Secondary Logo

Journal Logo

Research Articles

The antimicrobial peptide Brevinin-2ISb enhances the innate immune response against methicillin-resistant Staphylococcus aureus by activating DAF-2/DAF-16 signaling in Caenorhabditis elegans, as determined by in vivo imaging

Xie, Hui; Nie, Xu; Zhan, Yonghua; Zeng, Qi; Chen, Xueli; Chen, Dan

Author Information
doi: 10.1097/JBR.0000000000000079

Abstract

Introduction

Bacterial antibiotic resistance is a major area of concern for public health and well-being. The increasing incidence of methicillin-resistant Staphylococcus aureus (MRSA) in hospitals and communities is particularly important.[1,2] The increased antibiotic resistance and prevalence of MRSA are mostly related to antibiotic overuse in primary health care, which is an issue that requires urgent attention.[3–5] One possible solution to this resistance issue is the development of alternative antimicrobial drugs that can activate the host innate immune defense against pathogens.[6,7] Increased understanding of host-pathogen interactions and bacterial pathogenesis has led researchers to focus on the interaction between the innate immune system and external stimuli in many drug screening initiatives.[8]Caenorhabditis (C.) elegans is an appealing in vivo model[9,10] that has been used frequently to screen for novel antibacterial drug candidates.[11–13]

The pathogenesis of MRSA is mediated by certain secretory virulence factors, including toxins.[14–16] In particular, MRSA isolates associated with more invasive diseases, including endocarditis, primary septic arthritis and osteomyelitis, exhibit sustained expression of the genes encoding fibronectin-binding protein A (fnbA) and fibronectin-binding protein B (fnbB).[17–19] Moreover, staphylococcal enterotoxin (SEs), toxic shock syndrome toxin-1 (TSST-1) and exfoliative toxins, which are produced by some MRSA isolates, can lead to some pathological and post-infectious conditions, including staphylococcal food poisoning, toxic shock syndrome and scalded skin syndrome.[20]

Lately, drug resistance has become a major research topic in both the basic science and clinical arenas. Traditional antibiotics such as penicillin are expected to be replaced by new drugs based on antibacterial peptides in the near future.[21] Antimicrobial peptides (AMPs) are 10- to 50-amino acid molecules that comprise part of the endogenous innate immune system in a wide variety of species.[22] Some AMPs are expected to be useful in circumventing the issue of drug resistance in many pathogenic bacteria.[23]

Brevinin-2 is an inaugural member of an AMP family (also called Brevinin-2) that was originally isolated from Rana limnocharis in Japan.[24] Protein similarity analyses have shown that, except for four conserved amino acid residues (Lys15, Cys27, Lys28 and Cys33),[25] the primary structure of Brevinin-2 is dissimilar to that of other Brevinin-2 family members. Brevinin-2 peptides derived from Pelophylax lessonae and Rana boulengeri have demonstrated potent antimicrobial activity against gram-negative and gram-positive bacteria (Escherichia coli and Staphylococcus aureus, respectively), as well as against the pathogenic yeast Candida albicans.[26,27] Compared to the Brevinin-1 family, the Brevinin-2 family exhibits weak hemolysis activity, highlighting its promise for use as an antibacterial drug.[28] However, while Brevinin-2 family peptides have broad-spectrum antibacterial activity, they may induce hemolysis at concentrations close to their minimum inhibitory concentration (MIC). This feature has limited the use and role of these peptides in the development of new drugs.[29] Reducing the hemolytic activity of AMPs is an important issue to be resolved in the context of drug development.[30] At present, it is mainly believed that Brevinin-2 family peptides mainly act on bacteria with higher or equal to its MIC, which leads to bacterial content flow out and die through membrane perforation.[31] There are no reports that affect the physiological index and bacterial biochemical level of C. elegans. Whether Brevinin-2 family have the above comprehensive effects becomes an important theoretical basis for further research on the therapeutic mechanism of typical antimicrobial peptides in Brevinin-2 family.

The C. elegans immune response against pathogenic microbes is typically mediated by p38 mitogen-activated protein kinase (PMK-1), transforming growth factor β and the ZIP-2 and DAF-2/DAF-16 insulin-like pathways.[32–39] The DAF-2/DAF-16 pathway in particular regulates the expression of immune factors.[40] The role of this pathway in regulating longevity in C. elegans has been well-characterized. Not only are daf-2 mutants long-lived on a diet of OP50 (E coli strain OP50), they also resist infection by a range of both gram-negative and gram-positive bacterial pathogens.[34,41,42] Known targets of the DAF-2/DAF-16 pathway include the poorly characterized members of the downstream of DAF-16 gene group, as well as patent antimicrobial genes such as lys-7.[43–45] This pathway is assumed to contribute to resistance to infection by regulating the production of these different secreted antimicrobial proteins. Indeed, abrogation of the expression of several of these proteins (LYS-7) in daf-2 mutants leads to a reduction in lifespan.[46,47] Notably, the expression of LYS-1, LYS-2, SPP-3 and SPP-18 is also strongly upregulated upon infection with Pseudomonas aeruginosa.[48]

In this study, we tested MRSA (Staphylococcus aureus subsp. aureus; ATCC 33591) pathogenicity and host immunity in a C. elegans model of infection.[32] Then, we examined the effect of a newly defined Brevinin-2 peptide (Brevinin-2ISb) on host innate immunity.

Materials and methods

Preparation of Brevinin-2IS peptide and reagents

Brevinin-2ISb (primary sequence: N-SFLTTFKDLAIKAAKSAGQSVLSTLSCKLSNTC-C) was synthesized by Hai Mai Science Pte. Ltd (Xi’an, China). The Brevinin-2ISb treatment solution was prepared by dissolving the lyophilized peptide in distilled water to an MIC of 8.7 ± 0.9 μM,[32] and the solution was stored at 4°C. All solution preparation reagents were purchased from China Pharmaceutical Group Chemical Reagents Co., Ltd. (Shanghai, China).

Bacterial and C. elegans strains

The MRSA strain ATCC 33591 was cultured in Trypticase Soy (Bio Feng) media at 37°C. E coli strain OP50 was grown in Luria Bertani (Bio Feng, Xi’an, China) broth.[49] Wild-type C. elegans (N2 Bristol) and variant worm strains with mutations in DAF-2 (mutant e1370), DAF-16 (mutant mu86), PMK-1 (mutant km25) and SKN-1 (mutant zu67) were obtained from the Caenorhabditis Genetics Center (CGC, Springfield, Missouri, USA). C. elegans embryos of the same age were bleached with alkaline hypochlorite and sodium hydroxide and maintained on OP50-containing plates at 25°C until they reached the larva-4 (L4)stage.[50] All procedures involving animals were approved and monitored by the Academic Committee at Xidian University and Xi’an Jiaotong University Animal Care and Use Committee, Shaanxi Province, China (approval No. JGC201207) on July 15, 2017.

MRSA killing assay

Worms were maintained at 20°C on solid nematode growth medium (NGM) pre-seeded with live E coli OP50. For the MRSA killing assays, synchronized worms (from early L1 to young adult stages) were grown on NGM supplemented with 1/10, 1/8, 1/6, 1/4, 1/2 MIC (low MIC treatment groups) Brevinin-2ISb. One-day-old adult worms were transferred to modified NGM plates with a pre-established MRSA lawn. The MRSA lawn was established by spreading 10 μL of fresh MRSA culture to the plates containing low MICs of Brevinin-2ISb, after which the plates were incubated for 8 hours at 37°C. This step was essential to prevent the worms from becoming infected with other pathogens. Approximately 50 worms were transferred to each plate, and the MRSA cultures were spread onto the central area of the plate to ensure effective pathogen exposure and to prevent worms from climbing the sides of the plate. OP50-containing NGM plates served as negative control, while MRSA-containing plates served as a positive control. All plates were incubated at 25°C and routinely observed under an anatomical microscope. The number of live and dead worms was calculated every 12 hours, until all of the worms on the control plates had perished. Worms that did not respond to the gentle touch of a worm harvester were declared dead. Worms that died from sticking to the side of the plate were excluded from data analysis. Three biological replicates were performed for all experiments.

Effects of Brevinin-2ISb on C. elegans at the individual level

Worm lifespan experiments

Experiments were performed using synchronized wild-type N2 worms raised at 20°C, with or without 2.175 μM Brevinin-2ISb (1/4 MIC). OP50-only (negative control) and Brevinin-2ISb supplementation significantly extended worm lifespan.

Influence of spawning quantity

Reproduction was evaluated at the late L4 stage. To do this, two worms were transferred to a fresh treatment plate (n = 6 for each treatment). During the reproductive period, eggs were counted daily using a dissecting microscope with 8 × magnification, after removal of hermaphrodites to new treatment plates. Egg counts were compared with the OP50-only control group.

Motor ability

Motor ability was determined using stage L4 larvae divided into an experimental group (Brevinin-2ISb–treated MRSA) and two control groups (OP50-only and MRSA-only) in NGM medium. After 3 minutes of MRSA treatment, worm movements including pharyngeal twitch, head swing, body bending, u-turn, and forward and backward motion were recorded. The assessment was repeated 20 times, every 30 seconds, for further statistical analysis.

Pharyngeal pumping rate

Pharyngeal pumping rate was evaluated at 24, 48, 72 and 96 hours of adulthood. For this, worms were observed under a microscope at 100× magnification at room temperature (n = 18–30 for each treatment).

MRSA-related immune pathway analysis

MRSA infection was performed as described above for the killing assay. C. elegans strains with mutations in daf-2, daf-16, pmk-1, and skn-1 were synchronized on NGM. Approximately one hundred worms were transferred to each plate and harvested after between 12 and 96 hours of exposure to MRSA. Various MRSA-infected mutants were treated with appropriate concentrations of Brevinin-2ISb (as established by the MRSA killing assay). All plates were incubated at 25°C and routinely observed under an anatomical microscope. Three biological replicates were performed for all experiments.

C. elegans gene expression analysis using real-time quantitative polymerase chain reaction (qPCR)

The infected worms were washed 3 times with sterile M9 buffer (3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl, 1 mL 1 M MgSO4, with H2O to 1L). A sterile tube was briefly cooled on ice to collect the worms, and the buffer was then removed by gentle pipetting. Total worm RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) or an RNeasy RNA kit (Qiagen, Dusseldorf, Germany) according to the manufacturer's protocol. The integrity of the RNA was evaluated by denaturating agarose gel electrophoresis, and the RNA quantity was measured using a Nanodrop ND2000 spectrophotometer (Nanoparticle Technology, Wilmington, DE, USA). For immune gene expression analysis, RNA samples were collected from three biological replicates for each treatment. The cDNA was synthesized using a kit (Takara, Tokyo, Japan). Real-time qPCR was performed on a One Step Real-Time PCR system (ABI2700, New York City, NY, USA) using Promega GoTaq SYBR green reagent, with 4 μM of each gene-specific primer and 10ng of template cDNA. The amplified target genes were normalized to C. elegans actin-1 levels. Primer sequences are listed in Table 1. Fold changes were calculated using the 2−ΔΔCt method. Worms were grown with or without Brevinin-2ISb for different lengths of time (as indicated). The expression of a particular set of immune-related genes was analyzed by qPCR, using total RNA/cDNA isolated from adult worms exposed to MRSA or OP50 only (control). Results are expressed as fold-changes (relative expression) and were normalized to the OP50-only control group.

Table 1 - List of primers used for quantitative polymerase chain reaction analysis (Caenorhabditis elegans gene expression)
Genes Forward (5′–3′) Reverse (5′–3′) Product size (bp)
lys-7 TTGTTGACTCATCCCTTCC TGTCCTGCTGGGTTGTAT 189
spp-1 TGAACATCGGAACTCTTTGC TCAGCTCTTCCTCACACTCG 201
K08D8.5 TTACGATGGTGATTCCGTGA GCTTGTTGCCAGTTGAGACA 197
C29F3.7 GATCGGCAACTTTACCTCCA AATTGTGGCGGATATTCTGG 211
actin AAGACCACGTCATCAAGG TTCTCCATATCATCCCAGTT 176

C. elegans immune pathway protein analysis

The genomic DNA of Caenorhabditis elegans was extracted, according to the whole genome sequence of C. elegans, the promoter genomic region of lys-7 was determined, and primers (forward 5’-caatgcacatgctacgctgctggtgtcgcgg-3’, reverse 5’- aatgtacaaaactgcaatcctattcaaagactggtc-3’) were designed to amplify Caenorhabditis elegans lys-7 promoter region was recovered and inserted into the pcfj90-gfp-pmyo-7 expression vector. The plasmid was injected into the gonad of C. elegans by dropping a small amount of microinjection oil on the prepared fixed pad. After the injection, the nematodes were picked out and cultured on OP50. Five worms were screened under a fluorescent screening microscope at 20oC, and the fluorescent worms were selected and photographed. Subsequently, the strain of nematode with stable expression of green fluorescent protein was selected for in vivo imaging experiment.

One hundred worms expressing green fluorescent protein–labeled LYS-7 (an immune protein), a strain constructed in our laboratory as part of a preliminary study, were derived from distinct treatment conditions to determine relative expression levels of LYS-7. The experimental results were obtained by laser confocal microscopy (Weztlar, Germany).

MRSA gene expression analysis

MRSA (with an initial OD600 nm) were cultured overnight at 37°C in MH broth (Qiagen, Dusseldorf, Germany) under basal (untreated) conditions or after treatment with 1/4 MIC of Brevinin-2ISb. The cultures were then centrifuged for 10 minutes at 2000 × g, and total RNA was extracted from the bacterial pellets, as previously described.[32] cDNA synthesis and qPCR were carried out as before. 16S rRNA served as an endogenous gene expression control. Primer sequences are listed in Table 2. All tests were repeated three times.

Table 2 - List of primers used for quantitative polymerase chain reaction analysis (methicillin-resistant Staphylococcus aureus gene expression)
Gene Forward (5′–3′) Reverse (5′–3′) Product size (bp)
sea GGTTATCAATGTGCGGGTGG CGGCACTTTTTTCTCTTCGG 196
seb GTATGGTGGTGTAACTGAGC CCAATAGTGACGAGTTAGG 221
sec AGATGAAGTAGTTGATGTGTATGG CACACTTTTAGAATCAACCG 186
see AGGTTTTTTCACAGGTCATCC CTTTTTTTTCTTCGGTCAATC 177
seg CGTCTCCACCTGTTGAAGG CCAAGTGATTGTCTATTGTCG 183
seh CAACTGCGATTTAGCTCAG GTCGAATGAGTAATCTCTAGG 192
sei CAACTCGAATTTTCAACAGGTAC CAGGCAGTCCATCTCCTG 204
sej CATCAGAACTGTTGTTCCGCTAG CTGAATTTTACCATCAAAGGTAC 175
fnbA GCGGAGATCAAAGACAA CCATCTATAGCTGTGTGG 193
fnbB GGAGAAGGAATTAAGGCG GCCGTCGCCTTGAGCGT 211
tsst ACCCCTGTTCCCTTATCAATC TTTTCAGTATTTGTAACGGCC 178
16SrRNA GCAACGAGCGCAACCC TACGGYTACCTTGTTACGACTT 187

Protease activity assay

The protease activity assay was performed using MRSA cultured under basal (untreated) conditions or after treatment with 1/4 MIC of Brevinin-2ISb. Protease activity was determined spectrophotometrically at 600 nm by measuring skim milk hydrolysis, which can be used to determine the activity of proteases secreted by bacteria in culture.[39] Protease activity was expressed as milligrams (mg) of protein hydrolyzed per milliliter (mL) of culture per hour, using a standard curve generated from a serial dilution of skim milk (skim milk powder for microbiology, Solarbio, Beijing, China).

Alkaline protease activity assay

The alkaline protease activity assay was performed using Hide-Remazol brilliant blue fibrous powder (Sigma, San Francisco, CA, USA). The supernatant from MRSA cultures, untreated or treated with 1/4 MIC of Brevinin-2ISb, was used to estimate relative alkaline protease activity. Enzymatic activity was expressed as units, where 1unit was defined as a 1.0 increase in OD595 nm value per mL per hour.

Hemolytic activity assay

The hemolytic activity was determined by inoculating a bacterial suspension into brain-heart infusion medium (BHI, Solarbio, China), untreated or treated with 1/4 MIC of Brevinin-2ISb. The inoculated medium was cultured for 24 hours at 37°C with agitation, and then centrifuged for 5 minutes at 11,453 × g. The supernatant was filtered through a 0.22 μm membrane. A 475-μL aliquot of the filtrate was added to a 1.5-mL centrifuge tube containing 25 μL of sterile and defibrinized sheep blood. The solution was shaken gently at 37°C for 2 hours, followed by centrifugation at 1610 × g for 1minute. A 200-μL aliquot of the solution was transferred to 96-well plate, and absorbance was measured at OD450 nm.

Total enterotoxin expression assay

The effect of Brevinin-2ISb on the expression of total enterotoxin in MRSA was evaluated by ELISA (R-Biopharm, Darmstadt, Germany). ELISA reagents were allowed to equilibrate to room temperature before analysis, and the assay was performed according to the manufacturer's instructions. Absorbance values were measured at OD450 nm.

Statistical analyses

Data are presented as mean ± standard deviation (SD) of three independent experiments. All assays were replicated in a comparable manner. Data from the killing assays were analyzed with SPSS 17.0 (SPSS, Chicago, IL, USA). Pairwise comparisons were conducted using independent-samples t-test or one-way analysis with Tukey's post hoc test. Figures were produced using GraphPad 6.0 (San Diego, CA, USA).

Results

Sub-MIC concentrations of Brevinin-2ISb protect C. elegans from MRSA infection

Wild-type C. elegans (N2 strain) was cultured with Brevinin-2ISb, starting at the early L4 stage. At day 1 of adulthood, worms were exposed to MRSA in the presence or absence of Brevinin-2ISb on NGM culture medium. The survival rate of the worms was recorded every 12 hours. Worms cultured with MRSA or OP50, in the absence of Brevinin-2ISb, served as the positive and negative controls, respectively. Treatment with Brevinin-2ISb led to survival rates higher than those observed in the positive control group (Fig. 1). All untreated worms died at 96 hours, while 1/2 MIC (4.35 μM) and 1/4 MIC (2.175 μM) of Brevinin-2ISb protected up to 74.5 ± 1.89% and 67.5 ± 2.31% of the worms, respectively, against the lethal effects of MRSA infection (P < 0.001). At concentrations below 1/2 MIC of Brevinin-2ISb (9/10, 4/5, 7/10, 3/5 MIC), the nematode survival rate was not significantly different from that seen with 1/2 MIC (P > 0.05), while the hemolytic activity was higher and not suitable for follow-up studies (Additional Fig. 1, http://links.lww.com/JR9/A21). The 1/2 MIC and 1/4 MIC nematode survival rates were also significantly higher (P < 0.001) compared to those observed at other concentrations of Brevinin-2ISb. Based on these observations, 1/4 MIC was identified as the optimum Brevinin-2ISb concentration for our assays, since it provided (i) the highest level of protection against MRSA-induced lethality and (ii) the lowest hemolytic activity (Additional Fig. 2, http://links.lww.com/JR9/A22). Therefore, this concentration was established as the standard for all further experiments.

Figure 1
Figure 1:
Brevinin-2ISb–induced survival of wild-type C. elegans worms (N2 strain) infected with MRSA. Various concentrations of Brevinin-2ISb were tested and compared to a negative control (ddH2O). Day 1 adult N2 worms raised on E coli strain OP50 (E coli OP50) and treated with Brevinin-2ISb were exposed to a MRSA bacterial lawn for up to 96 hours (as indicated). Each group was repeated 3 times. Data are presented as the mean ± SD. N2 = 200. C. elegans = Caenorhabditis elegans, MIC = minimum inhibitory concentration, MRSA = methicillin-resistant Staphylococcus aureus.

Using this optimal concentration of Brevinin-2ISb (1/4 MIC), a protection rate of 80.5% was reached at 24 to 60 hours of MRSA exposure. Thus, Brevinin-2ISb may play an important role in the induction of host immunity after MRSA challenge. To rule out the possibility that the observed effects were due to any hormetic effect of Brevinin-2ISb, we assessed whether Brevinin-2ISb was toxic. Treatment with Brevinin-2ISb alone at 1/4 MIC did not disturb the growth or development of wild-type worms. Our results suggest that Brevinin-2ISb, at optimal levels, is not toxic to nematodes, since it extended their lifespan (Fig. 2A) and increased their reproductive activity (Fig. 2B), improved their normal behavior indicators (Fig. 2C) and improved their overall physiology (Fig. 2D). Taken together, the data suggest that Brevinin-2ISb promotes C. elegans health in the absence of pathogens and may modulate the C. elegans immune system in response to MRSA infection.

Figure 2
Figure 2:
Physiological effects of Brevinin-2ISb on C. elegans. (A) Worm lifespan (N2 = 200). (B) Influence on spawning (N2 = 6). (C) Motor ability (N2 = 10). (D) Pharyngeal pumping rate (N2 = 10). Each group was repeated 3 times. Data are presented as the mean ± SD. P < 0.05, ∗∗ P < 0.01, ∗∗∗ P < 0.001, vs OP50-only control group (independent-samples t-test). MIC = minimum inhibitory concentration, MRSA = methicillin-resistant Staphylococcus aureus, OP50 = E coli strain OP50.

The DAF-2/DAF-16 signaling pathway is critical for Brevinin-2ISb-mediated protection against MRSA infection

Mutant C. elegans lacking daf-2, daf-16, skn-1 or pmk-1 were used to test which immune pathways are involved in Brevinin-2ISb-induced protection against MRSA. As shown in Figure 3, Brevinin-2ISb treatment did not protect daf-16 mutants well, while it protected skn-1 and pmk-1 mutants to the same extent as wild-type worms. This suggests that a functional DAF-16 signaling cascade is essential for Brevinin-2ISb-mediated immunity against MRSA. We also found that treatment with 1/4 MIC of Brevinin-2ISb shorten the lifespan of the skn-1 and pmk-1 mutants, as indicated by a right shift in their survival curves. Therefore, Brevinin-2ISb supplementation may affect MRSA virulence. Moreover, daf-16 mutants survived MRSA infection for a longer period of time after Brevinin-2ISb treatment, which also indicates that Brevinin-2ISb may activate particular innate immune pathways in nematodes.

Figure 3
Figure 3:
Impact of Brevinin-2ISb on the survival of mutant C. elegans. Wild-type and mutant worms (as indicated) were cultured on a MRSA bacterial lawn pre-treated with Brevinin-2ISb (Isb). Worms raised on OP50 and transferred to a MRSA bacterial lawn without Brevinin-2ISb served as the positive control group, and N2 worms (wild-type) raised on OP50 alone were used as the negative control group (n = 100). Each group was repeated 3 times. Data are presented as the mean ± SD. DAF-2 = insulin-like receptor, DAF-16 = forkhead box protein O, Isb = brevinin-2ISb, N2 = wild-type Caenorhabditis elegans, PMK-1 = mitogen-activated protein kinase pmk-1, SKN-1 = protein skinhead-1.

Brevinin-2ISb induces the expression of immune response genes related to DAF-2/DAF-16 signaling in C. elegans

The downstream affects of Brevinin-2ISb treatment on the expression of four immune response genes in MRSA-infected and uninfected worms were analyzed by qPCR. The selected genes––lys-7 (lysozyme-like protein), spp-1 (saponin-like protein), K08D8.5 (CUB-like domain) and C29F3.7 (CUB-like domain)––are known to be closely related to the DAF-2/DAF-16 signaling pathway.[38,51–53] Worms fed with E coli OP50 were used as a “non-infection” control, while worms fed with OP50 prior to MRSA exposure served as the control for infection. All immune genes that we tested were upregulated 2- to 25-fold after treatment with 1/4 MIC of Brevinin-2ISb compared to the control at the same time points (P < 0.05, P < 0.01 or P < 0.001, Fig. 4A–D). In fact, at as early as 12 hours of adulthood, all of these genes were significantly upregulated (P < 0.001), especially lys-7 (8- to 25-fold). Thus, when the host is not challenged by MRSA infection, Brevinin-2ISb appears to enhance host immunity. However, the immune-related genes were differentially expressed at distinct times after infection. K08D8.5 and C29F3.7 were not activated by Brevinin-2ISb (Fig. 4C and D). Notably, at 48 hours post-infection, lys-7 (P < 0.05) and spp-1 (P < 0.05) were suppressed in MRSA-infected worms compared to control worms fed with OP50 (Fig. 4A and B). In contrast, at this same time point, K08D8.5 and C29F3.7 expression did not appear to be affected by Brevinin-2ISb treatment (Fig. 4C and D). Overall, Brevinin-2ISb appears to enhance immunity in C. elegans and to induce the expression of a set of immune genes under both basal and MRSA infection conditions.

Figure 4
Figure 4:
Brevinin-2ISb–mediated changes in the expression of immune-related genes in C. elegans at 12, 24, 36 and 48 hours (real-time quantitative polymerase chain reaction). (A) lys-7 expression groups. (B) spp-1 expression groups. (C) K08D8.5 expression groups. (D) C29F3.7 expression groups. Each group was repeated 3 times with one-way analysis of variance. Each group was repeated 3 times. Data are presented as the mean ± SD. P < 0.05, ∗∗ P < 0.01,∗∗∗ P < 0.001, vs OP50-only control group (independent-samples t-test). Isb = Brevinin-2ISb, MRSA = methicillin-resistant Staphylococcus aureus, OP50 = E coli strain OP50.

We further validated these observations using a nematode transgenic line constructed in our laboratory in which the lys-7 drives expression of green fluorescent protein (Fig. 5). Laser confocal microscopy showed that the green fluorescence intensity of the worms was significantly higher at 12 and 24 hours compared with the control group (P < 0.001). The fluorescence intensity of the 48-hour MRSA treatment group was significantly decreased (P < 0.05). In conclusion, the increased levels of lys-7 expression are consistent with the higher levels of gene expression observed after Brevinin-2ISb treatment in vivo.

Figure 5
Figure 5:
LYS-7 immunoreactivity in C. elegans after treatment with Brevinin-2ISb. (A) The real-time distribution of green fluorescent protein (GFP) labeled by lys-7 promoter in C. elegans in vivo for 48 hours (laser confocal microscopy). Scale bar = 10 μm. (B) The relative quantitative reading of green fluorescent protein labeled by lys-7 promoter in vivo within 48 hours. OP50-fed worms were used as the “non-infection” control, while OP50-fed MRSA-infected worms (MRSA) were used as the infected control. The histogram shows quantification (densitometry) of the green fluorescence intensity of each group. Data are presented as the mean ± SD. P < 0.05, ∗∗ P < 0.01, ∗∗∗ P < 0.001, vs OP50-only control group (one-way analysis of variance with Tukey's post hoc test). Each group was repeated 3 times. n = 100. Isb = Brevinin-2ISb, MRSA = methicillin-resistant Staphylococcus aureus, OP50 = E coli strain OP50.

Brevinin-2ISb suppresses expression of SEs and MRSA-related virulence factor genes

In addition to enhancing the host immune response, another mechanism that may act to attenuate worm death following MRSA exposure involves inhibition of virulence factors by treatment with 1/4 MIC of Brevinin-2ISb. Therefore, the effect of Brevinin-2ISb on the expression of quorum-sensing genes and MRSA-related virulence factor genes was further investigated.

Brevinin-2ISb was able to repress the expression of a number of virulence factor genes in MRSA, without affecting the expression of housekeeping genes (Fig. 6). SEs genes––Sea, Seb, Sec, See, Seg, She, Sei and Sej––were repressed 4- to 70-fold (Fig. 6A). Likewise, virulence factor genes, including FnbA, FnbB, and Tsst, were down-regulated 2- to 5-fold by treatment with 1/4 MIC of Brevinin-2ISb (Fig. 6B).

Figure 6
Figure 6:
Brevinin-2ISb suppressed the mRNA expression of SEs (A) and other virulence factor genes (B) in MRSA. Gene expression in Brevinin-2ISb-treated MRSA cultures was quantified by qPCR. Each group was repeated 3 times. Data are presented as the mean ± SD, n = 106 CFU (colony-forming units). P < 0.05, ∗∗ P < 0.01, ∗∗∗ P < 0.001, vs untreated MRSA (control group; independent-samples t-test). FnbA = fibronectin-binding protein A, FnbB = fibronectin-binding protein B, MRSA = methicillin-resistant Staphylococcus aureus, Sea, Seb, Sec, See, Seg, She, Sei and Sej = SEs genes, TSST-1 = toxic shock syndrome toxin-1.

Biochemical evidence of MRSA inhibition by Brevinin-2ISb

As indicated previously, Brevinin-2ISb significantly downregulated SEs and virulence factor genes in MRSA. Consistently, total pathogen protease activity was significantly inhibited by Brevinin-2ISb treatment (Fig. 7A), and alkaline protease activity also appeared to be affected (Fig. 7B). MRSA hemolytic activity and total enterotoxin expression showed4- and 3-fold decreases in activity, respectively, upon Brevinin-2ISb treatment (Fig. 7C and D). Additionally, the expression of MRSA genes encoding secreted toxins was significantly reduced.

Figure 7
Figure 7:
Biochemical activity of secreted MRSA virulence factors. (A) Effect of Brevinin-2ISb (Isb) on MRSA total protease activity. (B) Effect of Brevinin-2ISb on MRSA alkaline protease activity. (C) Effect of Brevinin-2ISb on MRSA hemolytic activity. (D) Effect of Brevinin-2ISb on enterotoxin expression in MRSA. Each group was repeated 3 times. Data are presented as the mean ± SD, n = 106 CFU. ∗∗ P < 0.01, ∗∗∗ P < 0.01, vs untreated MRSA (control group; independent-samples t-test). NC = negative control, OD = optical density, PC = positive control.

Discussion

Clinical MRSA isolates are pathogenic to humans. Pathogenicity in animal models is mediated by a number of virulence factors.[54] In fact, it has been demonstrated that MRSA kills C. elegans in either hours or days, depending on the type of growth medium used in the killing assay.[55–59] In previous studies, we found that the Brevinin-2ISb peptide has a strong inhibitory effect on MRSA at concentrations below its MIC. However, Brevinin-2ISb shows some hemolytic activity at its MIC, which is detrimental to its development and clinical use as a potential antibiotic drug. In the present study, we utilized a C. elegans model of infection to investigate the effects of Brevinin-2ISb on both host immunity and MRSA pathogenicity. We observed that Brevinin-2ISb concentration levels of 1/2 MIC (4.35 μM) and 1/4 MIC (2.175 μM) exerted the best protection against MRSA-dependent killing in worms, while higher or lower concentrations showed more variable effects. We selected 1/4 MIC for follow-up studies, since the hemolytic activity at this concentration was lower than that at 1/2 MIC (Additional Fig. 2, http://links.lww.com/JR9/A22).

Due to their complex habitats and exposed skin, many amphibians are highly susceptible to pathogenic microorganisms from the environment. Therefore, during evolution innate immune defense mechanisms involving the secretion of antibacterial peptides from the skin were established. Strikingly, Brevinin-2ISb, a newly defined Brevinin-2 peptide, can inhibit pathogenic strains of MRSA. This observation suggested that, while studying the antibacterial activity and therapeutic effects of antimicrobial peptides, attention should be paid to mitigation of the negative effects of pathogenic microorganisms at low doses.

C. elegans exhibited different immune responses against MRSA at early (12 hours) and late (48 hours) stages of infection. At 12 hours post-infection, all prototypical immune genes tested were upregulated, while the expression of most genes (expect for lys-7) was repressed or returned to normal levels at 48 hours after MRSA exposure. This finding was largely consistent with previous reports.[38] For instance, 12 hours of exposure to MRSA resulted in the activation of immune response genes in C. elegans. In addition, lys-1 and lys-7, as well as a lipase gene (ZK6.7), were demonstrated to be induced in C. elegans by exposure to the pathogenic bacterium Serratia marcescens.[60] Similarly, infection of C. elegans by the gram-positive bacterium Microbacterium nematophilus was correlated with the upregulation of a set of immune effectors.[61]

Despite the abundance of studies supporting immune activation after infection with a series of pathogenic organisms, there is also evidence of immune suppression after prolonged pathogen exposure. For instance, at 12 hours of exposure to PA14, immune response genes such as spp-1, lys-7 and thn-2 were suppressed in C. elegans by activation of the DAF-2 insulin-like signaling pathway.[62,63] Similarly, we observed that DAF2/DAF16 pathway–associated immune genes were inhibited to different degrees after 24 hours of exposure to MRSA. Host immune suppression may represent one of the many strategies that pathogens have evolved to counteract host immune defenses, through a yet unknown mechanism.[64–66] Interestingly, after 24 hours of infection, C29F3.7 and K08D8.5 expression levels returned to normal, and were not inhibited by prolonged exposure to MRSA. C29F3.7 and K08D8.5 are early-expressed genes that do not encode antibacterial-related proteins in the DAF2/DAF16 pathway.[52] So, although MRSA can enhance the expression of some genes, inhibition of gene expression at later stages of infection was not observed. However, treatment with Brevinin-2ISb induced sustained, high expression of Lys-7 and Spp-1 48 hours post-infection. In addition, these 2 genes showed different degrees of inhibition after 24 hours of MRSA infection. Due to the significant increase in lys-7 expression, validation at the protein level was pursued by immune blotting and laser confocal localization. The activation of key antibacterial proteins in the DAF-2/DAF-16 immune pathway[40] by low concentrations of Brevinin-2ISb was therefore more comprehensively confirmed in this study than that of other proteins. Therefore, in this study we characterized an unexpected role for Brevinin-2ISb in activating the DAF-2/DAF-16 immune pathway (Fig. 8).

Figure 8
Figure 8:
Brevinin-2ISb does not abolish MRSA growth. First, 100 μL of a fresh overnight culture of MRSA was inoculated into 10 mL of freshly autoclaved MH media in the presence or absence of 1/4 MIC of Brevinin-2ISb. The cultures were then incubated at 37°C with gentle shaking at 250 rpm. Absorbance at 600 nm was measured every two hours until the stationary growth phase was reached. Three biological replicates of the experiment were performed, each of which included three technical replicates. Each group was repeated 3 times with survival curve. The growth curve values are mean ± SD. MIC = minimum inhibitory concentration, MRSA = methicillin-resistant Staphylococcus aureus, OD = optical density.

Research has shed light on both sides of the pathogen-host interaction: mounting of an immune defense by the host and suppression of host immunity by the pathogen (s).[67–71] It is possible that one side may overcome the other at specific periods during infection, and that the outcome of this unbalanced condition may be further regulated by external factors. Indeed, in the present study we found that Brevinin-2ISb blocked the MRSA-induced immune repression involving a number of immune response genes in C. elegans. Despite the differential expression of immune genes upon MRSA infection, Brevinin-2ISb was observed to enhance the expression of the same immune response genes under basal “non-infection” conditions, again suggesting an important role of Brevinin-2ISb in the positive modulation of immunity in vivo. The immune modulation effect of Brevinin-2ISb may result from the special alpha spiral structure that it contains (Fig. 9).[72] Compared with other antimicrobial peptides of Brevinin-2 family, Brevinin-2isb antimicrobial peptides are characterized by incomplete α - helix “rigid” structure and partial β-folding. From the perspective of structure, it has certain “flexibility”. We also preliminarily speculated that the formation of the above-mentioned structure made the interaction between MRSA and MRSA relatively mild, especially at low concentrations, it could effectively enter MRSA cells and its virulence was inhibited (Fig. 10).

Figure 9
Figure 9:
Tertiary structure and phylogenetic analysis of Brevinin-2ISb. (A) Prediction of the tertiary structure of Brevinin-2ISb (generated using SWISS-MODEL, May 18, 2020). (B) A potential phylogenetic tree of the Brevinin-2 family. Differently colored branches represent different Brevinin-2ISb subfamilies.
Figure 10
Figure 10:
Brevinin-2ISb enhances the DAF-2/DAF-16 innate immune pathway in C. elegans and plays a role in combatting MRSA infection. On the one hand, Brevinin-2ISb can enhance the physiological level of nematodes, activate DAF-2/DAF-16 pathway, and effectively inhibit the main virulence factor of MRSA, and play a multiple therapeutic and protective role. AGE-1 = Phosphatidylinositol 3-kinase age-1, AMPs = Antimicrobial peptides, C. elegans = Caenorhabditis elegans, DAF-2 = Insulin-like receptor, DAF-16 = Forkhead box protein O, FnbA = fibronectin-binding protein A, FnbB = fibronectin-binding protein B, LYS-7 = lysozyme-like protein 7, SEs = staphylococcal enterotoxin, SPP-1 = COMPASS component SPP1, TSST-1 = toxic shock syndrome toxin-1.

The conflicting reports over the effects of Brevinin-2ISb could be attributable to a few factors. Originally, Brevinin-2ISb was the main antibacterial small peptide derived from frog skin. The direct collection of skin secretions requires a long purification process, entails high costs, and has relatively limited yields. In addition, peptide production from eukaryotic and/or prokaryotic expression systems can be also uncertain, depending on the number of experimental steps involved in (complexity of) the purification process, as well as the quality/purity of the final macromolecule. Therefore, in this study we employed a direct synthesis procedure to obtain pure Brevinin-2ISb to facilitate a more reliable analysis of its biological activity. Brevinin-2ISb and members of the same AMP family have demonstrated broad-spectrum antibacterial activity and concomitant hemolytic activity, which limits their development and further use as clinical drugs. Unlike previous studies, here we successfully reduced the therapeutic concentration of Brevinin-2ISb and also decreased its hemolytic activity, therefore achieving better protection and more robust therapeutic effects in C. elegans.[72–74] This discovery provides a comprehensive theoretical basis for the development and clinical application of new drugs related to Brevinin-2ISb and other AMPs. Using C. elegans as an in vivo model, this work supports a beneficial effect of Brevinin-2ISb in host immune modulation. Future studies will be required to explore the mechanism(s) of immune modulation involved (how DAF-2/DAF-16 is activated) in more detail, as well as to better optimize the yields and costs involved in the synthetic production of Brevinin-2ISb–related peptides.

Taken together, our results showed the impact of Brevinin-2ISb on major immune-related pathways in a number of mutant C. elegans lines. Antimicrobial peptide Brevinin-2ISb effectively inhibits MRSA at low concentration. This antimicrobial peptide can prolong the life of MRSA-infected C. elegans, has very low hemolytic activity and inhibits the activity and expression of various MRSA virulence factors. More importantly, Brevinin-2ISb activated the expression of antimicrobial genes downstream of DAF-2/DAF-16, which enhanced the MRSA resistance of C. elegans. This peptide could be used as the basis for developing new drugs to replace antibiotics.

Although how Brevinin-2ISb enters MRSA to inhibit its virulence factor activity, and how to complete the activation of DAF-2/DAF-16 pathway in nematode, has not yet been studied. The molecular mechanism of Brevinin-2ISb in therapeutic effect will be carried out in the future, which will lay a good foundation for the development of new drugs for Brevinin-2ISb in the future.

Acknowledgments

We are grateful to Professor Dr. Z Li, and Y Sun Research group in Shaanxi Normal University, China for kindly providing the technical support and nematodes.

Author contributions

HX, XN, QZ, DC, and XC participated in experimental studies. XC, DC, HX, XN, and QZ served as guarantors. HX participated in study concept and design, definition of intellectual content. HX and YZ participated in literature search, experiment performance. HX, XN, QZ and DC participated in data acquisition and analysis, statistical analysis. HX, YZ and XC participated in manuscript preparation, editing and review, and approved the final version of the manuscript.

Financial support

This work was supported in part by the National Key R&D Program of China (No. 2018YFC0910600), the National Natural Science Foundation of China (Nos. 62007026, 81627807, 11727813, 81871397, 81701853, and 91859109), the Fok Ying-Tong Education Foundation of China (No. 161104), the Program for the Young Top-notch Talent of Shaanxi Province, the Research Fund for Young Star of Science and Technology in Shaanxi Province of China (No. 2018KJXX-018), the Science and Technology Projects of Xi’an, China (No. 201809170CX11JC12), and the Natural Science Basic Research Plan in Shaanxi Province of China (No. 2019JQ-201).

Institutional review board statement

All animal study procedures were approved and monitored by the Academic Committee at Xidian University and Xi’an Jiaotong University Animal Care and Use Committee, China (approval No. JGC201207) on July 15, 2017.

Conflicts of interest

The authors declare that they have no conflicts of interest.

References

[1]. Zhang W, Zhuo SQ, He L, et al. Daphnetin prevents methicillin-resistant Staphylococcus aureus infection by inducing autophagic response. Int Immunopharmacol 2019;72:195–203.
[2]. Liu W, Li JH, Cheng MQ, et al. A surface-engineered polyetheretherketone biomaterial implant with direct and immunoregulatory antibacterial activity against methicillin-resistant Staphylococcus. Biomaterials 2019;208:8–20.
[3]. Ersoy SC, Abdelhady W, Li L, et al. Bicarbonate resensitization of methicillin-resistant Staphylococcus aureus to beta-lactam antibiotics. Antimicrob Agents Chemother 2019;63:e00496–e00519.
[4]. Tatiya-Aphiradee N, Chatuphonprasert W, Jarukamjorn K. Anti-inflammatory effect of Garcinia mangostana Linn. pericarp extract in methicillin-resistant Staphylococcus aureus-induced superficial skin infection in mice. Biomed Pharmacother 2019;111:705–713.
[5]. Yuan G, Xu L, Xu X, et al. Azalomycin F5a, a polyhydroxy macrolide binding to the polar head of phospholipid and targeting to lipoteichoic acid to kill methicillin-resistant Staphylococcus aureus. Biomed Pharmacother 2019;109:1940–1950.
[6]. Mellbye B, Schuster M. The sociomicrobiology of antivirulence drug resistance: a proof of concept. Mbio 2011;2:e00131–e211.
[7]. Zeng Q, Xie H, Song H, et al. In vivo wound healing activity of abrus cantoniensis extract. Evid Based Complement Alternat Med 2016;2016:6568528.
[8]. Niwa T, Watanabe T, Goto T, et al. Daily review of antimicrobial use facilitates the early optimization of antimicrobial therapy and improves clinical outcomes of patients with bloodstream infections. Biol Pharm Bull 2016;39:721–727.
[9]. Kim Y, Choi J. Early life exposure of a biocide, CMIT/MIT causes metabolic toxicity via the O-GlcNAc transferase pathway in the nematode C. elegans. Toxicol Applied Pharmacol 2019;376:1–8.
[10]. Ruszkiewicz JA, Pinkas A, Miah MR, et al. C-elegans as a model in developmental neurotoxicology. Toxicol Applied Pharmacol 2018;354:126–135.
[11]. Lucanic M, Garrett T, Gill MS, et al. A simple method for high throughput chemical screening in caenorhabditis elegans. J Vis Exp 2018;56892.
[12]. Matsunami K. Frailty and Caenorhabditis elegans as a Benchtop Animal Model for Screening Drugs Including Natural Herbs. Front Nutr 2018;5:111.
[13]. Tsuda Y, Yamanaka K, Toyoshima R, et al. Development of transgenic Caenorhabditis elegans expressing human transthyretin as a model for drug screening. Sci Rep 2018;8:17884.
[14]. Hernandez SL, Nelson M, Sampedro GR, et al. Staphylococcus aureus alpha toxin activates Notch in vascular cells. Angiogenesis 2019;22:197–209.
[15]. Jeannoel M, Casalegno JS, Ottmann M, et al. Synergistic effects of influenza and Staphylococcus aureus toxins on inflammation activation and cytotoxicity in human monocytic cell lines. Toxins (Basel) 2018;10:286.
[16]. Wen W, Liu BH, Xue L, et al. Autoregulation and virulence control by the toxin-antitoxin system SavRS in Staphylococcus aureus. Infect Immun 2018;86:e00032–e00018.
[17]. Kodama Y, Ishikawa T, Shimoyama Y, et al. The fibronectin-binding protein homologue Fbp62 of Streptococcus anginosus is a potent virulence factor. Microbiol Immunol 2018;62:624–634.
[18]. Tarahomjoo S, Ghaderi S. In Silico design of a novel serotype independent vaccine against Streptococcus pneumoniae based on B-cell epitope regions of fibronectin binding protein, choline binding protein D, and D-alanyl-D-alanine Carboxypeptidase. Letters Drug Design Discovery 2019;16:372–381.
[19]. Zhang R, Li S, Zhang XK, et al. Mechanisms of fibronectin-binding protein A (FnBPA(110-263)) vaccine efficacy in Staphylococcus aureus sepsis versus skin infection. Clin Immunol 2018;194:1–8.
[20]. Shore AC, Rossney AS, Brennan OM, et al. Characterization of a novel Arginine Catabolic Mobile Element (ACME) and staphylococcal chromosomal cassette mec composite island with significant homology to Staphylococcus epidermidis ACME type II in methicillin-resistant Staphylococcus aureus genotype ST22-MRSA-IV. Antimicrob Agents Chemother 2011;55:1896–1905.
[21]. Yang K, Ma C, Zhou M, et al. Identification and bioactivity evaluation of a novel bradykinin inhibitory peptide from the skin secretion of Chinese large odorous frog, Odorrana livida. J Pept Sci 2016;22:181–185.
[22]. Liu HK, Hung TM, Huang HC, et al. Bai-Hu-Jia-Ren-Shen-Tang decoction reduces fatty liver by activating AMP-activated protein kinase in vitro and in vivo. Evid Based Complement Alternat Med 2015;2015:651734.
[23]. Sun Y, Li Q, Li Z, et al. Molecular cloning, expression, purification, and functional characterization of Palustrin-2CE, an antimicrobial peptide of Rana chensinensis. Biosci Biotechnol Biochem 2012;76:157–162.
[24]. Morikawa N, Hagiwara K, Nakajima T. Brevinin-1 and -2, unique antimicrobial peptides from the skin of the frog, Rana brevipoda porsa. Biochem Biophys Res Commun 1992;189:184–190.
[25]. Conlon JM, Power GJ, Abdel-Wahab YH, et al. A potent, non-toxic insulin-releasing peptide isolated from an extract of the skin of the Asian frog, Hylarana guntheri (Anura:Ranidae). Regul Pept 2008;151:153–159.
[26]. Grazia Di A, Cappiello F, Imanishi A, et al. The frog skin-derived antimicrobial peptide Esculentin-1a(1-21)NH2 promotes the migration of human HaCaT keratinocytes in an EGF receptor-dependent manner: a novel promoter of human skin wound healing. PLoS One 2015;10:e0128663.
[27]. van der Meijden B, Robinson JA. Synthesis of a polymyxin derivative for photolabeling studies in the gram-negative bacterium Escherichia coli. J Pept Sci 2015;21:231–235.
[28]. Zhao J, Sun Y, Li Z, et al. Molecular cloning of novel antimicrobial peptide genes from the skin of the Chinese brown frog, Rana chensinensis. Zoolog Sci 2011;28:112–117.
[29]. Oddo A, Thomsen TT, Britt HM, et al. Modulation of backbone flexibility for effective dissociation of antibacterial and hemolytic activity in cyclic peptides. Acs Medicinal Chemistry Letters 2016;7:741–745.
[30]. Maturana P, Martinez M, Noguera ME, et al. Lipid selectivity in novel antimicrobial peptides: Implication on antimicrobial and hemolytic activity. Colloids Surf B Biointerfaces 2017;153:152–159.
[31]. Oddo A, Hansen PR. Hemolytic activity of antimicrobial peptides. Methods Mol Biol 2017;1548:427–435.
[32]. Xie H, Zhan YH, Chen XL, et al. Brevinin-2 drug family new applied peptide candidates against methicillin-resistant Staphylococcus aureus and their effects on Lys-7 expression of innate immune pathway DAF-2/DAF-16 in Caenorhabditis elegans. Appl Sci 2018;8:2627.
[33]. Zhi LT, Yu YL, Li XY, et al. Molecular control of innate immune response to Pseudomonas aeruginosa infection by intestinal let-7 in Caenorhabditis elegans. Plos Pathog 2017;13:e1006152.
[34]. Xiao Y, Liu F, Zhao PJ, et al. PKA/KIN-1 mediates innate immune responses to bacterial pathogens in Caenorhabditis elegans. Innate Immun 2017;23:656–666.
[35]. Cheesman HK, Feinbaum RL, Thekkiniath J, et al. Aberrant activation of p38 MAP kinase-dependent innate immune responses is toxic to Caenorhabditis elegans. G3 (Bethesda) 2016;6:541–549.
[36]. Bolz DD, Tenor JL, Aballay A. A conserved PMK-1/p38 MAPK is required in Caenorhabditis elegans tissue-specific immune response to Yersinia pestis infection. J Biol Chem 2010;285:10832–10840.
[37]. Gravato-Nobre MJ, Hodgkin J. Caenorhabditis elegans as a model for innate immunity to pathogens. Cell Microbiol 2005;7:741–751.
[38]. Estes KA, Dunbar TL, Powell JR, et al. bZIP transcription factor zip-2 mediates an early response to Pseudomonas aeruginosa infection in Caenorhabditis elegans. Proc Natl Acad Sci U S A 2010;107:2153–2158.
[39]. Liu J, Hafting J, Critchley AT, et al. Components of the cultivated red seaweed Chondrus crispus enhance the immune response of Caenorhabditis elegans to Pseudomonas aeruginosa through the pmk-1, daf-2/daf-16, and skn-1 pathways. Appl Environ Microbiol 2013;79:7343–7350.
[40]. Mi XN, Wang LF, Hu Y, et al. Methyl 3,4-dihydroxybenzoate enhances resistance to oxidative stressors and lifespan in C. elegans partially via daf-2/daf-16. Int J Mol Sci 2018;19:1670.
[41]. Diaz SA, Restif O. Spread and transmission of bacterial pathogens in experimental populations of the nematode Caenorhabditis elegans. Appl Environ Microbiol 2014;80:5411–5418.
[42]. Palominos MF, Verdugo L, Gabaldon C, et al. Transgenerational diapause as an avoidance strategy against bacterial pathogens in Caenorhabditis elegans. MBio 2017;8: e01234-17.
[43]. Mendelski MN, Keshet A, Hoffschroer N, et al. ROS-mediated relationships between metabolism and DAF-16 subcellular localization in Caenorhabditis elegans revealed by a novel fluorometric method. Cell Signal 2019;62:109330.
[44]. Wang D, Hou L, Nakamura S, et al. LIN-28 balances longevity and germline stem cell number in Caenorhabditis elegans through let-7/AKT/DAF-16 axis. Aging Cell 2017;16:113–124.
[45]. Wang H, Webster P, Chen L, et al. Cell-autonomous and non-autonomous roles of daf-16 in muscle function and mitochondrial capacity in aging C. elegans. Aging (Albany NY) 2019;11:2295–2311.
[46]. Beaudoin-Chabot C, Wang L, Smarun AV, et al. Deuterated polyunsaturated fatty acids reduce oxidative stress and extend the lifespan of C. elegans. Front Physiol 2019;10:641.
[47]. Kumar S, Egan BM, Kocsisova, et al. Lifespan extension in C. elegans caused by bacterial colonization of the intestine and subsequent activation of an innate immune response. Dev Cell 2019;49:100–117.
[48]. Kurz CL, Tan MW. Regulation of aging and innate immunity in C. elegans. Aging Cell 2004;3:185–193.
[49]. Mohamed MS, Maki T, Shah MM, et al. Synthesis and antimicrobial activity of nitrobenzyl-oxy-phenol derivatives. Biol Pharm Bull 2016;39:1888–1892.
[50]. Tabara H, Hill RJ, Mello CC, et al. pos-1 encodes a cytoplasmic zinc-finger protein essential for germline specification in C-elegans. Development 1999;126:1–11.
[51]. Kandasamy S, Khan W, Evans F, et al. Tasco(R): a product of Ascophyllum nodosum enhances immune response of Caenorhabditis elegans against Pseudomonas aeruginosa infection. Mar Drugs 2012;10:84–105.
[52]. Troemel ER, Chu SW, Reinke V, et al. p38 MAPK regulates expression of immune response genes and contributes to longevity in C. elegans. PLoS Genet 2006;2:e183.
[53]. JebaMercy G, Pandian SK, Balamurugan K. Changes in Caenorhabditis elegans life span and selective innate immune genes during Staphylococcus aureus infection. Folia Microbiol (Praha) 2011;56:373–380.
[54]. Netsvyetayeva I, Fraczek M, Piskorska K, et al. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes. BMC Infect Dis 2014;14:128.
[55]. Tharmalingam N, Rajmuthiah R, Kim W, et al. Antibacterial properties of four novel hit compounds from a methicillin-resistant Staphylococcus aureus-Caenorhabditis elegans high-throughput screen. Microb Drug Resist 2018;24:666–674.
[56]. Wu Q, Ploegh HL, Truttmann MC. Hepta-Mutant Staphylococcus aureus Sortase a (SrtA7m) as a tool for in vivo protein labeling in Caenorhabditis elegans. ACS Chem Biol 2017;12:664–673.
[57]. Thompson TA, Brown PD. Association between the agr locus and the presence of virulence genes and pathogenesis in Staphylococcus aureus using a Caenorhabditis elegans model. Int J Infect Dis 2017;54:72–76.
[58]. Pidgeon SE, Pires MM. Cell wall remodeling of Staphylococcus aureus in live Caenorhabditis elegans. Bioconjug Chem 2017;28:2310–2315.
[59]. Ngba Essebe C, Visvikis O, Fines-Guyo Mn, et al. Decrease of Staphylococcus aureus virulence by Helcococcus kunzii in a Caenorhabditis elegans model. Front Cell Infect Microbiol 2017;7:77.
[60]. Mallo GV, Kurz CL, Couillault C, et al. Inducible antibacterial defense system in C. elegans. Curr Biol 2002;12:1209–1214.
[61]. O’Rourke D, Baban D, Demidova M, et al. Genomic clusters, putative pathogen recognition molecules, and antimicrobial genes are induced by infection of C. elegans with M. nematophilum. Genome Res 2006;16:1005–1016.
[62]. Evans EA, Chen WC, Tan MW. The DAF-2 insulin-like signaling pathway independently regulates aging and immunity in C. elegans. Aging Cell 2008;7:879–893.
[63]. Wolkow CA, Munoz MJ, Riddle DL, et al. Insulin receptor substrate and p55 orthologous adaptor proteins function in the Caenorhabditis elegans daf-2/insulin-like signaling pathway. J Biol Chem 2002;277:49591–49597.
[64]. Abbas S, Wink M. Epigallocatechin gallate inhibits beta amyloid oligomerization in Caenorhabditis elegans and affects the daf-2/insulin-like signaling pathway. Phytomedicine 2010;17:902–909.
[65]. Evans EA, Kawli T, Tan MW. Pseudomonas aeruginosa suppresses host immunity by activating the DAF-2 insulin-like signaling pathway in Caenorhabditis elegans. PLoS Pathog 2008;4:e1000175.
[66]. Lee RY, Hench J, Ruvkun G. Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol 2001;11:1950–1957.
[67]. Kim D. Studying host-pathogen interactions and innate immunity in Caenorhabditis elegans. Dis Model Mech 2008;1:205–208.
[68]. Alegado RA, Campbell MC, Chen WC, et al. Characterization of mediators of microbial virulence and innate immunity using the Caenorhabditis elegans host-pathogen model. Cell Microbiol 2003;5:435–444.
[69]. Reddy KC, Dror T, Underwood RS, et al. Antagonistic paralogs control a switch between growth and pathogen resistance in C. elegans. PLoS Pathog 2019;15:e1007528.
[70]. Sorathia N, Rajadhyaksha MS. Caenorhabditis elegans: a model for studying human pathogen biology. Recent Pat Biotechnol 2016;10:217–225.
[71]. Luallen RJ, Reinke AW, Tong L, et al. Discovery of a natural microsporidian pathogen with a broad tissue tropism in Caenorhabditis elegans. PLoS Pathog 2016;12:e1005724.
[72]. Bandyopadhyay S, Ng BY, Chong C, et al. Micelle bound structure and DNA interaction of brevinin-2-related peptide, an antimicrobial peptide derived from frog skin. J Pept Sci 2014;20:811–821.
[73]. Conlon JM, Kolodziejek J, Mechkarska M, et al. Host defense peptides from Lithobates forreri, Hylarana luctuosa, and Hylarana signata (Ranidae): phylogenetic relationships inferred from primary structures of ranatuerin-2 and brevinin-2 peptides. Comp Biochem Physiol Part D Genomics Proteomics 2014;9:49–57.
[74]. Abdel-Wahab YH, Patterson S, Flatt PR, et al. Brevinin-2-related peptide and its [D4K] analogue stimulate insulin release in vitro and improve glucose tolerance in mice fed a high fat diet. Horm Metab Res 2010;42:652–656.
Keywords:

brevinin-2ISb; caenorhabditis elegans; DAF-2/DAF-16; innate immune response; MRSA

Supplemental Digital Content

Copyright © 2020 The Chinese Medical Association, Published by Wolters Kluwer Health, Inc. under the CCBY-NC-ND license.