The clinicopathological and genetic differences among gastric cancer patients with no recurrence, early recurrence, and late recurrence after curative surgery : Journal of the Chinese Medical Association

Secondary Logo

Journal Logo

Advanced Search
Original Articles

The clinicopathological and genetic differences among gastric cancer patients with no recurrence, early recurrence, and late recurrence after curative surgery

Chen, Meng-Chaoa,b; Su, Hsuan-Yuc,d; Su, Yen-Haoe,f,g,h; Huang, Kuo-Hungc,d,i,*; Fang, Wen-Liangc,d,i; Lin, Chii-Wanna; Chen, Ming-Huangd,j; Chao, Yeed,j; Lo, Su-Shund,k; Fen-Yau Li, Annad,l; Wu, Chew-Wunc,d

Author Information

aDepartment of Biomedical Engineering, National Taiwan University, Taipei, Taiwan, ROC

bDepartment of Neurosurgery, China Medical University Hospital, Taipei Branch, Taipei, Taiwan, ROC

cDivision of General Surgery, Department of Surgery, Taipei Veterans General Hospital, Taipei, Taiwan, ROC

dSchool of Medicine, National Yang Ming Chiao Tung University, Taipei, Taiwan, ROC

eDepartment of Surgery, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan, ROC

fDivision of General Surgery, Department of Surgery, Shuang Ho Hospital, Taipei Medical University, New Taipei City, Taiwan, ROC

gDivision of General Surgery, Department of Surgery, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan, ROC

hTMU Research Center of Cancer Translational Medicine, Taipei Medical University, Taipei, Taiwan, ROC

iGastric Cancer Medical Center, Department of Surgery, Taipei Veterans General Hospital, Taipei, Taiwan, ROC

jCenter of Immuno-Oncology, Department of Oncology, Taipei Veterans General Hospital, Taipei, Taiwan, ROC

kDepartment of Surgery, National Yang Ming Chiao Tung University Hospital, Yilan, Taiwan, ROC

lDepartment of Pathology, Taipei Veterans General Hospital, Taipei, Taiwan, ROC

Author Contributions: Dr. Meng-Chao Chen and Dr. Hsuan-Yu Su contributed equally to this article.

Conflicts of interest: Dr. Yee Chao, an editorial board member at Journal of the Chinese Medical Association, had no role in the peer review process of or decision to publish this article. The other authors declare that they have no conflicts of interest related to the subject matter or materials discussed in this article.

Received March 27, 2022; accepted September 23, 2022.

* Address correspondence. Dr. Kuo-Hung Huang, Division of General Surgery, Department of Surgery, Taipei Veterans General Hospital, 201, Section 2, Shi-Pai Road, Taipei 112, Taiwan, ROC. E-mail address: [email protected] (K.-H. Huang).

This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/)

Journal of the Chinese Medical Association 86(1):p 57-64, January 2023. | DOI: 10.1097/JCMA.0000000000000846
  • Open

Abstract

1. INTRODUCTION

Gastric cancer (GC) is the sixth most common cancer and is associated with the third most common cancer-related deaths worldwide.1 Radical gastrectomy with lymphadenectomy remains the mainstay of curative intent for GC.

Despite curative surgery, a proportion of patients experienced tumor recurrence and most of them died of GC. The majority of tumor recurrence of GC following curative surgery are within 2 years. Consequently, 2 years has been defined as the cutoff value for early and late recurrence.2,3 In these studies, patients with early recurrence tended to have a more advanced stage and worse survival than those with late recurrence. It was reported that the most common recurrence pattern was hematogenous metastasis in the early recurrence group, whereas locoregional and peritoneal recurrence was the most common recurrence pattern in the late recurrence group.4

Although the clinical features between early and late recurrence have been reported by other studies,5,6 there are few studies comparing the difference in genetic alterations between early and late recurrence. The loss expression of some tumor suppressor genes was associated with GC recurrence, such as ARID1A, XRCC1, and JWA.7,8 To date, it is unclear whether genetic mutations are associated with early recurrence in GC, which deserves more investigation.

The aim of the current study was to compare the clinicopathological characteristics, patient prognosis, and genetic alterations between no tumor recurrence, early recurrence, and late recurrence of GC patients after curative surgery.

2. METHODS

Between 2005 and 2015, a total of 473 GC patients with adenocarcinoma who underwent curative surgery were enrolled. Collection of the tumor and normal gastric mucosa tissues and analysis of the genetic alteration for all 473 GC patients were performed. Among them, 119 patients with tumor recurrence within 2 years after surgery were defined as having an early recurrence, whereas 45 patients with tumor recurrence ≥2 years after surgery were defined as having a late recurrence. The study was approved by the Institutional Review Board of Taipei Veterans General Hospital (No. 2022-01-015AC), and all samples used in the present study were anonymized and had been previously collected from the biobank of Taipei Veterans General Hospital. An informed consent form was signed by all patients enrolled before sample collection.

For early GC, at least D1+ lymph node dissection was performed, whereas D2 dissection was performed for advanced GC.9 As described in a previous study,10 follow-up examinations were performed postoperatively every 3 months during the first 3 years and then every 6 months thereafter. The definition of single-site recurrence was tumor recurrence in one organ, whereas multiple-site recurrence was defined as tumor recurrence in more than one organ. For example, patients with multiple liver metastases only were considered as single-site recurrence. Patients diagnosed with tumor recurrence could receive 5-fluorouracil (FU)-based chemotherapy. Before surgery, none of the patients in the present study received chemotherapy. Since 2008, S-1 has been used as adjuvant chemotherapy for stage II or III disease after curative surgery at our institute based on its proven survival benefit.11

2.1. Analysis of microsatellite instability and genetic mutations

Five reference microsatellite markers, D5S345, D2S123, D17S250, BAT25, and BAT26, were used to determine microsatellite instability (MSI) status.12 MSI-high (MSI-H) was defined as ≥2 loci showing instability, whereas one locus showing instability or no MSI loci was defined as MSI-low/stable (MSI-L/S).12

Identification of 68 mutation hotspots in eight GC-related genes using a MassARRAY system (Agena, San Diego, CA, USA) was performed, including PIK3CA, AKT1, AKT2, AKT3, PTEN, ARID1A, TP53, and B-Raf proto-oncogene.13 Mutations in PTEN, PIK3CA, AKT1, AKT2, or AKT3 were defined as PI3K/AKT pathway genetic mutations.

2.2. Detection of HP and Epstein-Barr virus infection

Helicobacter pylori (HP) infection was detected using the polymerase chain reaction (PCR) method.14 The reference sequence of the HP reference genome (GenBank: AE000511.1) was used to design PCR forward (AAGCTTACTTTCTAACACTAACGC) and reverse (AAGCTTTTAGGGGTGTTAGGGGTTT) primers. The PCR method was the same as in a previous report.14 Both tumor tissue and normal tissues were checked for HP infection. The PCR results were shown in Fig. 1. Epstein-Barr virus (EBV) infection was detected as EBV-encoded small RNAs (EBERs) in formalin-fixed paraffin-embedded tissue samples using the in situ hybridization technique.15 Positive EBER immunohistochemical staining result using the in situ hybridization technique is shown in Fig. 2.

F1
Fig. 1:
Agarose gel electrophoresis of the PCR product. 100 bp DNA ladder was used. Lane 1: size marker (100 bp); lane 2: Helicobacter pylori (positive control); lane 3: ddH2O (negative control); lane 4, 6, 8, 10, 12, 14, and 16: the normal stomach tissue DNA of patient No. 1 to No.7; lane 5, 7, 9, 11, 13, 15, and 17: tumor tissue DNA of patient No.1 to No.7. PCR=polymerase chain reaction.
F2
Fig. 2:
Positive EBV-encoded small RNA in situ hybridization (EBER ISH) result is stained with brown color and pointed with green arrows. EBER=EBV-encoded small RNAs; EBV=Epstein-Barr virus.

2.3. Statistical analysis

Statistical analyses were performed using IBM SPSS Statistics 25.0 (IBM Corp., Armonk, NY, USA). The χ2 test with Yates correction or Fisher’s exact test was used to compare categorical data between groups. The data of the follow-up period and survival time was presented as mean ± SD. Overall survival (OS) was defined from the surgery date until the patient's death or the last follow-up. Postrecurrence survival was defined from the date of GC recurrence to the date of death or the last follow-up. The Kaplan–Meier method was performed for the survival analysis of OS and postrecurrence survival. Multivariable analysis with a Cox proportional hazards model was used to analyze the independent prognostic factors of OS. A p value less than 0.05 was defined as statistically significant.

3. RESULTS

3.1. Clinicopathological features

Among the 473 GC patients who underwent curative surgery, 164 (34.7%) experienced tumor recurrence, including 119 with early recurrence and 45 with late recurrence. Regarding the clinicopathological characteristics, as shown in Table 1, patients with early recurrence had larger tumor sizes, fewer superficial-type tumors, more lymphovascular invasion, and earlier pathological T and N categories and TNM stages than patients with no recurrence and patients with late recurrence.

Table 1 - Clinical profiles between early and late recurrence in gastric cancer patients after curative surgery
No recurrence n = 309 n (%) Early recurrence n = 119 n (%) Late recurrence n = 45 n (%) p
Age (years old) 0.216
 <65 123 (39.8) 43 (36.1) 23 (51.1)
 ≥65 186 (60.2) 76 (63.9) 22 (48.9)
Sex 0.632
 Male 214 (69.3) 88 (73.9) 32 (71.1)
 Female 95 (30.7) 31 (26.1) 13 (28.9)
Tumor size (cm) <0.001
 <5 135 (43.7) 22 (18.5) 17 (37.8)
 ≥5 174 (56.3) 97 (81.5) 28 (62.2)
Tumor location 0.775
 Upper third 52 (16.8) 27 (22.7) 7 (15.6)
 Middle third 112 (36.2) 27 (22.7) 15 (33.3)
 Lower third 136 (44.0) 61 (51.3) 23 (51.1)
 Whole stomach 9 (2.9) 4 (3.4) 0
Extent of lymphadenectomy 0.190
 D1+ 85 (27.5) 26 (21.8) 16 (35.6)
 D2 224 (72.5) 93 (78.2) 29 (64.4)
Gross appearance <0.001
 Superficial type 56 (18.1) 2 (1.7) 5 (11.1)
 Borrmann type 1&2 105 (34.0) 21 (17.6) 6 (13.3)
 Borrmann type 3&4 148 (47.9) 96 (80.7) 33 (75.6)
Lauren’s classification 0.783
 Intestinal-type 166 (53.7) 61 (51.3) 22 (48.9)
 Diffuse-type 143 (46.3) 58 (48.7) 23 (51.1)
Adjuvant chemotherapy 42 (13.6) 16 (13.4) 6 (13.3) 0.998
Lymphovascular invasion 201 (65.0) 110 (92.4) 32 (71.1) <0.001
Pathological T category <0.001
 T1 58 (18.8) 2 (1.7) 6 (13.3)
 T2 62 (20.1) 8 (6.7) 2 (4.4)
 T3 104 (33.7) 42 (35.3) 14 (31.1)
 T4 85 (27.5) 67 (56.3) 23 (51.1)
Pathological N category <0.001
 N0 112 (36.2) 13 (10.9) 12 (26.7)
 N1 59 (19.1) 13 (10.9) 7 (15.6)
 N2 68 (22.0) 32 (26.9) 18 (40.0)
 N3 70 (22.7) 61 (51.3) 8 (17.8)
Pathological TNM stage <0.001
 I 81 (26.2) 2 (1.7) 5 (11.1)
 II 92 (29.8) 23 (19.3) 10 (22.2)
 III 136 (44.0) 94 (79.0) 30 (66.7)
Bold values indicate statistically significant (p <0.05)

3.2. Initial recurrence patterns

As demonstrated in Table 2, among the 164 patients with tumor recurrence, patients with early recurrence had more distant metastases than patients with late recurrence. For intestinal-type GC, there was no significant difference in the initial recurrence pattern between patients with early recurrence and late recurrence. For diffuse-type GC, patients with early recurrence had more distant metastases than patients with late recurrence.

Table 2 - The initial recurrence pattern between early and late recurrence of gastric cancer patients after curative surgery
All gastric cancer Intestinal-type gastric cancer Diffuse-type gastric cancer
Recurrence pattern Early recurrencen=119n (%) Late recurrencen=45n (%) p Early recurrencen=61n (%) Late recurrencen=22n (%) p Early recurrencen=58n (%) Late recurrencen=23n (%) p
Locoregional recurrence 48 (40.3) 16 (35.6) 0.575 25 (41.0) 6 (27.3) 0.254 23 (39.7) 10 (43.5) 0.752
Distant metastasis 107 (89.9) 34 (75.6) 0.018 55 (90.2) 19 (86.4) 0.623 52 (89.7) 15 (65.2) 0.009
 Peritoneal dissemination 54 (45.4) 16 (35.6) 0.256 24 (39.3) 7 (31.8) 0.532 30 (51.7) 9 (39.1) 0.306
 Hematogenous metastasis 48 (40.3) 15 (33.3) 0.411 29 (47.5) 10 (45.5) 0.867 19 (32.8) 5 (21.7) 0.327
  Liver 35 (29.4) 8 (17.8) 23 (37.7) 6 (27.3) 12 (20.7) 2 (8.7)
  Lung 8 (6.7) 3 (6.7) 5 (8.2) 2 (9.1) 3 (5.2) 1 (4.3)
  Bone 7 (5.9) 5 (11.1) 4 (6.6) 2 (9.1) 3 (5.2) 3 (13.0)
  Brain 1 (0.8) 0 0 0 1 (1.7) 0
  Adrenal 2 (1.7) 1 (2.2) 0 1 (4.5) 2 (3.4) 0
  Skin 2 (1.7) 1 (2.2) 1 (1.6) 1 (4.5) 1 (1.7) 0
Distant lymphatic recurrence 32 (26.9) 6 (13.3) 0.066 17 (27.9) 2 (9.1) 0.072 15 (25.9) 4 (17.4) 0.417
 Virchow’s lymph node 7 (5.9) 1 (2.2) 5 (8.2) 1 (4.5) 2 (3.4) 0
 Inguinal lymph node 1 (0.8) 0 1 (1.6) 0 0 0
 Paraaortic lymph node 26 (21.8) 6 (13.3) 13 (21.3) 2 (9.1) 13 (22.4) 4 (17.4)
Some patients had more than one recurrence pattern
Bold values indicate statistically significant (p <0.05)

3.3. Analysis of genetic mutations

As shown in Table 3, there was no significant difference in genetic mutations among patients with no recurrence, early recurrence, and late recurrence. For intestinal-type GC, patients with no recurrence had more HP infection than patients with early recurrence and late recurrence. For diffuse-type GC, the frequency of PIK3CA amplification was the highest in patients with early recurrence, followed by late recurrence and no recurrence (62.1% vs. 56.5% vs. 43.4%; p = 0.043). As shown in Table 4, regarding the number of tumor recurrence sites, patients with single-site recurrence had more ARID1A mutations than patients with multiple-site recurrence (21.7% vs. 7.4%; p = 0.008).

Table 3 - The molecular features in gastric cancer patients after curative surgery
All GC patients Intestinal-type gastric cancer Diffuse-type gastric cancer
Variables No recurrence n = 309 n (%) Early recurrence n = 119 n (%) Late recurrence n = 45 n (%) p No recurrence n = 166 n (%) Early recurrence n = 61 n (%) Late recurrence n = 22 n (%) p No recurrence n = 143 n (%) Early recurrence n = 58 n (%) Late recurrence n = 23 n (%) p
MSI status 0.436 0.349 0.107
 MSI-L/S 281 (90.9) 106 (89.1) 43 (95.6) 11 (6.6) 10 (16.4) 1 (4.5) 126 (88.1) 55 (94.8) 22 (95.7)
 MSI-H 28 (9.1) 13 (10.9) 2 (4.4) 4 (7.7) 3 (11.1) 0 17 (11.9) 3 (5.2) 1 (4.3)
HP infection 123 (39.8) 38 (31.9) 14 (31.1) 0.220 65 (39.2) 13 (21.3) 6 (27.3) 0.032 58 (40.6) 25 (43.1) 8 (34.8) 0.789
EBV infection 41 (13.3) 19 (16.0) 8 (17.8) 0.614 18 (10.8) 13 (21.3) 4 (18.2) 0.080 23 (16.1) 6 (10.3) 4 (17.4) 0.712
PIK3CA amplification 127 (41.0) 61 (51.7) 20 (44.4) 0.136 64 (38.6) 26 (42.6) 7 (31.8) 0.661 62 (43.4) 36 (62.1) 13 (56.5) 0.043
Genetic mutations
  PI3K/AKT pathway 45 (14.6) 25 (21.0) 5 (11.1) 0.173 30 (18.1) 20 (32.8) 4 (18.2) 0.216 15 (10.5) 5 (8.6) 1 (4.3) 0.351
  TP53 39 (12.6) 18 (15.1) 5 (11.1) 0.724 23 (13.9) 9 (14.8) 2 (9.1) 0.704 16 (11.2) 9 (15.5) 3 (13.0) 0.550
  ARID1A 33 (10.7) 16 (13.4) 6 (13.3) 0.677 18 (10.8) 13 (21.3) 4 (18.2) 0.080 15 (10.5) 3 (5.2) 2 (8.7) 0.428
 BRAF 2 (0.6) 0 0 0.587 2 (1.2) 0 0 0.357 0 0 0 -
Bold values indicate statistically significant (p <0.05) and place it before abbreviation list.
BRAF=B-Raf proto-oncogene; EBV=Epstein-Barr virus; HP=Helicobacter pylori; MSI=microsatellite instability; MSI-H=MSI-high; MSI-L/S=MSI-low/stable.

Table 4 - The molecular features in gastric cancer patients after curative surgery
Gastric cancer patients with recurrence
Variables Single-site recurrence n = 69 n (%) Multiple-site recurrence n = 95 n (%) p
MSI status 0.705
 MSI-L/S 62 (89.9) 87 (91.6)
 MSI-H 7 (10.1) 8 (8.4)
HP infection 18 (26.1) 34 (35.8) 0.187
EBV infection 14 (20.3) 13 (13.7) 0.260
PIK3CA amplification 34 (49.3) 48 (50.5) 0.874
Genetic mutations
  PI3K/AKT pathway 16 (23.2) 14 (14.7) 0.167
  TP53 8 (11.6) 15 (15.8) 0.445
  ARID1A 15 (21.7) 7 (7.4) 0.008
 BRAF 0 0 -
Bold values indicate statistically significant (p <0.05) and place it before abbreviation list.
BRAF=B-Raf proto-oncogene; EBV=Epstein-Barr virus; HP=Helicobacter pylori; MSI=microsatellite instability; MSI-H=MSI-high; MSI-L/S=MSI-low/stable.

3.4. Survival analysis

The follow-up period of all the patients included in the study was 79.8 ± 78.5 months. The time to recurrence after curative surgery was 11.1 ± 5.6 months in patients with early recurrence and 48.6 ± 32.1 months in patients with late recurrence. The OS for patients with early recurrence was significantly shorter than that for patients with late recurrence and patients with no recurrence (25.4 ± 30.1 vs. 66.5 ± 47.0 vs. 102.8 ± 84.2 months; p < 0.001)

We further analyzed the survival rates for patients with tumor recurrence. As shown in Fig. 3A, patients with early recurrence had significantly worse 5-year OS rates than patients with late recurrence and patients without recurrence (4.2% vs. 42.2% vs. 70.0%; p < 0.001). Patients with single-site recurrence had a better 5-year OS rate than patients with multiple-site recurrence (24.6% vs. 7.4%; p < 0.001). For patients with single-site recurrence, the 5-year OS rates were significantly lower in patients with early recurrence than in those with late recurrence (7.1% vs. 51.9%; p < 0.001, Fig. 3B). For patients with multiple-site recurrence, the 5-year OS rates were significantly lower in patients with early recurrence than in those with late recurrence (2.6% vs. 27.8%; p < 0.001, Fig. 3C).

F3
Fig. 3:
5-year OS rates were significantly lower in gastric cancer patients with early recurrence than in those with late recurrence and those without recurrence (4.2% vs. 42.2% vs. 70.0%; p < 0.001). For gastric cancer with single-site recurrence, 5-year OS rates were significantly lower in patients with early recurrence than in those with late recurrence (7.1% vs. 51.9%; p < 0.001). For gastric cancer with multiple-site recurrence, 5-year OS rates were significantly lower in patients with early recurrence than in those with late recurrence (2.6% vs. 27.8%; p < 0.001). The survival curves shown are as follows: (A) all gastric cancer patients, (B) single-site recurrence gastric cancer patients, and (C) multiple-site recurrence gastric cancer patients. OS=overall survival.

For intestinal-type GC, the 5-year OS rates were significantly lower in patients with early recurrence than in those with late recurrence (6.6% vs. 36.4%; p < 0.001). For diffuse-type GC, the 5-year OS rates were significantly lower in patients with early recurrence than in those with late recurrence (1.7% vs. 47.8%; p < 0.001).

The 5-year postrecurrence survival rates were not significantly different between GC patients with early recurrence and those with late recurrence (4.2% vs. 6.1%; p = 0.076). For patients with single-site recurrence, the 5-year postrecurrence survival rates were not significantly different between patients with early recurrence and those with late recurrence (7.1% vs. 8.1%; p = 0.548). For patients with multiple-site recurrence, the 3-year postrecurrence survival rates were not significantly different between patients with early recurrence and those with late recurrence (2.6% vs. 7.4%; p = 0.460).

Univariate analysis demonstrated that age, sex, tumor recurrence, gross appearance, lymphovascular invasion, and pathological T and N categories were significantly associated with OS. The above-mentioned seven factors were included in the multivariable analysis. The Cox proportional hazards model demonstrated that age, tumor recurrence, and pathological N categories were independent prognostic factors of OS (Table 5).

Table 5 - Univariate and multivariate analysis of factors affecting overall survival of all GC patients after curative surgery
Variables Univariate analysis Multivariate analysis
Hazard ratio Confidence interval p Hazard ratio Confidence interval p
Age (years old) <0.001 <0.001
 <65 1.000 1.000
 ≥65 1.682 1.323–2.140 1.790 1.383–2.317
Sex 0.001 0.545
 Male 1.000 1.000
 Female 0.634 0.487–0.826 0.916 0.689–1.217
Tumor recurrence <0.001 <0.001
 No recurrence 1.000 1.000
 Early recurrence 6.798 5.183–8.915 4.141 3.087–5.556
 Late recurrence 2.248 1.576–3.207 1.913 1.318–2.777
Extent of lymphadenectomy 0.131
 D1+ 1.000
 D2 0.829 0.652–1.058
Gross appearance <0.001 0.143
 Superficial type 1.000 1.000
 Bormann type 1&2 2.332 1.498–3.630 1.562 0.942–2.590
 Bormann type 3&4 3.180 2.110–4.794 1.654 1.003–2.728
Lymphovascular invasion 2.487 1.861–3.325 <0.001 1.098 0.768–1.570 0.610
Lauren’s classification 0.157
 Intestinal type 1.000
 Diffuse type 1.175 0.940–1.468
Adjuvant chemotherapy 0.924 0.644–1.324 0.665
Pathological T category <0.001 0.065
 T1 1.000 1.000
 T2 1.684 1.007–2.815 0.919 0.505–1.672
 T3 2.617 1.673–4.095 0.943 0.529–1.683
 T4 4.501 2.920–6.936 1.310 0.732–2.344
Pathological N category <0.001 <0.001
 N0 1.000 1.000
 N1 1.050 0.706–1.563 0.936 0.620–1.414
 N2 1.959 1.414–2.716 1.403 0.985–1.997
 N3 5.169 3.801–7.030 3.407 2.375–4.885
MSI status 0.885
 MSI-L/S 1.000
 MSI-H 0.970 0.645–1.460
PIK3CA amplification 1.051 0.840–1.315 0.662
Genetic mutation
PI3K/AKT pathway 0.928 0.689–1.251 0.625
  TP53 1.220 0.892–1.669 0.213
  ARID1A 0.783 0.552–1.110 0.169
 BRAF 1.001 0.249–4.026 0.999
Bold values indicate statistically significant (p <0.05) and place it before abbreviation list.
BRAF=B-Raf proto-oncogene; MSI=microsatellite instability; MSI-H=MSI-high; MSI-L/S=MSI-low/stable.

4. DISCUSSION

Although the clinical features between early and late recurrence have been reported by other studies, the novel findings of the present study are the molecular difference among GC patients with no recurrence, early recurrence, and late recurrence. In the present study, our results showed that GC patients with early recurrence had more unfavorable clinicopathological features and worse 5-year OS rates than patients with no recurrence and late recurrence. For diffuse-type GC, PIK3CA amplifications were more common in patients with early recurrence; for intestinal-type GC, HP infections were more common in patients with no tumor recurrence. GC patients with single-site recurrence had more ARID1A mutations and better survival than GC patients with multiple-site recurrence.

GC with early recurrence was associated with larger tumor sizes, more extensive lymph node metastasis, more advanced TNM stages, more distant metastasis, and worse survival than GC with late recurrence,2,16 which is consistent with the results of the present study. Furthermore, our results demonstrated that postrecurrence survival was poor in patients with early and late recurrence, regardless of whether recurrence is early or late.

It was reported that PIK3CA amplifications were associated with diffuse-type GC, poor differentiation, and peritoneal recurrence.17 In addition, PIK3CA amplifications were associated with poor survival in GC.18 GC with early recurrence was more likely to develop distant metastasis than GC with late recurrence.4 In the present study, PIK3CA amplifications were associated with early recurrence in diffuse-type GC. In addition, diffuse-type GC patients with early recurrence were more likely to develop distant metastasis than those with late recurrence. According to the results of other reports and the present study, PIK3CA amplification may serve as a prognostic biomarker for early recurrence and poor prognosis in GC, especially diffuse-type GC. PIK3CA amplifications could activate the PI3K/AKT pathway, which may be targeted by mTOR and AKT inhibitors.19 Consequently, in addition to chemotherapy, combination therapy with mTOR or AKT inhibitor might be applicable for diffuse-type GC patients with early recurrence.

The correlation between HP infection and patient prognosis in GC is still controversial.20,21 HP infection was associated with better survival, especially in intestinal-type GC.22 In the present study, for intestinal-type GC, HP infection was more common in patients with no tumor recurrence compared with those with early recurrence and late recurrence. Although HP infection can increase the incidence of GC, HP infection may also improve patient’s outcome by inducing a tumor-specific immune response. It seems that HP infection might play a protective role and induce an immune response and further decrease tumor recurrence in GC. Further in vivo and in vitro studies are required to validate our hypothesis.

ARID1A, a key component of the SWI/SNF chromatin remodeling complex, is considered as a tumor suppressor gene.23 However, the relationship between loss expression of ARID1A and prognosis in GC is controversial. Some studies reported a poor prognosis,24 and some studies demonstrated a good prognosis.25 It was reported that GC with ARID1A mutations was associated with two molecular subtypes, MSI-H and EBV-associated tumors, which were correlated with a favorable prognosis.25 In our study, GC patients with single-site recurrence had more ARID1A mutations and better OS than those with multiple-site recurrence, which has not yet been reported. Among GC with recurrence, patients with ARID1A mutations were associated with more MSI-H GCs than those without ARID1A mutations (27.3% vs. 6.3%; p = 0.002), and this factor might play a role in the better survival of patients with single-site recurrence than in those with multiple-site recurrence. PD-L1 expression was reported to be associated with EBV infection and MSI-H in GC,26 indicating that MSI-H GC was a potential predictor of response to immunotherapy. It was reported that gastrointestinal tract cancer with high enrichment of immune signatures had frequent ARID1A mutations and a higher response rate to immunotherapy.27 Since ARID1A mutations were associated with MSI-H tumors, immunotherapy might be beneficial for this subgroup of GC patients.

There are limitations in the present study. First, this is a retrospective and single-center study, which may cause selection bias in the present study. The enrollment of more patients from different countries and with different races is needed for the validation of our results. We hope our study will provide useful information for treating GC in the near future. The hotspots of the eight genes selected in the present study are based on the mutation prevalence in GC from the COSMIC database, indicating those can be used as good DNA biomarkers for us to investigate the molecular profiles in GC. Although RNA sequencing provides more information, especially in expression levels, splicing error, gene fusion, and so on, the RNA quality of our GC formalin-fixed paraffin-embedded (FFPE) samples might be still a great challenge for us to perform RNA-seq and have the final good data using the FFPE RNA. Further application of RNA-seq in GC study for testing more mutations is required in the future.

In conclusion, GC with early recurrence was associated with unfavorable clinicopathological features, distant metastases, and poor survival. PIK3CA amplifications were associated with early recurrence in diffuse-type GC, whereas GC patients with single-site recurrence had more ARID1A mutations and a better prognosis than those with multiple-site recurrence. Targeted therapy and immunotherapy might be applicable for these patients.

ACKNOWLEDGMENTS

This study was funded by research grants from the Ministry of Science and Technology, Taiwan (107-2314-B-075-005-MY2, 110-2314-B-075-053) and Taipei Veterans General Hospital (V110C-105, V110C-172, V111C-222, V111C-184). The above funding sources had no participation in the designing study, analyzing data, writing, or submitting the article.

REFERENCES

1. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2021;71:209–49.
2. Shiraishi N, Inomata M, Osawa N, Yasuda K, Adachi Y, Kitano S. Early and late recurrence after gastrectomy for gastric carcinoma. Univariate and multivariate analyses. Cancer 2019;89:255–61.
3. Bilici A, Selcukbiricik F. Prognostic significance of the recurrence pattern and risk factors for recurrence in patients with proximal gastric cancer who underwent curative gastrectomy. Tumour Biol 2015;36:6191–9.
4. Eom BW, Yoon H, Ryu KW, Lee JH, Cho SJ, Lee JY, et al. Predictors of timing and patterns of recurrence after curative resection for gastric cancer. Dig Surg 2010;27:481–6.
5. Shin CH, Lee WY, Hong SW, Chang YG. Characteristics of gastric cancer recurrence five or more years after curative gastrectomy. Chin J Cancer Res 2016;28:503–10.
6. Choi JY, Ha TK, Kwon SJ. Clinicopathologic characteristics of gastric cancer patients according to the timing of the recurrence after curative surgery. J Gastric Cancer 2011;11:46–54.
7. Luchini C, Veronese N, Solmi M, Cho H, Kim JH, Chou A, et al. Prognostic role and implications of mutation status of tumor suppressor gene ARID1A in cancer: a systematic review and meta-analysis. Oncotarget 2015;6:39088–97.
8. Wang W, Yang J, Yu Y, Deng J, Zhang H, Yao Q, et al. Expression of JWA and XRCC1 as prognostic markers for gastric cancer recurrence. Int J Clin Exp Pathol 2020;13:3120–7.
9. Japanese Gastric Cancer Association. Japanese gastric cancer treatment guidelines 2014 (ver. 4). Gastric Cancer 2017;20:1–19.
10. Wu CW, Chen MH, Huang KH, Chang SC, Fang WL, Lin CH, et al. The clinicopathological characteristics and genetic alterations between younger and older gastric cancer patients with curative surgery. Aging (Albany NY) 2020;12:18137–50.
11. Sasako M, Sakuramoto S, Katai H, Kinoshita T, Furukawa H, Yamaguchi T, et al. Five-year outcomes of a randomized phase III trial comparing adjuvant chemotherapy with S-1 versus surgery alone in stage II or III gastric cancer. J Clin Oncol 2011;29:4387–93.
12. Kim SY, Choi YY, An JY, Shin HB, Jo A, Choi H, et al. The benefit of microsatellite instability is attenuated by chemotherapy in stage II and stage III gastric cancer: results from a large cohort with subgroup analyses. Int J Cancer 2015;137:819–25.
13. Fang WL, Lan YT, Huang KH, Liu CA, Hung YP, Lin CH, et al. Clinical significance of circulating plasma DNA in gastric cancer. Int J Cancer 2016;138:2974–83.
14. Fang WL, Huang KH, Chang SC, Lin CH, Chen MH, Chao Y, et al. Comparison of the clinicopathological characteristics and genetic alterations between patients with gastric cancer with or without Helicobacter pylori infection. Oncologist 2019;24:e845–53.
15. Ribeiro J, Oliveira A, Malta M, Oliveira C, Silva F, Galaghar A, et al. Clinical and pathological characterization of Epstein-Barr virus-associated gastric carcinoma in Portugal. World J Gastroenterol 2017;23:7292–302.
16. Xu GF, Zhang WJ, Sun Q, Xu X, Zou X, Guan W. Combined epithelial-mesenchymal transition with cancer stem cell-like marker as predictors of recurrence after radical resection for gastric cancer. World J Surg Oncol 2014;12:368.
17. Fang WL, Huang KH, Lan YT, Lin CH, Chang SC, Chen MH, et al. Mutations in PI3K/AKT pathway genes and amplifications of PIK3CA are associated with patterns of recurrence in gastric cancers. Oncotarget 2016;7:6201–20.
18. Shi J, Yao D, Liu W, Wang N, Lv H, Zhang G, et al. Highly frequent PIK3CA amplification is associated with poor prognosis in gastric cancer. BMC Cancer 2012;12:50.
19. Fattahi S, Amjadi-Moheb F, Tabaripour R, Ashrafi GH, Akhavan-Niaki H. PI3K/AKT/mTOR signaling in gastric cancer: epigenetics and beyond. Life Sci 2020;262:118513.
20. Kolb JM, Ozbek U, Harpaz N, Holcombe RF, Ang C. Effect of helicobacter pylori infection on outcomes in resected gastric and gastroesophageal junction cancer. J Gastrointest Oncol 2017;8:583–8.
21. Wang F, Sun GP, Zou YF, Zhong F, Ma T, Li XQ, Wu D. Helicobacter pylori infection predicts favorable outcome in patients with gastric cancer. Curr Oncol 2013;20:e388–95.
22. Fang WL, Huang KH, Chang SC, Lin CH, Chen MH, Chao Y, et al. Comparison of the clinicopathological characteristics and genetic alterations between patients with gastric cancer with or without Helicobacter pylori infection. Oncologist 2019;24:e845–53.
23. Wu RC, Wang TL, Shih IM. The emerging roles of ARID1A in tumor suppression. Cancer Biol Ther 2014;15:655–64.
24. Kim YS, Jeong H, Choi JW, Oh HE, Lee JH. Unique characteristics of ARID1A mutation and protein level in gastric and colorectal cancer: a meta-analysis. Saudi J Gastroenterol 2017;23:268–74.
25. Wang K, Kan J, Yuen ST, Shi ST, Chu KM, Law S, et al. Exome sequencing identifies frequent mutation of ARID1A in molecular subtypes of gastric cancer. Nat Genet 2011;43:1219–23.
26. Ma C, Patel K, Singhi AD, Ren B, Zhu B, Shaikh F, et al. Programmed death-ligand 1 expression is common in gastric cancer associated with Epstein-Barr virus or microsatellite instability. Am J Surg Pathol 2016;40:1496–506.
27. Li L, Li M, Jiang Z, Wang X. ARID1A mutations are associated with increased immune activity in gastrointestinal cancer. Cells 2019;8:678.
Keywords:

ARID1A; Early recurrence; Gastric cancer; Genetic alteration; Late recurrence; PIK3CA amplification

Copyright © 2022, the Chinese Medical Association.