Secondary Logo

Share this article on:

Study of tumor necrosis factor-α-308 promoter polymorphism in psoriasis vulgaris

Elfarargy, Shawkya; Farag, Azza G.A.a; Azmy, Rania M.b; Abdullah, Mona S.a

Journal of the Egyptian Women's Dermatologic Society: May 2014 - Volume 11 - Issue 2 - p 117–122
doi: 10.1097/01.EWX.0000445218.46201.6a
Original articles

Background The etiology of psoriasis is still unclear. Defining the molecular genetics of psoriasis may enhance our understanding of the disease process. An association of psoriasis vulgaris with functional polymorphisms in the tumor necrosis factor (TNF) gene has been reported in some populations.

Objective To analyze the association of polymorphisms of the TNF-α gene in psoriasis vulgaris cases and its relation to TNF-α serum levels in the etiopathogenesis of this disease in a sample of Egyptian patients.

Patients and methods This case–control study included 30 patients with psoriasis vulgaris and 20 controls who were examined to detect G–A transition polymorphism at position −308 of the TNF-α gene by PCR and estimation of TNF-α serum levels by enzyme linked immunosorbent assay.

Results Compared with the controls, patients with psoriasis vulgaris showed a high frequency of the TNF-α-308GG genotype (P<0.05) and highly significantly elevated G allele (P=0.03). The mean serum level of TNF-α was significantly elevated in psoriasis vulgaris cases than in the controls (P=0.001), and was correlated with the severity of psoriasis (P<0.03).

Conclusion A significant association was found between the different genotypes of the TNF-α gene polymorphism and psoriasis, suggesting that the TNF-α gene polymorphism may play a possible active role in the etiopathogenesis of psoriasis vulgaris.

Departments of aDermatology

bBiochemistry, Faculty of Medicine, Menoufiya University, Menoufiya, Egypt

Correspondence to Azza G.A. Farag, MD, Department of Dermatology, Andrology and STDs, Faculty of Medicine, Menoufiya University, Shibeen El Koom, 32511 Menoufiya, Egypt Tel: +20 109 778 7204; fax: +204 8223 3521; e-mail: elsayedib@yahoo.com

Received January 25, 2014

Accepted February 24, 2014

Back to Top | Article Outline

Introduction

Psoriasis is a common autoimmune inflammatory skin disease with a multifactorial genetic basis 1. It affects ∼4.8% of the world’s population 2.

The hypothesis of immunological disorder in psoriasis is described by abnormal keratinocyte proliferation mediated through T lymphocytes-induced inflammation 3. Autoimmune disorders and inflammatory reactions are currently segregated into cell-mediated Th1 or Th2 categories. Psoriasis is associated with an overexpression of proinflammatory cytokines produced by Th1 cells and the relative underexpression of Th2 cytokines 4.

Tumor necrosis factor-α (TNF-α) has been shown to play a fundamental role in the pathogenesis of psoriasis 5. This role may be mediated through several pathogenic mechanisms, including the expression of adhesion molecules on the surface of endothelial cells, keratinocyte, and dendritic cells that promote leukocyte migration 6. TNF-α and interferon-γ stimulate the production of TNF-α by epidermal cells that may, together with interleukin-8 (IL-8), be involved in autocrine stimulation of keratinocyte proliferation 7. Recently, several TNF-α inhibitors have either been approved or are undergoing clinical trials for the treatment of psoriasis 8.

Genetic factors are likely to play a fundamental role in the manifestation of psoriasis 9. The results of family, twin, and human leukocyte antigen (HLA) allotype studies as well as genome-wide scans in affected families all point to a genetic basis for psoriasis susceptibility, which is complex and likely to reflect the action of a number of genes 10.

Many studies have attempted to identify genetic polymorphisms in psoriasis that act as markers of disease susceptibility 10,11. The main genes analyzed are the major histocompatibility complex HLA-Cw*0602 11 and the genes encoding TNF 12, various interleukins such as IL-1, IL-6, and IL-10 13, subunit p40 common to IL-12 and IL-23, a subunit of the IL-23 receptor 14, IL-13 and IL-15 15, SNF313 (a gene implicated in protein ubiquitination) 16, and transforming growth factor, 17 as well as the promoter of the gene encoding interferon 18.

The TNF-α gene is located on the short arm of chromosome 6, very close to the major histocompatibility complex B. This region is highly polymorphic, with up to 44 polymorphisms reported 19.

In psoriasis, the most widely studied polymorphisms are substitution of guanine by adenine at positions 238 and 308 (−238G→A, −308G→A), which have been associated with the severity of psoriasis 20, substitution of cytosine by thymine at position 857 (−857C→T), which has been associated with a greater risk of psoriatic arthritis, and substitution of thymine by cytosine at position 1031(−1031T→C) 21.

This work aimed to investigate the genetic polymorphisms in the TNF-α308 promoter in a sample of Egyptian patients and to establish possible allelic and genetic differences between them and healthy controls and its relation to TNF-α in serum.

Back to Top | Article Outline

Patients and methods

Patients

Thirty patients with psoriasis vulgaris attending the Dermatology Outpatient Clinic of Menoufiya University Hospital were recruited for this case–control study during the period from October 2012 to July 2013. The study was approved by the Committee of Human Rights in Research of Menoufiya University. Twenty age-matched and sex-matched healthy volunteers were included as controls. An informed consent was signed by all participants.

Back to Top | Article Outline

Inclusion criteria

Patients of both sexes with psoriasis vulgaris were included in this study.

Back to Top | Article Outline

Exclusion criteria

Patients receiving any topical or systemic treatment for psoriasis in the last 2 weeks before blood sampling, and participants (patients or controls) with a personal or a family history, or association of any autoimmune diseases were excluded from the study.

Back to Top | Article Outline

Methods

Each patient in the study was subjected to the following:

  • Full clinical assessment.
  • Assessment of the psoriasis area and severity index (PASI) scores to determine the degree of severity of psoriasis 22.
  • Blood sampling for:
    • detection of TNF-α serum level;
    • detection of the TNF-α gene polymorphism.

Control individuals were subjected to blood sampling for the detection of TNF-α serum level and the TNF-α gene polymorphism.

Back to Top | Article Outline

Blood sampling

A volume of 10 ml of venous blood was withdrawn from the cubital vein of all participants under aseptic conditions. A volume of 5 ml was transferred slowly into a plain tube for determination of the serum TNF-α level. The other 5 ml was transferred slowly into a vaccumated EDTA tube for isolation of white blood cells for genotyping.

Back to Top | Article Outline

Detection of serum TNF-α level

Serum levels of TNF-α were measured using an enzyme linked immunosorbent assay following the protocol provided by the manufacturer (Anogen, Mississauga, Ontario, Canada).

Back to Top | Article Outline

Detection of the TNF-α gene polymorphism

Peripheral blood mononuclear cells isolation was performed using a lymphofot solution (BiotestAG, Dreieich, Germany). DNA extraction was performed using QIA Amp (R) DNA Blood Mini Kits (Qiagen, Hilden, Germany). Genotyping of the TNF-α gene polymorphism was carried out using allele-specific polymerase chain reaction to detect the G→A transition polymorphism of position −308 of the TNF-α gene. Three primers were used for the allele-specific polymerase chain reaction: the forward primer (F: CTGCATCCCCGTCTTTCTCC) was used in combination with either R1 primer (ATAGGTTTTGAGGGGCATCG) for the G allele or R2 primer (ATAGGTTTTGAGGGGCATCA) for the A allele. The amplification reaction was performed in 25 μl final volume(10 μl DNA template+15 μl master mix containing 2.5 μl,10× PCR, 2 μl MgCl 25 mmol/l, 0.5 μl dNTPs, 10 mmol/l, and 1.0 μl of each forward and reverse primer 20 mmol/l and 7.5 μl distilled water). PCR amplification was performed using Perkin Elmar thermal Cycler 2400 (Foster, California, USA). PCR conditions were as follows: first initial denaturation at 96°C for 5 min, 35 cycles, 94°C for 30 s (denaturation), 58°C for 30 s (annealing), 72°C for 1 min (extraction), and then a final extraction step at 72°C for 5 min.

Back to Top | Article Outline

Statistical analysis

The computer software package SPSS 15.0 (SPSS Inc., Chicago, Illinois, USA) was used in the analysis. For continuous quantitative data, mean/median (as a measure of central tendency), SD, minimum, and maximum (as measures of variability) were presented. Frequency and percentages were presented for categorical data. Independent t-test, Mann–Whitney test, and Kruskal–Wallis test were used to estimate differences in quantitative variables. The χ 2-test was used to estimate differences in qualitative variables. Odds ratio with a 95% confidence interval was used to compare cases with controls for genotype or allele frequencies. P-value less than 0.05 was considered significant.

Back to Top | Article Outline

Results

Clinical results

Patient group comprised 13 male (43.3%) and 17 female (56.7%) patients; their ages ranged between 12 and 63 years, mean 35.93±14.34 years. In terms of onset of psoriasis, 15 patients had early-onset psoriasis (onset before 30 years of age) and the other 15 patients had late-onset psoriasis (onset after 30 years of age). The duration of illness ranged between 1 and 21 years, mean 7.93±6.30 years. The PASI score ranged between 3.1 and 29.1, with a mean of 10.4±5.7. Twenty sex-matched and age-matched healthy volunteers were chosen as control participants; there were 12 male and eight female patients, age range 13–63 years, mean 36.35±16.11 years.

Back to Top | Article Outline

TNF-α serum levels

Compared with the controls, TNF-α serum levels in psoriatic patients were highly significantly elevated (3.98±0.65) and (6.85±1.12) pg/ml, respectively (P=0.001) (Fig. 1). In terms of the relation between TNF-α serum levels and the clinical parameters studied (Tables 1 and 2), we observed a positive significant correlation between TNF-α serum levels and disease severity (PASI score) (P<0.03). Patients with a positive family history were found to have significantly high TNF-α serum levels than those with a negative family history (P<0.001).

Figure 1

Figure 1

Table 1

Table 1

Table 2

Table 2

Back to Top | Article Outline

TNF-α-308 gene polymorphism

The distributions of genotype and allele frequencies of analyzed DNA are shown in (Figs 2–4). Frequencies of the TNF-α gene in psoriasis showed a significant elevation in the polymorphisms of the TNF-α promoter −308 (GG) and a decrease in the (AA) genotype compared with the controls (40 vs. 10% and 16.7 vs. 35%), respectively (P=0.05) (Fig. 3). We observed a significantly higher frequency of the G allele and a lower frequency of the A allele in cases than in the controls (61.7 vs. 40% and 38.3 vs. 59.5%), respectively (odds ratio=2.37, 95% confidence interval=1.06–5.3, P=0.03; Fig 4).

Figure 2

Figure 2

Figure 3

Figure 3

Figure 4

Figure 4

On plotting TNF-α genotypes against the clinical parameters studied, the result showed that the TNF-α-308 (GG) genotype was associated with the severity of psoriasis (high values of the PASI score), and in patients with a positive family history (P=0.02, for both), no other significant association could be detected for other clinical parameters (all P’s>0.05) (Table 3).

Table 3

Table 3

On comparing TNF-α serum levels of different TNF-α-308 genotypes (AA, GA, and GG), the TNF-α-308GG genotype was found to be associated with high serum TNF-α levels (P<0.001) (Table 3).

Analysis of the results of TNF-α-308 allele frequencies in relation to the clinical parameters studied showed that the TNF-α-308 G allele frequency was elevated compared with the TNF-α-308 A allele in patients with a positive family history (P=0.005), early onset of psoriasis (P=0.03), and those with nail changes (P=0.04) (Table 4).

Table 4

Table 4

Back to Top | Article Outline

Discussion

TNF-α is a proinflammatory cytokine that has been implicated as a key cytokine in the pathogenesis of psoriasis 23.

In the current study, the serum TNF-α level in psoriatic patients was significantly higher than that in the controls. Our results are in agreement with those of many authors 24,25. In addition, Nakamura et al. 26 recorded a higher mean TNF-α serum level in patients with pustular psoriasis and palmoplantar pustulosis than controls. Moreover, TNF-α and its receptors play important roles in the development and persistence of psoriatic plaques 27. In contrast to our finding is that of Tigalonova et al. 28, who reported that the serum level of TNF-α did not differ between the psoriasis and the control groups.

The present study found a significant positive correlation between serum levels of TNF-α and PASI score (P=0.03); this result is in agreement with that of some investigators 26,29 and in disagreement with that of others 25.

The search for genetic factors in psoriasis has led to the identification of several psoriasis susceptibility loci (PSORS) 30. Of particular interest is the study of polymorphisms in the TNF-α gene. There are several polymorphisms in the promoter region of the TNF-α gene. The most common polymorphisms are two G to A transitions in the promoter at positions −238 and −308. These polymorphisms may affect cytokine production 31.

In this study, we observed a higher frequency of the TNF-α-308GG genotype in psoriatic patients than in the controls; this observation was reported among 375 German psoriatic patients 21 and in 46 cases with psoriasis recruited from the Nile Delta of Egypt 32. Also, Gallo et al. 33 observed a high frequency of the TNF-α-308GG genotype in psoriatic patients than in the controls (83.3 vs.78.9%) in their Spanish study, although the difference was not statistically significant.

However, some studies have found no significant associations between TNF-α-308 promoter polymorphisms and psoriasis 12,21,34,35. The different results can be attributed to differences in population or race, and insufficient sample size both for patients and for controls.

The highest PASI scores were found for the TNF-α-308GG genotype in our psoriatic patients. Also, Settin et al. 32 reported a high frequency of the TNF-α-308GG genotype in psoriatic cases with moderate severity, and two published studies 33,36 concluded that the TNF-α-238GG genotype is more frequent among individuals with more severe forms of psoriasis.

The TNF-α gene polymorphism is associated with increased TNF-α production in carriage of the TNF-α-857T genotype. This has been reported in many diseases such as psoriatic arthritis 21, acute uveitis 15, and gastric B cell lymphoma 16. Possibly, the association observed between TNF-α serum level and the TNF-α-308GG genotype in our psoriatic patients might also be explained by an increased TNF production.

Settin et al. 32, in their analysis of cases-subgroups, reported no significant difference in the TNF-α-308GG genotype related to age and sex of their studied cases, similar to of our results. Moreover, we did not find any significant difference among the TNF-α-308 genotypes (GG, AG, and AA) related to other clinical parameters studied (onset of disease, nail changes, and koebnerization), except for those patients with a positive family history of psoriasis.

With respect to allele counts, our investigation found a higher number of G alleles and lower number of A alleles in patients than in controls (P=0.03). Similar studies have also reported a decreased frequency of the TNF-α −308A allele 37, with a trend toward increased frequency of the G allele in early-onset psoriasis 38, similar to our result. However, other investigators reported no difference in the distribution of TNF-α alleles from control participants 13. Furthermore, in a meta-analysis published by Li et al. 39 on polymorphisms of TNF-α at positions −238 and −308, the authors concluded that the presence of a wild-type G allele might play a protective role in psoriasis.

Back to Top | Article Outline

Conclusion

On the basis of our results, we can conclude that polymorphisms of TNF-α at position −308 in psoriasis vulgaris could play an active role in the pathophysiology of this disease and might contribute toward its predisposition. Also, our findings support the concept that promoter polymorphisms of the TNF-α gene might modify certain aspects of psoriasis, such as its severity, age of onset, and associated nail changes.

To provide more conclusive evidence of the role of the TNF-α gene in psoriasis, a large number of patient and family studies are needed. Further investigation of polymorphisms of the TNF gene region and other proteins implicated in the pathophysiology of psoriasis will be helpful in elucidating its pathogenesis and identification of other possible therapeutic targets.

Back to Top | Article Outline

Acknowledgements

Conflicts of interest

There are no conflicts of interest.

Back to Top | Article Outline

References

1. Rahman P, O’Rielly DD.Psoriatic arthritis: genetic susceptibility and pharmacogenetics.Pharmacogenomics2008;9:195–205.
2. Naldi L.Epidemiology of psoriasis (review).Curr Drug Targets Inflamm Allergy2004;3:121–128.
3. Chamian F, Krueger JG.Psoriasis vulgaris: an interplay of T lymphocytes, dendritic cells, and inflammatory cytokines in pathogenesis (review).Curr Opin Rheumatol2004;16:331–337.
4. Gudjonsson JE, Johnston A, Sigmundsdottir H, Valdimarsson H.Immunopathogenic mechanisms in psoriasis (review).Clin Exp Immunol2004;135:1–8.
5. Haider AS, Cohen J, Fei J, Zaba LC, Cardinale I, Toyoko K, et al..Insights into gene modulation by therapeutic TNF and IFNγ antibodies: TNF regulates IFNγ production by T cells and TNF-regulated genes linked to psoriasis transcriptome.J Invest Dermatol2008;128:655–666.
6. González-Quintela A, Dominguez-Santalla M-J, Loidi L, Quinteiro C, Perez LF.Relation of tumor necrosis factor (TNF) gene polymorphisms with serum concentrations and in vitro production of TNF-alpha and interleukin-8 in heavy drinkers.Alcohol2004;342–3273–277.
7. Hüffmeier U, Lascorz J, Traupe H, Böhm B, Schürmeier-Horst F, Ständer M, et al..Systematic linkage disequilibrium analysis of SLC12A8 at PSORS5 confirms a role in susceptibility to psoriasis vulgaris.J Invest Dermatol2005;125:906–912.
8. Walsh N.TNF blocker curbs psoriatic arthritis.Ann Rheum Dis2013;72:1777–1785.
9. Rahman P, Siannis F, Butt C, Farewell V, Peddle L, Pellett F, Gladman D.TNFα polymorphisms and risk of psoriatic arthritis.Ann Rheum Dis2006;65:919–923.
10. Capon F, Dallapiccola B, Novelli G.Advances in the search for psoriasis susceptibility genes (short survey).Mol Genet Metab2000;711–2250–255.
11. Valdimarsson H.The genetic basis of psoriasis.Clin Dermatol2007;25:563–567.
12. Baran W, Szepietowski JC, Mazur G, Baran E.A-308 promoter polymorphism of tumor necrosis factor alpha gene does not associate with the susceptibility to psoriasis vulgaris. No difference either between psoriasis type I and type II patients.Acta Dermatovenerol Alp Pannonica Adriat2006;15:113–118.
13. Baran W, Szepietowski JC, Mazur G, Baran E.IL-6 and IL-10 promoter gene polymorphisms in psoriasis vulgaris.Acta Derm Venereol2008;88:113–116.
14. Nair RP, Ruether A, Stuart PE, Jenisch S, Tejasvi T, Hiremagalore R, et al..Polymorphisms of the IL12B and IL23R genes are associated with psoriasis.J Invest Dermatol2008;128:1653–1661.
15. Duffin KC, Krueger GG.Genetic variations in cytokines and cytokine receptors associated with psoriasis found by genome-wide association (review).J Invest Dermatol2009;129:827–833.
16. Gudjonsson JE.Genetic variation and psoriasis (review).G Ital Dermatol Venereol2008;143:299–305.
17. Baran W, Szepietowski JC, Mazur G, Baran E.TGF-β1 gene polymorphism in psoriasis vulgaris.Cytokine2007;38:8–11.
18. Baran W, Szepietowski JC, Mazur G, Baran E.IFN-γ promoter gene polymorphism in psoriasis vulgaris.Biomarkers2008;13:52–58.
19. Llanos MC, Soto SL, Sabugo SF, Bastías Ch MJ, Salazar AL, Aguillón GJC, Cuchacovich TM.The influence of -238 and -308 TNF α polymorphisms on the pathogenesis and response to treatment in rheumatoid arthritis (review).Rev Med Chil2005;133:1089–1095.
20. Oregón-Romero E, Mercado M.V.-D., Ruiz-Quezada SL, Navarro-Hernández RE, Rangel-Villalobos H, Martínez-Bonilla G, et al..Tumor necrosis factor α-308 and -238 polymorphisms in rheumatoid arthritis. Association with messenger RNA expression and sTNF-α.J Invest Med2008;56:937–943.
21. Reich K, Hüffmeier U, König IR, Lascorz J, Lohmann J, Wendler J, et al..TNF polymorphisms in psoriasis: association of psoriatic arthritis with the promoter polymorphism TNF*-857 independent of the PSORS1 risk allele.Arthritis Rheum2007;56:2056–2064.
22. Sampogna F, Gisondi P, Melchi CF, Amerio P, Girolomoni G, Abeni D.Prevalence of symptoms experienced by patients with different clinical types of psoriasis.Br J Dermatol2004;151:594–599.
23. Chiricozzi A, Guttman-Yassky E, Suárez-Farĩas M, Nograles KE, Tian S, Cardinale I, et al..Integrative responses to IL-17 and TNF-α in human keratinocytes account for key inflammatory pathogenic circuits in psoriasis.J Invest Dermatol2011;131:677–687.
24. Alshorafa AKH, Guo Q, Zeng F, Chen M, Yin R, Tan G, Tang Z.Psoriasis is associated with low serum levels of hydrogen sulfide, a potential anti-inflammatory molecule.Tohoku J Exp Med2012;228:325–332.
25. EL Reweny AA, Alghaithy AAA, Hamdy A.A study to compare tumor necrosis factor alpha in psoriatic patients versus normal population from Taibah University and its possible role as a marker of disease severity.Med J Cairo Univ2012;80:47–52.
26. Nakamura S, Takeda K, Hashimoto Y, Mizumoto T, Iizuka H, Toshio D.Levels of tumor necrosis factor-alpha, interleukin-6, and interferon-gamma during the active phases of bechet’s disease, pustular psoriasis, palmoplantar pustulosis, and Stevens-Johnson syndrome: a pilot study.J Clin Exp Dermatol Res2013;4:175.
27. Elias AN, Nanda VS, Pandian R.Serum TNF-α in psoriasis after treatment with propylthiouracil, an antithyroid thioureylene.BMC Dermatol2004;4:4.
28. Tigalonova M, Bjerke JR, Gallati H, Degre M, Jablonska S, Majewski S, Matre R.Serum levels of interferons and TNF-α are not correlated to psoriasis activity and therapy (Conference Paper).Acta Derm Venereol Suppl1994;186:25–27.
29. Mussi A, Bonifati C, Carducci M, D’Agosto G, Pimpinelli F, D’Urso D, et al..Serum TNF-alpha levels correlate with disease severity and are reduced by effective therapy in plaque-type psoriasis.J Biol Regul Homeost Agents1997;11:115–118.
30. Nair RP, Stuart PE, Nistor I, Hiremagalore R, Chia NVC, Jenisch S, et al..Sequence and haplotype analysis supports HLA-C as the psoriasis susceptibility 1 gene.Am J Hum Genet2006;78:827–851.
31. Rácz E, Prens EP.Molecular pathophysiology of psoriasis and molecular targets of antipsoriatic therapy (Review).Expert Rev Mol Med2009;11:e38. doi: 10.1017/S146239940900129X.
32. Settin A, Hassan H, El-Baz R, Hassan T.Association of cytokine gene polymorphisms with psoriasis in cases from the Nile Delta of Egypt.Acta Dermatovenerol Alp Pannonica Adriat2009;18:105–112.
33. Gallo E, Cabaleiro T, Román M, Abad-Santos F, Daudén E.Study of genetic polymorphisms in the tumor necrosis factor α promoter region in Spanish patients with psoriasis.Actas Dermosifiliogr2012;103:301–307.
34. Kim T-G, Pyo C-W, Hur S-S, Kim Y-K, Hwang H-Y, Youn J-I, Kim T-Y.Polymorphisms of tumor necrosis factor (TNF) α and β genes in Korean patients with psoriasis.Arch Dermatol Res2003;295:8–13.
35. Tsunemi Y, Nishibu A, Saeki H, Oyama N, Nakamura K, Kishimoto M, et al..Lack of association between the promoter polymorphisms at positions -308 and -238 of the tumor necrosis factor alpha gene and psoriasis vulgaris in Japanese patients.Dermatology2003;207:371–374.
36. Magalhães RF, Biral AC, Pancoto JAT, Donadi EA, Mendes-Júnior CT, Magna LA, Kraemer MH.Human leukocyte antigen (HLA) and single nucleotide polymorphisms (SNPs) tumor necrosis factor (TNF)-alpha -238 and -308 as genetic markers of susceptibility to psoriasis and severity of the disease in a long-term follow-up Brazilian study.Int J Dermatol2010;49:1133–1140.
37. Nedoszytko B, Szczerkowska-Dobosz A, Zabłotna M, Gleń J, Rebała K, Roszkiewicz J.Associations of promoter region polymorphisms in the tumour necrosis factor-α gene and early-onset psoriasis vulgaris in a northern Polish population.Br J Dermatol2007;157:165–167.
38. Arias AI, Giles B, Eiermann TH, Sterry W, Pandey JP.Tumor necrosis factor-alpha gene polymorphism in psoriasis.Exp Clin Immunogenet1997;14:118–122.
39. Li C, Wang G, Gao Y, Liu L, Gao T.TNF-α gene promoter -238G>A and -308G>A polymorphisms alter risk of psoriasis vulgaris: a meta-analysis.J Invest Dermatol2007;127:1886–1892.
Keywords:

gene polymorphism; psoriasis; tumor necrosis factor-α

© 2014 Egyptian Women's Dermatologic Society