Secondary Logo

Journal Logo

Original Articles

The subpopulation of CD44-positive cells promoted tumorigenicity and metastatic ability in lung adenocarcinoma

Wang, Chien-Yinga,b,c; Huang, Chi-Shuana,d; Yang, Yi-Pinge,f; Liu, Chao-Yua,g; Liu, Yung-Yanga,h; Wu, Wai-Waha,i; Lu, Kai-Hsia,j; Chen, Kuan-Hsuana,k; Chang, Yuh-Liha,k; Lee, Shou-Donga,i,j,*; Lin, Hsin-Chia,i,j,*

Author Information
Journal of the Chinese Medical Association: March 2019 - Volume 82 - Issue 3 - p 196-201
doi: 10.1097/JCMA.0000000000000056
  • Open

Abstract

1. INTRODUCTION

Lung cancer is one of the major leading causes of cancer death in both men and women worldwide.1 Based on the clinical and histological analysis, lung cancers can be divided into two major types: nonsmall cell lung cancers (NSCLC) and small cell lung cancer.1–2 Lung adenocarcinoma (LAC) is one of the major NSCLC and carries a very dismal prognosis with a progressive relapse with complete resection followed by adjuvant chemoradiation.3–7 Recent reports had indicated that the aggressiveness and recurrence of LAC could be produced from the persistence of cancer stem cells (CSCs) known as tumor initiating cells.8–11 Further researches have exhibited that miRNAs are involved in regulating CSC properties in several types of malignant cancers.12–14 However, it is still unclear whether the biomarkers or target-gene profiles may play the key function in regulating or maintaining CSCs in LAC, conferring LAC on metastasis, progression, recurrence, and resistance to clinical-oriented therapeutics.

Some studies showed the evidence that CD44, known as a multifunctional cell surface adhesion receptor, is a potential target regulating the tumorigenic properties in the malignant cancer.15–17 Notably, the recent studies showed that CD44 may play a key role in initiating the tumorigenic stem cell properties, and promoting the metastatic characteristics with epithelial–mesenchymal transition (EMT).18–20 Especially CD44v isoforms are CSCs markers and play a vital role in modulating the capabilities of CSCs, including tumor initiation, self-renewal, metastasis, and immunotherapy resistance.18–22 Moreover, there are some clinical studies and observation to show that CD44 especially CD44v isoforms are key prognostic markers in various types of tumors.20–24 Therefore, the main target of therapies is focusing on CD44 that it may destroy the CSCs population. However, there are many obstacles that remain to determine how to target CD44 as a biomarker and therapeutic treatment hubs.

Transcriptomic and in vivo evidences supported that cancers possessing CSC-like properties were found to have worse prognosis.25–27 Integration of network biology and signal pathways and axis with processing mechanics are dramatically used in cancer research community.27 Here, we identified CD44, known as a multifunctional cell surface adhesion receptor, as a potential target modulating the stem-like characteristics of lung tumor stem-like cells (TSLCs) as well as the progressive propensity in LACs. The identification process was based on a network-signal-processing framework to translate information in the isolated CD44high expression subpopulation, as well as lung-TSLCs. In addition, a series of TSLCs was developed and compared with the parental and normal counterparts to come up with concordant signatures for networks interplays. We developed scalable lung-TSLCs networks-signal-processing type to define CD44 hosting a significant role in the tuning of lung cancer with CSC properties. Notably, CD44 was in correlated synchronization with the markers of EMT, Twist and Snail. The results of this study highlighted the function of CD44-positive subpopulation in promoting tumor CSC-like initiation and EMT-based metastatic ability of TSLCs with lung malignancy.

2. METHODS

2.1. Lung cancer cell lines

The human LAC cell line A549 and H1299 were obtained from the American Type Culture Collection and grown in DMEM (Gibco, Grand Island, NY,) containing 100 units/ml penicillin, 100 μg/ml streptomycin, 4 mmol/l glutamine, and 10% fetal bovine serum (FBS; Gibco). Other primary cultivation from original patients was approved by the IRB, reviewed by Taipei Veterans General Hospital.

2.2. Sorting of CSC-like cells using flow cytometry

Cells were dissociated and washed by cooled 1× PBS, and suspended in incubation buffer (containing PBS of pH 7.2, 0.5% BSA, and 2 mmol/l of EDTA) on ice for 10 minutes for blocking. Cells were resuspended in 1 ml incubation buffer to reach a final concentration of 2 × 105 cells/ml before being stained with 0.5 g/ml of the following primary antibodies on ice for 30 minutes: CD44-FITC (BJ18; Biolegend). Aldefluor assay kit (Aldagen, Durham, NC) was used for the detection of aldehyde dehydrogenase (ALDH) activity according to the manufacturer’s instructions. Data were collected by the FACSCalibur flow cytometer (Becton-Dickinson, Franklin Lakes, NJ) and analyzed with CellQuest software (BD Biosciences) or FlowJo software (TreeStar, San Carlos, CA). Cell debris was excluded from the analysis based on scatter signals. For fluorescent-activated cell sorting in cells, cells were suspended in incubation buffer, stained with indicated primary antibodies, and subjected to the FACSAria (Becton-Dickinson) for CD44 sorting. Positive populations were defined and compared with isotype control staining groups.

2.3. Reverse transcription polymerase chain reaction, quantitative reverse transcription polymerase chain reaction and gene profiling study

The detail of reverse transcription polymerase chain reaction (RT-PCR) and quantitative reverse transcription polymerase chain reaction (qRT-PCR) were conducted. Total RNA was extracted from cells using Trizol reagent (Life Technologies, Bethesda, MD, USA) and the QiagenRNAeasy (Qiagen, Valencia, CA, USA) column for purification, according to the manufacturer’s instructions. The RNA was quantized by UltroSpec 3100 Pro (Amersham), and 1 μg of RNA was reversely transcribed with a SuperScript III reverse transcriptase kit (Invitrogen). qRT-PCR was performed in real time using an ABI 7900 Fast System and SYBR Green Master Mix. The real-time PCR cycling condition used was as follows: 94°C for 3 minutes; 35 thermal cycles (denaturing the DNA at 94°C for 30 seconds, annealing with primers at 60°C for 5 seconds, extending the length of the product at 72°C for 1 minute); and a final extension of the product at 72°C for 10 minutes. The reactions were carried out by specific primers and are listed below TWIST1-forward: GTCCGCAGTCTTACGAGGAG, TWIST1-reverse: GCTTGAGGGTCTGAATCTTGCT, SNAIL-forward: ACTGCAACAAGGAATACCTCAG, SNAIL-reverse: GCACTGGTACTTCTTGACATCTG, GAPDH-forward: ACAACTTTGGTATCGTGGAAGG, SNAIL-reverse: GCCATCACGCCACAGTTTC. Moreover, glyceraldehyde 3-phosphate dehydrogenase was used to normalize the raw data of qPCR, and the error bar indicated the standard deviation of triplicate measurements.

2.4. Sphere formation assay

All cells were trypsinized and centrifuged at 1500 rpm at 4°C for 5 minutes, followed by wash with PBS. Cell were plated in 24-well plates (BD, falcon) at a density of 5000 viable cells/ml and grown in a serum-free DMEM (Gibco, Grand Island, NY) with 1× N2 supplement (Invitrogen), 20 ng/ml EGF, 20 ng/ml bFGF (Invitrogen), and 4 µg/ml heparin (Sigma). Cells were further cultured for 12 days, and the number of tumor spheres were counted by using a microscope.

2.5. Statistical analysis

The results are reported as mean ± SD. Statistical analysis was performed using Student’s t test or an one-way or two-way analysis of variance (ANOVA) test followed by Turkey’s test, as appropriate; p < 0.05 was considered to be statistically significant.

3. RESULTS

CD44 has been reported as cell surface structural molecule and as highlight biomarker of CSCs.20–26 However, it is unclear whether the involvement of CD44 plays a role in regulating CSCs or lung tumor stem-like cells (TSLCs) in lung cancer. To explore the role of CD44 in lung cancer, we isolated and purified the CD44-positive cells by using flow-cytometry and cell sorters. As shown in Fig. 1, the data exhibited the ratio of CD44-positive cells primary tumor cells from lung cancer cell line originally was 31.2%. Furthermore, we validated that the ratio of sorted CD44-positive cells by flow-cytometry was up to 95% (data not shown). Notably, we further evaluated the phenotype of CD44 expression pattern. By using the analysis of immunofluorescent assay, our result showed that the isolated CD44high expression subgroup (CD44high) from lung cancer cells (Fig. 1A) are detected with higher signals of CD44 surface protein when compared with the CD44low expression of lung cancer subgroup (Fig. 1B).

Fig. 1
Fig. 1:
Isolation and characterization of CD44high expression cells from lung cancer cells. (A)The results showed the phenotype of CD44 expression pattern. By using the analysis of immunofluorescent assay, our result showed that the isolated CD44high expression subgroup (CD44high) from lung cancer cells are detected with the higher signals of CD44 surface protein compared (B) with the CD44low expression of lung cancer subgroup (Bar: 100 μm).

To evaluate the tumorigenicity of the CD44high subpopulation of lung cancer cells, we performed the colony formation assay, tumor-spheres formation, invasive/metastatic abilities (Fig. 2). Importantly, our studies and results clearly showed that the CD44high subpopulation of TSLCs (Fig. 2A) presented the significant higher capabilities of tumorigenic colonies (Fig. 2B), tumor-sphere formation (Fig. 2C), and migratory properties (Fig. 2D) compared with the CD44low subpopulation of lung cancer cells.

Fig. 2
Fig. 2:
CD44high expression cells are tumorigenic with self-renewal property. (A) The results showed that the CD44high subpopulation of TSLCs presented the significant higher capabilities of (B) tumorigenic colonies, (C) tumor-sphere formation, and (D) migratory compared to the CD44low subpopulation of lung cancer cells (Bar: 100 μm); *p < 0.05.

To further close dissect the association and characteristics of CD44high subpopulation of TSLCs, the isolated CD44high expression subgroup was determined by microarray and quantitative real-time PCR. The correlation of cancer stemness pathways/axis and EMT process has explored the malignant progression, tumor metastasis, and clinical replase.26–29 To investigate the relationship between the expression levels of CD44 and EMT genes in lung cancer and TSLCs, we examined the expression level of CD44 and EMT transcription markers (Twist and Snail) in lung cancer cell lines, LAC primary cultivated cells, and LAC tissue specimens were determined. We compared with normal lung fibroblasts HEL-299 and MRC-5 cells by qRT-PCR, our result showed the higher CD44 corresponded with elevated Twist and Snail expressions in A549 CD44-positive cell lines and five primary LAC cell types (Fig. 3). We further demonstrated that the elevated CD44 expression compared with the normal counterparts in LAC tissue specimens derived from LAC patients (Fig. 3) and Twist and Snail expression is also higher in LAC tissue compared to normal tissue (Fig. 3). In summary, our results highly suggested that CD44 expression is correlated with EMT transcription factor (Twist and Snail) expression during LAC tumorigenesis.

Fig. 3
Fig. 3:
The EMT gene profiling of Twist and Snail in CD44-hgih and CD44low expression subgroups of lung cancer cells. We examined the expression level of CD44 and EMT transcription markers (Twist and Snail) in lung cancer cell lines and LAC primary cultivated cells. We compared with normal lung fibroblasts HEL-299 and MRC-5 cells by qRT-PCR, our result showed the higher CD44 corresponded with elevated Twist and Snail expressions in A549 CD44-positive cell lines and five primary LAC cell types; *p < 0.05.

The current data showed the critical role of CD44 in regulation of cancer stemness and the research status of CD44 as biomarkers, and therapeutic targets in cancer are outlined. The current gage and future directions that may elicit the best use of CD44 or clinical applications are founded. However, the role of CD44 in lung cancer and TSLCs is not determined. As we have demonstrated that the subgroups of CD44high TSLCs revealed the cancer stem-like properties with the high expression of EMT gene profile, we, therefore, tested the role of Snail, one of a key transcriptional factor and biomarker of EMT in lung cancer. Notably, our data confirmed that the overexpression of Snail with gene vector in CD44low expression cells (Fig. 4A) further significantly promoted the properties of lung tumor stem-like cells, percentage of ALDH1 subpopulation (Fig. 4B) and CD44high/CD24low groups (Fig. 4C), as well as the generating abilities of tumorigenic and tumor-sphere formation (Fig. 4D)

Fig. 4
Fig. 4:
Overexpressing Snail in CD44low expression cells promoted the CSC-like properties. We therefore test the role of Snail, one of a key transcriptional factor and biomarker of EMT in lung cancer. (A) The immunofluorescent data showed that overexpression of Snail with gene vector in CD44low expression cells significantly promoted the properties of lung tumor stem-like cells, including promoting the percentage of (B) ALDH1 subpopulation and (C) CD44high/CD24low groups, and (D) the generating abilities of tumor-sphere formation (Bar: 100 μm); *p < 0.05.

4. DISCUSSION

Recent studies indicated that CSCs are mainly responsible for cancer aggressiveness, immunotherapy resistance, and tumor relapse. CD44 has been identified as CSC surface markers for isolating and enriching CSCs in malignant cancers. The current findings showed the critical role of CD44 in regulation of cancer stemness and the research status of CD44 as biomarkers and therapeutic targets in recurrent tumors. The EMT plays a vital step during embryonic development, as well as in the initiation of cancer metastasis. A linkage of EMT and CSC has recently been demonstrated in breast cancer cell under transcriptome-based EMT-driven CSC characteristics. Snail, a member of the zinc-finger transcription factor family, is a transcription factor of EMT and facilitates to initiate and promote EMT by repressing E-cadherin. Herein, we demonstrated that overexpressing Snail in CD44low subgroup of noncancer stem-like cells further significantly regulates the ALDH1 subpopulation and CD44high/CD24low groups. In turns, CD44high expression subgroups govern the CSC-like capabilities with the generating abilities of tumorigenic initiation and metastasis.

The ALDH, a family of cytosolic isoenzyme, plays a key role in responsively oxidizing intracellular aldehydes. This function will be further contributing to the oxidation of retinol to retinoic acid in cancer stem cell. The recent research has shown that up-regulated Snail expression significantly increased the subpopulation of ALDH+ cells in malignant cancer and CSCs. In this study, we detected the significance of higher expression levels of Snail mRNA in CD44high subpopulation of TSLCs. Using the CSC platform of the serum-free medium culture with bFGF and EGF, the up-regulated expression of Snail can promote CSC generation and TSLCs to form 3D spheroid formation and enhanced self-renewal ability. Therefore, we aimed to develop a network-based model using the lung-TSLC panel to characterize or modulate the underlying biological perturbation leading to the variable survivals of LACs. It was expected that such network-based model derived from the lung-TSLCs could further elucidate the underlying regulatory mechanisms leading to invasion and metastasis. We hypothesized that the stemness marker of lung tumors modeled by the lung-TSLC networks could be utilized to estimate the prognostic survival times. Lastly, clinical CD44 expression levels associated with LACs metastasis and survivals were further verified by qRT-PCR and immunofluorescent staining in lung cancer cells, down-regulation of CD44 promotes EMT, while over-expression induces the opposite effect. In this study, we found that LAC-CSC-related CD44 could regulate the stemness properties in LAC-CSC and alter their metastatic potential.

ACKNOWLEDGMENTS

This study was supported by research grants from the Joint Projects of National Yang-Ming University and Cheng-Hsin General Hospital, and the Joint Projects of National Yang-Ming University and Far-Eastern Memorial Hospital from 2015 to 2018 in Taiwan.

REFERENCES

1. Kim HS, Mendiratta S, Kim J, Pecot CV, Larsen JE, Zubovych I, et al. Systematic identification of molecular subtype-selective vulnerabilities in non-small-cell lung cancer. Cell 2013;155:552–66.
2. Quoix E, Westeel V, Zalcman G, Milleron B. Chemotherapy in elderly patients with advanced non-small cell lung cancer. Lung Cancer 2011;74:364–8.
3. Reck M, Heigener DF, Mok T, Soria JC, Rabe KF. Management of non-small-cell lung cancer: recent developments. Lancet 2013;382:709–19.
4. Blinman P, Alam M, Duric V, McLachlan SA, Stockler MR. Patients’ preferences for chemotherapy in non-small-cell lung cancer: a systematic review. Lung Cancer 2010;69:141–7.
5. Yeh HH, Lai WW, Chen HH, Liu HS, Su WC. Autocrine IL-6-induced Stat3 activation contributes to the pathogenesis of lung adenocarcinoma and malignant pleural effusion. Oncogene 2006;25:4300–9.
6. Yan Y, Zuo X, Wei D. Concise review: emerging role of cd44 in cancer stem cells: a promising biomarker and therapeutic target. Stem Cells Transl Med 2015;4:1033–43.
7. Thiery JP, Sleeman JP. Complex networks orchestrate epithelial-mesenchymal transitions. Nat Rev Mol Cell Biol 2006;7:131–42.
8. Mani SA, Guo W, Liao MJ, Eaton EN, Ayyanan A, Zhou AY, et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell 2008;133:704–15.
9. Polyak K, Weinberg RA. Transitions between epithelial and mesenchymal states: acquisition of malignant and stem cell traits. Nat Rev Cancer 2009;9:265–73.
10. Batlle E, Sancho E, Franci C, Dominguez D, Monfar M, Baulida J, et al. The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat Cell Biol 2000;2:84–9.
11. Cano A, Perez-Moreno MA, Rodrigo I, Locascio A, Blanco MJ, del Barrio MG, et al. The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat Cell Biol 2000;2:76–83.
12. Backlund MG, Mann JR, Holla VR, Shi Q, Daikoku T, Dey SK, et al. Repression of 15-hydroxyprostaglandin dehydrogenase involves histone deacetylase 2 and snail in colorectal cancer. Cancer Res 2008;68:9331–7.
13. Palmer HG, Larriba MJ, Garcia JM, Ordonez-Moran P, Pena C, Peiro S, et al. The transcription factor SNAIL represses vitamin D receptor expression and responsiveness in human colon cancer. Nat Med 2004;10:917–9.
14. Pena C, Garcia JM, Silva J, Garcia V, Rodriguez R, Alonso I, et al. E-cadherin and vitamin D receptor regulation by SNAIL and ZEB1 in colon cancer: clinicopathological correlations. Hum Mol Genet 2005;14:3361–70.
15. Huber MA, Kraut N, Beug H. Molecular requirements for epithelial-mesenchymal transition during tumor progression. Curr Opin Cell Biol 2005;17:548–58.
16. Sugimachi K, Tanaka S, Kameyama T, Taguchi K, Aishima S, Shimada M, et al. Transcriptional repressor snail and progression of human hepatocellular carcinoma. Clin Cancer Res 2003;9:2657–64.
17. Yang MH, Chang SY, Chiou SH, Liu CJ, Chi CW, Chen PM, et al. Overexpression of NBS1 induces epithelial-mesenchymal transition and co-expression of NBS1 and Snail predicts metastasis of head and neck cancer. Oncogene 2007;26:1459–67.
18. Thiery JP. Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer 2002;2:442–54.
19. Feldmann G, Dhara S, Fendrich V, Bedja D, Beaty R, Mullendore M, et al. Blockade of hedgehog signaling inhibits pancreatic cancer invasion and metastases: a new paradigm for combination therapy in solid cancers. Cancer Res 2007;67:2187–96.
20. Lien HC, Hsiao YH, Lin YS, Yao YT, Juan HF, Kuo WH, et al. Molecular signatures of metaplastic carcinoma of the breast by large-scale transcriptional profiling: identification of genes potentially related to epithelial-mesenchymal transition. Oncogene 2007;26:7859–71.
21. Chen YC, Hsu HS, Chen YW, Tsai TH, How CK, Wang CY, et al. Oct-4 expression maintained cancer stem-like properties in lung cancer-derived CD133-positive cells. PLoS One 2008;3:e2637.
22. Spira A, Ettinger DS. Multidisciplinary management of lung cancer. N Engl J Med 2004;350:379–92.
23. Lam WK, Watkins DN. Lung cancer: future directions. Respirology 2007;12:471–7.
24. Su J, Wu S, Wu H, Li L, Guo T. CD44 is functionally crucial for driving lung cancer stem cells metastasis through Wnt/beta-catenin-FoxM1-Twist signaling. Mol Carcinog 2016;55:1962–73.
25. Wellner U, Schubert J, Burk UC, Schmalhofer O, Zhu F, Sonntag A, et al. The EMT-activator ZEB1 promotes tumorigenicity by repressing stemness-inhibiting microRNAs. Nat Cell Biol 2009;11:1487–95.
26. Lo WL, Yu CC, Chiou GY, Chen YW, Huang PI, Chien CS, et al. MicroRNA-200c attenuates tumour growth and metastasis of presumptive head and neck squamous cell carcinoma stem cells. J Pathol 2011;223:482–95.
27. Sowa T, Menju T, Sonobe M, Nakanishi T, Shikuma K, Imamura N, et al. Association between epithelial-mesenchymal transition and cancer stemness and their effect on the prognosis of lung adenocarcinoma. Cancer Med 2015;4:1853–62.
28. Ju SY, Chiou SH, Su Y. Maintenance of the stemness in CD44(+) HCT-15 and HCT-116 human colon cancer cells requires miR-203 suppression. Stem Cell Res 2014;12:86–100.
29. Haria D, Trinh BQ, Ko SY, Barengo N, Liu J, Naora H. The homeoprotein DLX4 stimulates NF-kappaB activation and CD44-mediated tumor-mesothelial cell interactions in ovarian cancer. Am J Pathol 2015;185:2298–308.
Keywords:

CD44-positive cells; Epithelial–mesenchymal transition; Lung adenocarcinoma; Metastatic ability; Tumorigenicity

© 2019 by Lippincott Williams & Wilkins, Inc.