, Results of quantitation of the band densities in A, showing significant decreases in Col I and Col III and a significant increase in Col IV from the ganglionic to the aganglionic segment. C, The changes of mRNA levels of the 3 collagens determined by real-time polymerase chain reaction (RT-PCR). The differences among the 3 groups are all statistically significant: ^∗, P < 0.05; ^∗∗, P < 0.01; ^∗∗∗∗, P < 0.0001. GAPDH = glyceraldehyde-3-phosphate dehydrogenase.

To see whether similar alterations exist at the mRNA level, RT-PCR analysis was performed. As shown in Figure 1 C, the changes in mRNA levels were broadly consistent with those in the protein levels (Fig. 1 C).

Immunofluorescence Staining of Col I, Col III, and Col IV

Finally, we analyzed the distributions of the 3 collagen proteins in cross-sections of muscle strips (muscle layers and myenteric plexus) prepared from colonic tissues of human patients with HSCR, to determine the locations and levels of Col I, Col III, and Col IV both around and within myenteric ganglia. The Col I and Col III levels in and around the myenteric ganglia generally increased in going from aganglionic, to transitional, to ganglionic colonic segments, whereas Col IV showed the opposite pattern (Fig. 2 A–D and Fig. S2, Supplemental Digital Content, https://links.lww.com/MPG/B768).

FIGURE 2: Myenteric ganglia of ganglionic, transitional, and muscle interspace of aganglionic colonic segments from 30 randomly selected patients with HSCR. Representative single confocal sections of transverse cuts of human colonic muscles labeled with antibodies against βIII-tubulin (red) and (A) Col I (green), (B) Col III (green), and (C) Col IV (green). Scale bar, 20 μm. D, Quantitative analysis of the immunohistochemical images based on intensities and areas of myenteric ganglions and intermyenteric space. ^∗∗, P < 0.01; ^∗∗∗∗, P < 0.0001.

FIGURE 2 (Continued): Myenteric ganglia of ganglionic, transitional, and muscle interspace of aganglionic colonic segments from 30 randomly selected patients with HSCR. Representative single confocal sections of transverse cuts of human colonic muscles labeled with antibodies against βIII-tubulin (red) and (A) Col I (green), (B) Col III (green), and (C) Col IV (green). Scale bar, 20 μm. D, Quantitative analysis of the immunohistochemical images based on intensities and areas of myenteric ganglions and intermyenteric space. ^∗∗, P < 0.01; ^∗∗∗∗, P < 0.0001.

DISCUSSION

The 3-dimensional structure and components of the ECM provide a microenvironment that plays a key role in the regulation of basic cellular functions. Therefore, it is likely that aberrant expression of components and abnormal structure of the ECM during tissue development could influence cell survival and lead to pathological processes. In particular, collagens are the main components of ECM, and therefore might play a role in the occurrence and development of HSCR ^(15–17). Among them, Col IV, which contains 3 α chains (α1.α1.α2), is the main component of basement membranes. Consequently, Col IV(α1) mutations may lead to a systemic phenotype ⁽¹⁸⁾. Other analyses have identified Col I and Col III as major genes involved in carcinoma invasion, including colorectal carcinoma, malignant astrocytoma and hepatocellular carcinoma ^(13,19,20). Because ENS precursors have been reported to synthesize at least collagen VI ⁽¹⁶⁾, it seems plausible that altered levels of Col I and Col III in the distal colon of HSCR could be related to the absence of ENS. Based on these findings, we speculated that abnormal levels of collagens expression patterns might be involved, at least in part, in the pathogenesis of HSCR.

Therefore, the aim of the present study was to examine the distribution patterns of Col I, Col III, and Col IV in the ENS of HSCR patients, to determine whether or not the collagen levels in the aganglionic bowel are altered. We collected colonic tissues from children with HSCR, and analyzed the levels and distributions of collagens around and within the myenteric ganglia. Col IV is a network-forming collagen ⁽²¹⁾, so it is plausible that excessive deposition of Col IV around myenteric ganglia would impede or block the colonization of enteric neural crest cells. In contrast, Col I and Col III, major components of fibrillar collagen, can increase the tensile strength of tissues and form a functional scaffold for cells, helping cells move directionally along the axis of fibrous structures; this process is important in wound healing and cell migration ^(22–24).

The clear reason that collagen I, III, and IV levels, however, vary between ENS containing and aganglionic bowel are not known. Furthermore, it is not known whether these variations occur during the first trimester of pregnancy when ENS precursors colonize fetal bowel or which cells synthesize these collagens. Although it is possible that altered collagen expression during gestation in people with HSCR predisposes to HSCR, it is at least as likely that the changes in collagen we observe are the result of bowel aganglionosis. Further work will be required to determine whether these alterations in collagen occur during early gestation when ENS precursors colonize fetal bowel.