Secondary Logo

Journal Logo

Tissue liver X-receptor-α (LXRα) level in acne vulgaris

Bosseila, Manala; Tawfic, Shereen O.a; Ezzat, Marwa A.a; Shaker, Olfat G.b

Journal of the Egyptian Women's Dermatologic Society: May 2013 - Volume 10 - Issue 2 - p 101–105
doi: 10.1097/01.EWX.0000426318.37913.00
Original articles
Free

Background Increased sebum lipogenesis by the sebaceous gland is the major factor in the pathophysiology of acne. Liver X receptor-α (LXRα) have been recognized in the regulation of genes involved in lipid biosynthesis.

Objective The aim of the study was to evaluate the role of LXRα in inflammatory versus noninflammatory acne lesions.

Patients and methods Seventeen patients with inflammatory and noninflammatory acne lesions and 16 controls were included in the study. Punch skin biopsy samples were taken from the acne lesions and from the normal skin of the volunteers for detection of gene expression of LXRα by reverse transcriptase-PCR.

Results mRNA LXRα was significantly higher in lesional skin, whether inflammatory (1188.52±129.5 μg/mg) or comedonal (892.52±66.08 μg/mg), compared with control skin (600.50±95.30 μg/mg) (P value <0.001). The level of LXRα mRNA was significantly higher in inflammatory acne than in comedonal acne (P value <0.001).

Conclusion It is suggested that LXRα may have a role in the pathogenesis of acne vulgaris itself and is not a consequence of inflammation. It may play a role in the progression of the disease from comedonal to inflammatory.

Departments of aDermatology

bMedical Biochemistry, Faculty of Medicine, Cairo University, Giza, Egypt

Correspondence to Shereen O. Tawfic, Department of Dermatology, Faculty of Medicine, Cairo University, Giza, Egypt Tel: +20 122 008 5050; e-mail: shereenosamat@yahoo.com

Received November 11, 2012

Accepted January 5, 2013

Back to Top | Article Outline

Introduction

Acne vulgaris is a disease of the pilosebaceous unit resulting from the interplay of different factors such as seborrhea, Propionibacterium acnes colonization, hyperkeratinization of the follicular duct, and release of inflammatory mediators. Increased sebum lipogenesis by the sebaceous gland is considered, among all features, the major one involved in the pathophysiology of acne 1. Considerable progress has been made in our understanding of the molecular events regulating lipogenesis in the adipose tissues and the liver. Several transcriptional factors have been identified, which act cooperatively and sequentially to trigger lipogenesis in preadipocytes; among them are peroxisome proliferator-activated receptors (PPAR) and sterol regulatory element-binding proteins (SREBP-1) 2,3. Liver X receptors (LXRs) are ligand-activated transcription factors that belong to the nuclear receptor superfamily and are highly expressed in tissues known to play important roles in lipid metabolism. LXRs were initially classified as orphan nuclear receptors because their natural ligands were unknown. The LXR subfamily consists of two isoforms, LXRα (NR1H3) and LXRβ (NR1H2), which are highly related and share ∼78% identity of their amino acid sequences in both DNA-binding and ligand-binding domains. High expression levels of LXRα are restricted to the spleen, liver, adipose tissue, intestine, kidney, and lungs, whereas LXRβ is expressed in all tissues examined. Upon ligand-induced activation, both isoforms form obligate heterodimers with the retinoid X receptor and regulate gene expression through binding to LXR response elements in the promoter regions of the target genes 4. LXRα expression has been studied in sebocyte cell lineages but no studies in international published literature have evaluated its expression in acne lesions in vivo. The aim of this study was to investigate the level of tissue expression of LXRα in different types of acne lesions in relation to the clinical settings observed in acne cases and in comparison with normal skin of controls in order to clarify the role of LXRα in the pathogenesis of acne.

Back to Top | Article Outline

Patients and methods

This study was carried out on 17 5 patients with acne vulgaris, 10 male and seven female, with their ages ranging from 15 to 30 years, who presented at the Kasr AlAini Dermatology Department’s outpatient clinic between November 2010 and May 2011. None of the patients received topical or systemic therapy within the 4 weeks before inclusion in the study. In this study, acne was graded using lesion counting and classified into four groups on the basis of the number of inflammatory eruptions on half of the face: 0–5, mild; 6–20, moderate; 21–50, severe; and more than 50, very severe 6. Sixteen healthy volunteers served as controls. They included six men and 11 women, and their ages ranged from 20 to 27 years. All participants were informed according to the Helsinki Declaration of biomedical ethics; verbal consent was obtained after proper orientation of the participants with respect to the objectives of the study. Data confidentiality and the impact of the study were respected and maintained. Every patient underwent a thorough history taking and clinical examination including assessment of disease severity (mild, moderate, or severe). Two punch skin biopsies were taken from the back of each acne patient (one from an inflammatory and another from a noninflammatory acne lesion), each measuring 1.5 mm, whereas one punch skin biopsy measuring 1.5 mm was taken from the normal skin of each individual of the control group. The skin biopsy was stored as a frozen section at −80°C for quantitative reverse transcriptase-PCR examination of LXRα mRNA.

Back to Top | Article Outline

Methods

Liver X-receptor-α gene expression by reverse transcriptase-PCR

Total RNA was extracted from the skin biopsy using a Qiagen RNA extraction kit (Qiagen, Valencia, California, USA). Two sets of primers were used for amplification of LXRα and GHPDA genes. The primer sequences were: LXRα sense 5′-CGGGCTTCCACTACAATGTT-3′, LXRα antisense 5′-TCAGGCGGATCTGTTCTTCT-3′, and GHPDA sense 5′-ATGGGGAAGGTGAAGGTCGG-3′, GHPDA antisense 5′TGGTGAAGACGCCAGTGGAC3′. Reverse transcription was performed using 0.5 μg of total pure RNA, 100 ng of antisense-specific primer, 100 U of M-MLV reverse transcriptase (Promega Corporation, Madison, Wisconsin, USA), 20 U of RNasin (Promega), and 800 μmol/l of PCR Nucleotide Mix (Promega) as described by the manufacturers. The cDNA was amplified by PCR using the specific sense and antisense, GoTaq Green Master Mix 2× (Promega), and 5 μl reverse transcriptase product, in a final volume of 50 μl. Amplifications were performed in a thermal cycler under the following conditions: 30 cycles at 93°C for 30 s, at 58°C for 45 s, and at 72°C for 1 min for LXRα. GAPDH was expressed in the extracted RNA as the housekeeping gene with 25 cycles at 93°C for 30 s, at 56°C for 45 s, and at 72°C for 1 min. All the PCR products were electrophoresed on a 2% agarose gel stained with ethidium bromide and visualized by a ultraviolet transilluminator. Gene expression of LXR produced sharp bands at 213 bp and the GAPDA at 300 bp.

The PCR products were then quantitated using a quantitation kit (Promega Corporation). This method depends on purification of the PCR using a Promega Wizard PCR preps DNA purification kit (Promega Corporation). The mixture for quantitation consisted of DNA quantitation buffer, sodium pyrophosphate, NDPK enzyme solution, T4 DNA polymerase, and DNA. All these contents were incubated at 37°C for 10 min. Thereafter, 100 μl of Enliten L/L reagent was added. The reaction was immediately read using a luminometer. The same steps were carried out on DNAs of known concentrations provided by the kit, and a standard curve was plotted from the readings of the luminometer against the concentrations. Thereafter, the readings of the amplified PCR product of interleukin-12 and interferon-γ after using the luminometer were read from the standard curve. The results were expressed as μg/mg tissue 7.

Back to Top | Article Outline

Statistical analysis

The IBM statistical package for social sciences (SPSS) (V.19.0; IBM Corp., New York, New York, USA, 2010) was used for data analysis. Data were expressed as mean±SD for quantitative parametric measures in addition to median percentiles for quantitative nonparametric measures and both number and percentage for categorized data. The following tests were carried out: comparison of quantitative variables between the study groups using the Mann–Whitney U-test, the association between two variables or comparison between two independent groups as regards the categorized data using the χ2 test, and the Kruskal–Wallis test, which was used for comparison between three or more groups. Correlation between the different study variables was determined using the Spearman rank correlation test, and the correlation coefficiency was expressed as r. The P value was considered significant if less than 0.05.

Back to Top | Article Outline

Results

The study included 17 patients with acne vulgaris. Their clinical and demographic data are summarized in Table 1. Sixteen healthy volunteers served as the control group; their ages ranged from 20 to 27 years with a mean of 23.56±2.12 and included 11 women (68.8%) and five men (31.2%).

Table 1

Table 1

The level of LXRα mRNA was significantly higher in both types of acne, in inflammatory acne (mean±SD of 1188.52±129.57 μg/mg tissue) and in comedonal acne (mean±SD of 892.52±66.08 μg/mg tissue), in a statistically significant manner compared with the control population with a mean±SD of 600.50±95.30 μg/mg tissue (Table 2, Fig. 1). The level of tissue expression of LXRα mRNA was found to be significantly higher in inflammatory lesions in comparison with comedonal lesions (P<0.001).

Table 2

Table 2

Figure 1

Figure 1

An increase in tissue levels of LXRα mRNA was detected with the increase in disease severity: in mild acne the mean±SD was 990.37±160.67 μg/mg tissue, in moderate acne it was 1036±184.45 μg/mg tissue, and in severe acne it was 1122.33±197.7 μg/mg tissue. However, this elevation proved to be statistically insignificant (P value 0.378). In addition, the level of LXRα mRNA was insignificantly related to the course of the disease (P value 0.979), where the mean in the stationary course was 1067.25±260 μg/mg tissue, in the progressive course was 1038.45±179.8 μg/mg tissue, and in the cyclic course was 1031±163.19 μg/mg tissue. There was no correlation between the level of LXRα and age of the patients (r=−0.213, P=0.138).

Back to Top | Article Outline

Discussion

Excessive sebum production from the sebaceous glands is one of the major causes of acne 8,9. Sebaceous lipogenesis resulting in accumulation of lipid droplets and subsequent sebum secretion represents a major step in the terminal differentiation of sebocytes 10. It was indicated that sebocytes, as major components of the pilosebaceous unit, may act as immune cells and may be activated by P. acnes, which recognizes altered lipid content in the sebum, followed by the production of inflammatory cytokines 11.

Strong expression of LXRα is present in the sebaceous glands, which play a critical role in sebaceous lipid production 12, as it was expressed in the skin and has been widely recognized in the regulation of genes involved in innate immunity, inflammation, and lipid biosynthesis 13. LXRα expression has been studied in sebocyte cell lineages but not in acne lesions in vivo, which was evaluated in the present study.

The current study showed that the mean level of LXRα was statistically significantly higher in lesional acne skin than in the control population. This supports the fact that increased LXR expression may have a role in acne pathogenesis. It is proposed to be through its action on inducing lipogenesis, as activation of LXRα inhibits proliferation, increases lipogenesis, and improves differentiation of sebocytes 14.

Our results agree with the findings of Russell et al.12 who demonstrated increased lipogenesis in sebocytes by synthetic stimulation of LXR; sebocytes increased significantly by 1.5-fold following incubation for 2 days with synthetic LXR agonists and increased by five-fold following incubation for 5 days when compared with untreated control cells. Furthermore, it was indicated that both LXR isotypes are expressed in the sebocytes and that LXRα stimulates lipogenesis and inhibits the proliferation of sebocytes 12.

PPAR and LXR are related to the same subfamily of nuclear receptors, and strong expression of PPARα, PPARβ/δ, PPARγ1, LXRα, and LXRβ is present in sebaceous glands 12,15. LXR ligands activate the expression of all three subtypes of PPARs and downstream target genes, indicating that PPARs may mediate the lipogenic function of LXRα in sebocytes, at least in part. It has been reported that activation of LXR involves the induction of PPARγ and downstream adipogenic gene expression in adipose tissue 16.

Our results support the findings of Elmongy and Shaker 5, who demonstrated that sebum production is the key factor in the pathophysiology of acne, and lipid mediators are able to interfere with sebocyte differentiation and sebogenesis through the activation of pathways related to PPAR. Their results showed a highly statistically significant increase in PPAR β/δ expression in acne patients compared with controls, and this expression was also significantly increased in lesional skin compared with nonlesional skin in patients; the results also showed that the increased PPAR β/δ expression could have a role in the pathogenesis of acne vulgaris through an increase in lipogenesis.

In addition to their key role in cholesterol homeostasis, LXRs have emerged as important regulators of inflammatory gene expression and innate immunity. It was shown that activation of LXR blunts the induction of classical inflammatory genes such as iNOS and COX-2 in the sebocytes 14. The expression of COX-2 and iNOS is largely stimulated by nuclear factor κB in response to a variety of inflammatory signals, suggesting that LXRα may antagonize the activation of nuclear factor κB in sebocytes 17,18. COX-2 is normally expressed in the sebocytes, and COX-2 expression is upregulated in the sebaceous glands of acne-involved skin 19,20.

It was demonstrated that LXR activators have potent anti-inflammatory activity in both the irritant and allergic contact models of cutaneous inflammation by inhibition of cytokine production upon topical treatment with LXR endogenous and synthetic agonists 21. In this study, the level of LXRα proved to be higher in inflammatory acne than in comedonal acne in a statistically significant manner. This indicates that LXRα may play a role in the progression of disease from comedonal to inflammatory, as most inflammatory acne lesions (54%) arise from comedones and 28% of lesions from normal skin 22. This is possibly through excess induction of sebaceous lipogenesis, or because LXRα alone fails to suppress inflammation. LXR activators did not reduce inflammation in LXRβ-deficient or LXRα/β-deficient mice, indicating that LXRβ was required for this anti-inflammatory effect 21. Further studies with analysis of purified primary lymphoid cultures established that activation of LXRβ by physiological or pharmacological ligands diminishes the proliferative capacity of B and T cells 23.

However, it is suggested that in sebaceous glands in-vivo LXRα alone fails to suppress inflammation. LXRβ levels were not measured in this study. It could be speculated that an unchanged or even reduced level might aid in the progression of disease from the noninflammatory phase to the inflammatory phase. Further studies on LXRβ in acne should be conducted to clarify this aspect.

In contrast, PPARs may mediate the lipogenic function of LXRα in sebocytes, at least in part 14. It was recently proven that inflammatory acne did not show a significant increase in PPAR β/δ expression compared with noninflammatory acne, although its level was significantly elevated in lesional versus nonlesional acne skin. Therefore, the increased PPAR β/δ was not simply because of inflammation and it is directly related to the pathogenesis of acne vulgaris itself 5.

Therefore, we assume that the effects of LXR on induction of acne vulgaris are not due to transrepression of inflammatory signaling pathways; rather, they are related to the control of cellular cholesterol metabolism inducing excess lipogenesis, which promotes the progression of the disease state into the papulopustular phase. It is established that LXRs regulate gene expression linked to cholesterol metabolism in a tissue-specific manner, according to whether it is in the liver, intestine, or in macrophages 24.

In addition, our results showed that the level of LXRα was significantly higher in comedonal (noninflammatory) acne in a statistically significant manner than in control biopsy samples. This result established that the increased LXRα expression is directly related to the pathogenesis of acne vulgaris itself and is not a consequence of inflammation. Hong et al.25, examined whether LXRα and its ligands regulate lipid synthesis in HaCaT cells (a transformed human keratinocyte cell lineage) depending on previous studies that demonstrated that ligands of LXRα are important in the maintenance of the normal epidermal barrier function and keratinocyte differentiation. When HaCaT cells were treated with the LXRα ligand TO901317, lipid droplets accumulated in the majority of cells, leading to lipogenesis in keratinocytes, which may enhance the epidermal barrier function of the skin. This further indicates that LXR has a role in lipid synthesis in these cells.

In our study, the level of LXRα was insignificantly correlated to disease severity, whether mild, moderate, or severe; hence, it cannot be used as a clinical marker for the disease, nor its level as a predictor for disease severity. Further, there was insignificant inverse correlation between the level of LXRα and the age of the patients. The course of the acne, whether stationary, progressive, or remitting and exacerbating (cyclic), was also insignificantly related to the level of LXRα.

Back to Top | Article Outline

Conclusion and recommendations

Excess sebum levels and inflammation, which have been implicated in initiating acne lesions, are associated with the function of LXR. LXRα could be one of the therapeutic targets for the treatment of acne, as its main role in acne pathogenesis is in increase of sebaceous lipogenesis and induction of comedogenesis, in addition to its proposed role in the progression from comedonal to inflammatory acne. Further studies are needed on the role of LXRβ in inflammatory versus noninflammatory acne lesions in vivo.

Back to Top | Article Outline

Acknowledgements

Conflicts of interest

There are no conflicts of interest.

Back to Top | Article Outline

References

1. Picardo M, Ottaviani M, Camera E, Mastrofrancesco A. Sebaceous gland lipids. Dermatoendocrinol. 2009;1:68–71
2. Wu Z, Puigserver P, Spiegelman BM. Transcriptional activation of adipogenesis. Curr Opin Cell Biol. 1999;11:689–694
3. Rosen ED, Walkey CJ, Puigserver P, Spiegelman BM. Transcriptional regulation of adipogenesis. Genes Dev. 2000;14:1293–1307
4. Baranowski M. Biological role of liver X receptors. J Physiol Pharmacol. 2008;59(Suppl 7):31–55
5. Elmongy NN, Shaker O. Expression of peroxisome proliferator activator receptor β/δ (5/8 (PPARβ/δ) in acne vulgaris. Eur J Dermatol. 2012;22:42–45
6. Hayashi N/, Akamatsu H, Kawashima M, Ito M, Otsuki M, Kawashima M, et al. Establishment of grading criteria for acne severity. J Dermatol. 2008;35:255–260
7. Shaker OG, Moustafa W, Essmat S, Abdel-Halim M, El-Komy M. The role of interleukin-12 in the pathogenesis of psoriasis. Clin Biochem. 2006;39:119–125
8. Brown SK, Shalita AR. Acne vulgaris. Lancet. 1998;351:1871–1876
9. Zouboulis CC. Acne and sebaceous gland function. Clin Dermatol. 2004;22:360–366
10. Downie MMT, Kealey T. Lipogenesis in the human sebaceous gland: glycogen and glycerophosphate are substrates for the synthesis of sebum lipids. J Invest Dermatol. 1998;111:199–205
11. Knor T. The pathogenesis of acne. Acta Dermatovenerol Croat. 2005;13:44–49
12. Russell LE, Harrison WJ, Bahta AW, Zouboulis CC, Burrin JM, Philpott MP. Characterization of liver X receptor expression and function in human skin and the pilosebaceous unit. Exp Dermatol. 2007;16:844–852
13. Gupta DS, Kaul D, Kanwar AJ, Parsad D. Psoriasis: crucial role of LXR-α RNomics. Genes Immun. 2010;11:37–44
14. Hong I, Lee MH, Na TY, Zouboulis CC, Lee MO. LXRα enhances lipid synthesis in SZ95 sebocytes. J Invest Dermatol. 2008;128:1266–1272
15. Schmuth M, Jiang YJ, Dubrac S, Elias PM, Feingold KR. Peroxisome proliferator-activated receptors and liver X receptors in epidermal biology. J Lipid Res. 2008;49:499–509
16. Seo JB, Moon HM, Kim WS, Lee YS, Jeong HW, Yoo EJ, et al. Activated liver X receptors stimulate adipocyte differentiation through induction of peroxisome proliferator-activated receptor γ expression. Mol Cellular Biol. 2004;24:3430–3444
17. Hayden MS, Ghosh S. Signaling to NF-κB. Genes Dev. 2004;18:2195–2224
18. Zelcer N, Tontonoz P. Liver X receptors as integrators of metabolic and inflammatory signaling. J Clin Invest. 2006;116:607–614
19. Alestas T, Ganceviciene R, Fimmel S, Müller-Decker K, Zouboulis CC. Enzymes involved in the biosynthesis of leukotriene B 4 and prostaglandin E 2 are active in sebaceous glands. J Mol Med. 2006;84:75–87
20. Zhang Q, Seltmann H, Zouboulis CC, Konger RL. Involvement of PPARγ in oxidative stress-mediated prostaglandin E2 production in SZ95 human sebaceous gland cells. J Invest Dermatol. 2006;126:42–48
21. Fowler AJ, Sheu MY, Schmuth M, Kao J, Fluhr JW, Rhein L, et al. Liver X receptor activators display anti-inflammatory activity in irritant and allergic contact dermatitis models: liver-X-receptor-specific inhibition of inflammation and primary cytokine production. J Invest Dermatol. 2003;120:246–255
22. Do TT, Zarkhin S, Orringer JS, Nemeth S, Hamilton T, Sachs D, et al. Computer-assisted alignment and tracking of acne lesions indicate that most inflammatory lesions arise from comedones and de novo. J Am Acad Dermatol. 2008;58:603–608
23. Bensinger SJ, Bradley MN, Joseph SB, Zelcer N, Janssen EM, Hausner MA, et al. LXR signaling couples sterol metabolism to proliferation in the acquired immune response. Cell. 2008;134:97–111
24. Hong C, Tontonoz P. Coordination of inflammation and metabolism by PPAR and LXR nuclear receptors. Curr Opin Genet Dev. 2008;18:461–467
25. Hong I, Rho HS, Kim DH, Lee MO. Activation of LXRα induces lipogenesis in HaCaT cells. Arch Pharm Res. 2010;33:1443–1449
Keywords:

acne vulgaris; liver X receptors (LXRα); reverse transcriptase-PCR

© 2013 Egyptian Women's Dermatologic Society