Effects of Tongxinluo on myocardial fibrosis in diabetic rats : Journal of the Chinese Medical Association

Secondary Logo

Journal Logo

Original Article

Effects of Tongxinluo on myocardial fibrosis in diabetic rats

Wang, Xiaomeia,b; Mu, Changzhengc; Mu, Tianchic; Gao, Lilib; Zhao, Yaxueb; Zhang, Yangyib; Zhang, Zhimiana,*

Author Information
Journal of the Chinese Medical Association: March 2016 - Volume 79 - Issue 3 - p 130-136
doi: 10.1016/j.jcma.2015.06.022

    Abstract

    1. Introduction

    In 1972, Rubler1 first proposed diabetic cardiomyopathy (DCM) as one of the microangiopathies in diabetes with a very complicated pathogenesis, independent of the occurrence of hypertension and coronary artery disease. The prevailing opinion now is that DCM is highly associated with the renin–angiotensin–aldosterone system, oxidative stress, inflammatory factors, growth factors, and extracellular matrix (ECM), which play an essential role in the development and occurrence of DCM.2–6 Furthermore, the major pathological changes of DCM are an increase in the size of myocardial microvascular walls, a narrow lumen, ECM accumulation, and myocardial fibrosis,7 which is a characteristic pathological change in DCM.8 Recent studies showed that a change in the expression of transforming growth factor beta 1 (TGF-β1) and an abnormal ECM might be involved in the development and occurrence of DCM.9,10 TGF-β1 is the most powerful cytokine that has been recognized to induce fibrosis. It performs many cellular functions, including the control of fibroblast proliferation, differentiation, migration, and production of ECM. TGF-β1 also increases protein expression in the ECM of different cell types; however, overexpression of TGF-β1 promotes myocardial fibrosis and hypertrophy leading to ventricular remodeling.11 The Smad protein is found in the cytoplasm; it is the downstream signal transduction molecule of the TGF-β1 family of receptors as well as the key regulatory factor of the TGF-β1/Smad signal transduction pathway. Moreover, the TGF-β1/Smad signaling pathway in myocardial tissue is closely associated with DCM.

    Tongxinluo, in capsule form, is a traditional Chinese medicine. It is a compound preparation consisting of many kinds of herbs and insects, developed using the traditional Chinese collateral disease theory. Tongxinluo is crushed and squeezed, which helps release the active ingredients into solution and improves bioavailability and efficacy. Some reports have indicated that Tongxinluo has a good clinical efficacy when used to treat patients with angina. This study explored the effect of Tongxinluo on the prevention and treatment of myocardial fibrosis in rats with diabetes induced by streptozotocin (STZ) and the possible mechanism of action of Tongxinluo, and examined the expression levels of TGF-β1, Smad3, and Smad7 in myocardial tissue.

    2. Methods

    2.1. Animals

    Healthy Sprague-Dawley male rats ranging in age from 7 weeks to 8 weeks and weighing 180–220 g were provided by the Experimental Animal Center of Liaoning Medical College. The certification number was SYXK (Liao) 2005-0013. This study was conducted in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The animal use protocol was reviewed and approved by the Institutional Animal Care and Use Committee of Shandong University.

    2.2. Establishment of diabetic model and groups

    Thirty healthy Sprague-Dawley male rats that were deprived of food and water for 12 hours were injected with 1% STZ solution (Sigma, 22 chaowai street, fanli mansion, 4 floor, room 407, Chaoyang, Beijing) through the caudal vein. An STZ (1%) solution was prepared with 0.5 mol/L of sodium citrate buffer (pH 4.5). As controls, 10 rats were injected with the same dose (0.5 mol/L) of the sodium citrate buffer. After 72 hours, blood samples were collected to measure blood glucose level using a blood glucose monitor (SureStep Plus; Johnson Company). If the blood glucose concentration exceeded 16.7 mmol/L for 3 consecutive days, a diabetic model was assumed to have been successfully established. Thereafter, 28 diabetic rats were successfully established, which were then randomly divided into a diabetic group and a Tongxinluo group; each group had 14 rats. In the Tongxinluo group, 1.0 g Tongxinluo ultrafine powder (equivalent to 1.43 g of crude drug; lot number: 070406; HebeiYiling Pharmaceutical Institute, Shijiazhuang, China), consisting of ginseng, leech, scorpion, chilopod, woodlouse, red paeonia, cicada, and borneol, was dissolved in physiological saline and intragastrically administered to rats at a dose of 0.5 g/kg once a day. The same volume of water was administered to the control and diabetic groups for 12 weeks. The rats were weighed and blood samples were collected to determine blood glucose level once a week. In addition, drug dose was regulated according to weight.

    2.3. Measurement of heart function

    At the end of 12 weeks, rats from the three groups were anesthetized by injecting them with a 20% urethane solution (5 mL/kg). Tracheal cannulation was performed on the rats; one end of the tube was inserted into the left ventricular chamber and the other end was connected to a pressure transducer to record left ventricular pressure (LVP) curves. Then, LVP signals were inputted into a BL-420F biological signal collection system (Taimeng Tech. Ltd., Chengdu, China) and the heat rate, LVP maximum rise or fall speed (±dp/dtmax), left ventricular systolic pressure (LVSP), and left ventricular end diastolic pressure (LVEDP) were recorded.

    2.3.1. Determination of heart weight index and left ventricular weight index

    After functional measurement was obtained, the heart was removed and washed at 4°C and weighed after being dried. The left ventricle was weighed and rat heart weight index (whole heart weight/body weight) and left ventricular weight index (left ventricular weight/body weight) were calculated. Next, the myocardial specimen of the left ventricle was cut into two parts; one part was stored at −80°C for reverse transcriptase polymerase chain reaction (RT-PCR) assay, and the other part was fixed with 10% formalin and then embedded in paraffin for spectroscopic analysis and detection of the protein expressions of TGF-β1, Smad3, and Smad7 through immunohistochemistry.

    2.4. Measurement of myocardial interstitial collagen volume fraction

    After the paraffin sections were dewaxed, they were stained with Masson's dye and observed under a light microscope. Myocardial cells and collagen fibers were dyed in red and blue, respectively. Next, the sections were photographed and scanned to calculate the interstitial collagen volume fraction (CVF) using an image analyzer (CVF = collagen area/total area). In each section, the measurements were performed by choosing five high-power fields and then obtaining mean area values.

    2.5. Immunohistochemistry assay

    Myocardial tissue sections were dewaxed with xylene and ethanol, and antigen repair and serum blocking were performed. The primary antibody (at 4°C overnight) and secondary antibodies (rabbit antirat TGF-β1, Smad3, and Smad7 antibodies; Beijing Bioss Ltd., Beijing, China) were added, and 3,3′-diaminobenzidine (DAB) coloration, hematoxylin redyeing, dehydration, and mounting were performed in order. A brown-yellow coloration represented a positive expression under the microscope. Ten high-power fields were chosen in sections from each group to be observed randomly and analyzed using a CIAS-1000 cell image analyzer (Beijing Daheng Image Vision, Ltd., Beijing, China).

    2.5.1. RT-PCR

    Myocardial tissue, which was stored at −80°C, was taken and 1 mL of Trizol solution was added to extract total RNA. RT-PCR assay was performed according to the RT-PCR kit instructions. Additionally, primers were designed and synthesized by Dalian Takara Ltd (Dalian treasure biological engineering co., LTD, economic and technological development zone of northeast 19 second street of Dalian city, Liaoning province). Primers were as follows: TGF-β1 (329 bp)—sense: 5′ATGGTGGACCGCAACAAC3′, antisense: 5′TGAGCACTGAAGCGAAAGC3′; Smad3 (74 bp)—sense: 5′GATGTGGCTGGGAAATAC3′, antisense: 5′TTCTAGTCAGTCTGCCTGTAC3′; Smad7 (345 bp)—sense: 5′CCCTTTGGATCAGCATTTC3′, antisense: 5′GGTTCTGGTTCAGCCTTCTA3′; β-actin (477 bp)—sense: 5′GAAATCGTGCGTGACATTA3′, antisense: 5′GGACTCATCGTACTCCTGCT3′. PCR conditions were as follows: initial melting at 94°C for 5 minutes followed by 33 cycles of denaturation at 94°C for 30 seconds, annealing at an appropriate temperature for 30 seconds, and extension at 72°C for 30 seconds. The PCR was then given a final extension step of 72°C for 7 minutes. The transcripts were checked subsequently using 2% agarose gel electrophoresis, and integrated optical density was presented by the ratio of TGF-β1, Smad3, Smad7, and β-actin.

    2.6. Statistical analysis

    Statistical analysis was performed using the SPSS 13.0 software (SPSS, Inc., Chicago, IL, USA). Measured data were presented as means ± standard deviation. The Q-test and one-way analysis of variance were used to compare the data between two groups; p < 0.05 denoted a significant statistical difference.

    SPSS 13.0 statistical software (SPSS, Inc.) was used for data processing. The data were expressed as (x ± s). The multigroup comparison was performed using analysis of variance, and the intergroup comparison was performed using the standard pairwise q test (Student–Newman–Keuls method). A p value < 0.05 was considered a statistically significant difference.

    3. Results

    3.1. General condition

    After injection of STZ, the rats presented typical symptoms of diabetes (diuresis, polydipsia, and polyphagia) and their weight increased slowly along with gradually increasing listlessness; meanwhile, their hair became thin and lackluster. At the end of the study, two rats died due to infection in the diabetic group and one rat was dead in the Tongxinluo group. Therefore, 25 rats survived.

    3.2. Effect of Tongxinluo on heart function

    Heart function was judged by the measurement of LVP (±dp/dtmax). We also measured LVSP and LVEDP, which reflected systole and abnormal diastolic function, respectively. Compared with the control group, LVSP and ±dp/dtmax were lower, but LVEDP was higher in the diabetic group. Furthermore, LVSP and ±dp/dtmax were clearly higher in the Tongxinluo group than in the diabetic group. However, LVEDP was significantly lower in the Tongxinluo group than in the diabetic group (Table 1).

    T1-5
    Table 1:
    Comparisons of heart function in three groups (Symbol ± s).
    FSM1-5
    Symbol

    3.3. Effect of Tongxinluo on blood glucose level, heart weight index, and left ventricular weight index

    At the end of 12 weeks, the blood glucose level was higher in the diabetic group than in the control group. The heart weight index and left ventricular weight index were also clearly higher in the diabetic group. Furthermore, compared with the diabetic group, there was no obvious difference in blood glucose level in the Tongxinluo group. The heart weight index and left ventricular weight index were significantly reduced, but were still higher than those in the control group (Table 2).

    T2-5
    Table 2:
    Comparisons of blood sugar, heart weight index, left ventricular weight index, and CVF in three groups (Symbol ± s).

    3.4. Measurement of myocardial interstitial CVF

    Under the light microscope, myocardial cells were seen surrounded by only a few collagen fibers that were blue, thin, and well distributed in the control group. However, many large collagen fibers that were poorly aligned and unevenly distributed were observed in the diabetic group. In addition, compared with the diabetic group, the number of blue collagen fibers was lower in the Tongxinluo group. CVF was determined by image analysis, and when compared with the control group, it was significantly higher in the diabetic group. Compared with the diabetic group, CVF was clearly reduced in the Tongxinluo group, but was still higher than that in the control group (Table 2).

    3.5. Protein expressions of TGF-β1, Smad3, and Smad7

    TGF-β1 and Smad3 were brownish-yellow particles located in the myocardial cytoplasm, periplasm, and surrounding vessels and were weakly expressed. However, Smad7 was strongly expressed in the control group. In the diabetic group, the expressions of TGF-β1 and Smad3 were strong, but the expression of Smad7 was significantly lower. Compared with the diabetic group, the expressions of TGF-β1 and Smad3 were clearly lower, but the expression of Smad7 was significantly higher in the Tongxinluo group (Fig. 1, Table 3).

    T3-5
    Table 3:
    Comparisons of the protein expressions of TGF-β1, Smad3, and Smad7 (Symbol ± s).
    F1-5
    Fig. 1:
    In the control group, the protein expressions of TGF-β1 and Smad3 were presented as weakly positive, and the protein expression of Smad7 was strongly positive. In the diabetic group, the protein expressions of TGF-β1 and Smad3 were strongly positive, but the expression of Smad7 was reduced significantly. In the Tongxinluo group, protein expressions of TGF-β1 and Smad3 obviously reduced, but the expression of Smad7 increased significantly compared with that in the diabetic group. TGF-β1 = transforming growth factor beta 1.

    3.5.1. Expressions of mRNA in TGF-β1, Smad3, and Smad7

    Compared with the control group, the mRNA expressions of TGF-β1 and Smad3 were higher, but the expression of Smad7 was significantly lower in the diabetic group. Furthermore, compared with the diabetic group, the mRNA expressions of TGF-β1 and Smad3 were clearly lower, but the expression of Smad7 was significantly higher in the Tongxinluo group (Table 4, Fig. 2).

    T4-5
    Table 4:
    Comparisons of the mRNA expressions of TGF-β1, Smad3, and Smad7 in three groups (Symbol ± s).
    F2-5
    Fig. 2:
    Contents of (A) TGF-β1 mRNA; (B) Smad3 mRNA; and (C) Smad7 mRNA in rat myocardial tissue of the three groups. TGF-β1 = transforming growth factor beta 1.

    4. Discussion

    DCM is a chronic complication of diabetes. In diabetes mellitus, alterations in cardiac function in the absence of ischemic heart disease, hypertension, or other cardiac pathologies are termed DCM.12 Recent studies have found that intermyocardial collagen deposition and myocardial fibrosis are important features of DCM. Fibrosis is characterized by ECM accumulation and often by a change in the quality of the ECM, such as Type I and Type III collagen.13 Myocardial fibrosis is a major pathological characteristic in the development and occurrence of DCM. It causes a significant increase in ECM, and diastolic dysfunction is induced by diffused myocardial fibrosis.14 Diastolic dysfunction represents the earliest preclinical manifestation of DCM.15 This is followed by the development of systolic dysfunction and a clear reduction of the left ventricular ejection fraction,16,17 which can easily cause arrhythmia and heart failure, even sudden death.18 TGF-β1 is a polypeptide member of the TGF-β superfamily of cytokines. A high expression of TGF-β1 promotes the occurrence of fibrosis in myocardial tissue, by increasing the synthesis and secretion of ECM and the production of collagen and matrix proteins. TGF-β1 reduces the degradation of ECM, which leads to myocardial ECM accumulation, ultimately leading to myocardial fibrosis.19 A previous study showed that TGF-β1 was overexpressed and the synthesis of Type I and Type III collagen increased in an animal model of ventricular remodeling.20 TGF-β1 binds to specific receptors on the cell surface to exert its biological effects; Type I (TGF-β1 receptor I, TGF-β1RI) and Type II (TGF-β1RII) receptors have high affinities and signal transduction functions.

    Smad protein is a frequently studied substrate. It is the only substrate transducing the signal downstream of the TGF-β1RI activating enzyme. Smads are intracellular signal transduction proteins of the TGF-β1 pathway and are involved in the pathological changes of DCM. Many studies have shown that Smads could play an important role in neovascularization, myocardial hypertrophy, and heart failure. Eight types of Smad proteins are expressed in the mammalian cytoplasm, which are divided into three categories based on their functions: (1) receptor-modulating Smad proteins (R-Smads) include Smads1, Smads2, Smads3, Smads5, and Smads8, among which Smads2 and Smads3 mediate TGF-β1 signal transduction; (2) comediator Smad proteins (Co-Smads) include the only mammalian Smad, Smads4, which is involved in TGF-β1 signal transduction; and (3) inhibitory Smad proteins (I-Smads) include Smad6 and Smad7. In the TGF-β1/Smad pathway, first, TGF-β1 binds to its receptor TGF-β1RI, which phosphorylates the C-terminal serine residue of the R-Smads protein, leading to the generation of different downstream signals. Smad7, an inhibitory Smad protein, is involved in the modulation of TGF-β1 by negatively regulating signal transduction. Smad7 binds competitively with TGF-β1RI to stop Smad2,3 phosphorylation and TGF-β1 signaling.21,22

    Some studies have shown that Tongxinluo could regulate the TGF-β1/Smad signaling pathway, thereby improving the functions of the target organs. Wang et al23 applied Tongxinluo while treating diabetic nephropathy, and used technologies such as RT-PCR, cell transfection, in situ hybridization, and laser confocal microscopy. It was found that Tongxinluo could block the miR-21-regulated TGF- β1/Smad3 pathway and increase the expression of Smad7, thus improving renal structures and functions, and playing a protective role in diabetic nephropathy. Our study showed that the protein and mRNA expression levels of TGF-β1 were clearly higher in the diabetic and Tongxinluo groups than in the control group. However, compared with the diabetic group, the protein and mRNA expression levels of TGF-β1 were lower in the Tongxinluo group, which suggested that Tongxinluo could reduce the expression of TGF-β1 in rats with DCM and alleviate the occurrence and development of DCM.

    This study also found that the protein and mRNA expressions of Smad3 were higher in the myocardial tissue of diabetic rats. However, the expression of Smad7 decreased. In the Tongxinluo group, the expression of Smad7 was significantly higher, but Smad3 expression was lower. This implies that Smad3 might be involved in the occurrence and development of DCM and that Smad7 plays a protective role in DCM through the Smad7/TGF-β1 signaling pathway. The results of this study further showed that Tongxinluo could prevent and treat myocardial fibrosis in diabetic rats. The mechanism of action of Tongxinluo could be through its effect on the intracellular signal transduction of TGF-β1, wherein it downregulates the expressions of TGF-β1 and Smad3, and upregulates the expression of Smad7 to relieve myocardial fibrosis and improve heart function in diabetic rats. These results indicate that Tongxinluo has a protective effect on the myocardial tissue of diabetic rats. However, Tongxinluo is composed of many herbs and insects, including Panax ginseng, leech, scorpion, Radix paeoniaerubra, periostracum cicadae, ground beetle, centipede, sandalwood, rosewood, heartwood, frankincense, semen Ziziphi Spinosae, and borneol; whether the protective effect on myocardial tissue observed in this study is imparted by a single ingredient or multiple compounds is still not clear. Therefore, further studies are needed to determine the exact mechanism.

    References

    1. Rubler S, Dlugash J, Yuceoglu YZ. New type of cardiomyopathy associated with diabetic glomerulosclerosis. Am J Cardiol. 1972;30:595-602.
    2. Cardin S, Guasch E, Luo X, Naud P, Le Q, Shi Y, et al. Role for microRNA-21 in atrial profibrillatory fibrotic remodeling associated with experimental postinfarction heart failure. Circ Arrhythm Electrophysiol. 2012;5:1027-1035.
    3. Hou N, Wang J, Li ZH, Cao Y, Fan KJ, Yang X. Cardiomyocyte overexpression of microRNA-27b resulted in cardiac fibrosis and mitochondria injury in mice. Yi Chuan. 2012;34:326-334.
    4. Liang H, Zhang C, Ban T, Liu Y, Mei L, Piao X, et al. A novel reciprocal loop between microRNA-21 and TGF-β1RIII is involved in cardiac fibrosis. Int J Biochem Cell Biol. 2012;44:2152-2160.
    5. Creemers EE, Pinto YM. Molecular mechanisms that control interstitial fibrosis in the pressure-overloaded heart. Cardiovasc Res. 2011;89:265-272.
    6. Falcão-Pires I, Leite-Moreira AF. Diabetic cardiomyopathy: understanding the molecular and cellular basis to progress in diagnosis and treatment. Heart Fail Rev. 2012;17:325-344.
    7. Aneja A, Tang WH, Bansilal S, Garcia MJ, Farkouh ME. Diabetic cardiomyopathy: insights in to pathogenesis, diagnostic challenges, and therapeutic options. Am J Med. 2008;121:748-757.
    8. Lu J, Yao YY, Dai QM, Ma SG, Zhang FS, Cao L, et al. Erythropoietin attenuates cardiac dysfunction by increasing myocardial angiogenesis and inhibiting interstitial fibrosis in diabetic rats. Cardiovasc Diabetol. 2012;11:105.
    9. Jiang C, Huang H, Liu J, Wang Y, Lu Z, Xu Z. Fasudil, a rho-kinase inhibitor, attenuates bleomycin-induced pulmonary fibrosis in mice. Int J Mol Sci. 2012;13:8293-8307.
    10. Harmancey R, Taegtmeyer H. The complexities of diabetic cardiomyopathy: lessons from patients and animal models. Curr Diab Rep. 2008;8:243-248.
    11. Fang ZY, Prins JB, Marwick TH. Diabetic cardiomyopathy: evidence, mechanism, and therapeutic. Endocr Rev. 2004;25:543-567.
    12. Maya L, Villarreal FJ. Diagnostic approaches for diabetic cardiomyopathy and myocardial fibrosis. J Mol Cell Cardiol. 2010;48:524-529.
    13. Ban CR, Twigg SM. Fibrosis in diabetes complications: pathogenic mechanisms and urinary markers. Vasc Health Risk Manag. 2008;4:575-596.
    14. Liu JW, Liu D, Cui KZ, Xu Y, Li YB, Sun YM, et al. Recent advances in understanding the biochemical and molecular mechanism of diabetic cardiomyopathy. Biochem Biophys Res Commun. 2012;427:441-443.
    15. Nagy A, Cserep Z. Link between diabetes and diastolic dysfunction and the diagnosis role of echocardiography. Orv Hetil. 2009;150:2060-2067.
    16. Wu W, Sun Z, Li Q, Wang M, Miao J, Zheng Z, et al. Influence of the glucose-lowering rate on left ventricular functioning in patient with type 2 diabetes and coronary heart disease. J Diabetes Complications. 2012;26:83-88.
    17. Giannetta E, Isidori AM, Galea N, Carbone I, Mandosi E, Vizza CD, et al. Chronic inhibition of cGMP phosphodiesterase 5A improves diabetic cardiomyopathy: a randomized, controlled clinical trial using magnetic resonance imaging with myocardial tagging. Circulation. 2012;125:2323-2333.
    18. Chavali V, Tyagi SC, Mishra PK. Predictors and prevention of diabetic cardiomyopathy. Diabetes Metab Syndr Obes. 2013;6:151-160.
    19. Peart JN, Headrick JP. Sustained cardioprotection: exploring unconventional modalities. Vasc Pharmacol. 2008;49:63-70.
    20. Chen R, Xie ML. The research progress of TGF-β1/Smads signal pathway in the treatment of myocardial fibrosis and its application. Chin Pharmacol Bull. 2012;28:1189-1192.
    21. Euler-Taimor G, Heger J. The complex pattern of Smad signaling in the cardiovascular system. Cardiovasc Res. 2006;69:15-25.
    22. Schneiders D, Heger J, Best P, Michael Piper H, Taimor G. SMAD proteins are involved in apoptosis induction in ventricular cardiomyocytes. Cardiovasc Res. 2005;67:87-96.
    23. Wang JY, Gao YB, Zhang N, Zou DW, Xu LP, Zhu ZY, et al. Tongxinluo ameliorates renal structure and function by regulating miR-21-induced epithelial-to-mesenchymal transition in diabetic nephropathy. Am J Physiol Renal Physiol. 2014;306:F486-F495.
    Keywords:

    diabetic myocardial fibrosis; Smad3; Smad7; Tongxinluo; transforming growth factor beta 1

    © 2016 by Lippincott Williams & Wilkins, Inc.