Angiotensin-converting enzyme 2 (ACE2 ) has been primarily studied for its properties as a monocarboxy-peptidase that efficiently cleaves Angiotensin (Ang) II to form Ang 1–7.1 , 2 ACE2 also cleaves several substrates of interest in cardiovascular and kidney disease, such as apelins 13 and 36 and des 9 Arg bradykinin.2 3 4 5 6 7 8 9 10 11 12 13 14–15 ACE2 is the main receptor for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2 ).16 17 18 19–20 SARS-CoV-2 S spike to membrane-bound full-length angiotensin-converting enzyme 2 (FL-ACE2 ), there is priming by a protease TMPRSS2 that is needed for the fusion and internalization of the ACE2 -viral spike complex.16 21 22 ACE2 protein acting as a decoy to bind to SARS-CoV-2 should limit viral uptake mediated by membrane-bound FL-ACE2 . Consequently, SARS-CoV-2 entry into the cells and viral replication should be prevented. In addition, further therapeutic benefit should result from restoring decreased ACE2 activity and therefore, correct the altered balance of Ang II and bradykinins as reviewed in ref. 21 ACE2 protein are both important and need to be examined experimentally by approaches that cannot be easily applied in human research. The promise of soluble ACE2 therapy is illustrated by a recent case report of a patient with coronavirus disease 2019 (COVID-19 ) who appeared to respond favorably to the administration of soluble ACE2 therapy given for compassionate use.23
We have recently generated short recombinant mouse ACE2 variants that exhibit full ACE2 activity.15 ACE2 variant that has 618 amino acids. This ACE2 variant moreover was fused with the albumin binding domain (ABD) as a strategy to increase its duration of action. We reasoned that when administered in vivo , the feature of enhanced duration of action should provide a more favorable profile in terms of intercepting the SARS-CoV-2 than the native soluble protein that has a short half-life of only a few hours.9 , 24
To test whether our novel soluble ACE2 proteins can reduce SARS-CoV-2 –mediated infectivity, we use human kidney organoids as a convenient model; studies in rodents are limited by the resistance to SARS-CoV-2 infectivity because the ACE2 of rodents lacks the receptor binding domain (RBD) for the S spike of SARS-CoV-2 ,25 ACE2 .16 17 18 19–20 in vivo studies in animals, human organoids provide a convenient model to study certain aspects of kidney injury, including inherited kidney diseases, development disorders, and nephrotoxicity.26 27–28 organoids were used to demonstrate the neutralizing effect of native soluble ACE2 1–740 on SARS-CoV-2 infectivity.22 organoids to demonstrate the efficacy of our novel ACE2 variants in neutralizing SARS-CoV-2 infectivity.
Methods
Generation of Human ACE2 1–618 and a Fused Chimera with an ABD Tag
A C-terminally truncated recombinant human ACE2 protein of 618 amino acids that we termed ACE2 1–618 was generated using an approach similar to that used previously by us to generate a short mouse rACE2 variant 1–61915 Supplemental Material ACE2 variant was found to be as enzymatically active as the longest soluble intact mouse rACE2 1–740.15 ACE2 1–618 was then fused with a small (5-kD) ABD in order to prolong in vivo duration of action (as described in more detail in Supplemental Material ABDCon cDNA (IDT). The cDNA of the G4S3-ABDCon construct was fused to the C terminus of ACE2 1–618human ACE2 1–618-ABD ). The cDNA of the fusion chimera ACE2 1–618-ABDACE2 1–618-ABDACE2 1–618 and ACE2 1–618-ABD) were expressed in human kidney embryonic cell line HEK-293 and purified using Fast Protein Liquid Chromatography on Q-Sepharose followed by size exclusion chromatography on Superdex 200 pg to >90% purity.
Enzyme Activities and Kinetic Constants of Purified Short Recombinant ACE2 Variants
The ability of the two purified short human recombinant ACE2 variants to cleave two natural substrates of ACE2 was examined. ACE2 cleaves Ang II-(1–8), to form Ang-(1–7), as well as des 9 Arg bradykinin [bradykinin-(1–8)] to form bradykinin-(1–7).5 ACE2 is known to remove the C-terminal amino acid phenylalanine from the cleavage reaction with either substrate.5 ACE2 substrates29 ACE2 variants as compared with equivalent molar amounts of the standard ACE2 1–740, which was used as a benchmark. For assessment of activity levels, the Michaelis–Menten model was used to derive the parameters of catalytic kinetics, such as K m and K cat .29 , 30
Plasma ACE2 Activity
The pharmacokinetic profiles of human ACE2 1–618-ABD were assessed in wild-type mice as compared with those of naked human ACE2 1–618 and the native ACE2 1–740. The mice received a single intraperitoneal injection of each purified rACE2 variant at a dose of 1 μ g/g body wt. Blood samples were collected by tail bleeding either before or at several indicated time points after injection. Blood samples were collected in heparinized capillaries, and plasma was isolated by centrifugation at 1850×g for 10 minutes at 4°C. Mca-APK(Dnp) substrate (Bachem, Bubendorf, Switzerland) was used to measure ACE2 enzyme activity in plasma. The pharmacokinetic parameters on the basis of plasma ACE2 activity measurements were calculated30
BP Response to Ang II–Induced Hypertension
To demonstrate the biologic enzymatic activity in vivo of our ACE2 1–618 variants and the benchmark ACE2 1–740, we used a model of Ang II–induced hypertension.9 , 15 ACE2 proteins on acute Ang II–induced hypertension were examined as previously described by us.9 , 15 , 31 ACE2 1–618, ACE2 1–618-ABD, or ACE2 1–740 (all at 1 mg/kg body wt). After 1 hour, 3 days, or 7 days, mice were anesthetized with an intraperitoneal injection of ketamine (150 mg/kg body wt) and then placed on a temperature-controlled platform immediately. Systolic BP (SBP) was monitored noninvasively every 30 seconds for a period of 20 minutes, including 5 minutes of baseline SBP recording, after which acute hypertension was induced with an intraperitoneal bolus injection of Ang II (0.2 mg/kg body wt).
Generation of Human Kidney Organoids and Culture Conditions
Human kidney organoids were generated using a previously published protocol,26 4 cells per cm2 in mTeSR1 medium (STEMCELL Technologies) on a geltrex-coated (ThermoFisher Scientific) six-well plate. After cells became approximately 50% confluent, differentiation was started with the treatment of 8 μ M CHIR99021(Reprocell) in the basic differentiation medium (advanced RPMI 1640 containing 1× l -glutamine supplement). On day 4, medium was replaced with basic differentiation medium supplemented with 10 ng/ml Activin A, and on day 7, medium was replaced with basic differentiation medium supplemented with 10 ng/ml FGF9. On day 9, differentiated kidney progenitors form renal vesicle–like clusters and were fed with the basic differentiation medium supplemented with 10 ng/ml FGF9 and 1 μ M CHIR99021. On day 11, the medium was changed to the basic differentiation medium containing 10 ng/ml FGF9. From day 14, the cells were fed with the basic differentiation medium every 2–3 days until harvest on day 21. On day 21, some organoids were transferred to a six-well plate or collected for isolation of cellular fractions. Several days later, using sterile tips, organoids from the six-well plate were plated onto a sterile 96-well plate with fresh medium (five organoids per well) for subsequent tissue infectivity experiments.
Another set of human kidney organoids was generated from H9 cells as previously described32 4 cells per centimeter2 in StemFit (ams-bio) on a geltrex-coated six-well plate (Supplemental Material ACE2 (AF933; R&D Systems) and anti-TMPRSS2 antibodies (NBP-2 38263; Novus) to localize expression of ACE2 and TMPRSS2.
In Vitro Assay for Detection of hACE2-RBD InteractionUsing an artificial ACE2 substrate Mca-APK-Dnp (10 µ M), ACE2 activity of ACE2 1–740 was not affected by the presence of recombinant glycosylated RBD in a 0.001- to 100-ng/ml concentration range. On the basis of this finding, we developed a method that measures interaction between viral S1 RBD and human ACE2 using as a readout ACE2 activity. Purified His-tagged RBD protein was dissolved in Tris-buffered saline (TBS; pH 7.4) and loaded into 96-well Ni-coated black plate for binding. TBS alone was loaded to blank wells. After incubation for 1 hour at room temperature, five washes were done. One hundred milliliters of human ACE2 1–740 (positive control) and mouse ACE2 (negative control) were added to the wells and incubated for 1 hour at room temperature at concentrations ranging from 1000 to 6.25 ng/ml. Afterward, wells were washed five times. Finally, Mca-APK-Dnp substrate (1 µ M final concentration) was added, and fluorescence formation was measured in a microplate fluorescence reader (a detailed description is in Supplemental Material ACE2 protein to the RBD-His protein immobilized onto the Ni-coated microplate was confirmed by concentration-dependent increase in fluorescence formation (expressed in relative fluorescence unit) from the cleavage of the Mca-APK-Dnp ACE2 substrate.
We then used lysates of isolated cytosol, nuclear, or membrane fractions from human kidney organoids to assess binding of hACE2 from those isolated fractions to the RBD domain of SARS-CoV-2 S1 protein. Purified His-tagged RBD protein was dissolved in TBS and loaded into 96-well Ni-coated black plates (100 μ l per well) for binding for 1 hour. After five washes, the organoid tissue lysate samples (10 µ l) were diluted in 90 µ l TBS, loaded onto the plate, and left for 1 hour at room temperature. Afterward, wells were washed five times before Mca-APK-Dnp substrate (1 µ M final concentration) was added, and fluorescence formation was measured in a microplate fluorescence reader (a detailed description is in Supplemental Material ACE2 protein by reference to a standard curve of recombinant ACE2 (R&D Systems) assayed under the same conditions.
SARS-CoV-2 Neutralization AssayUnder Biosafety Level 3 conditions, 0 and 200 µ M indicated ACE2 proteins (mouse ACE2 1–740, human ACE2 1–740, human ACE2 1–618, and human ACE2 1–618-ABD) in PBS were mixed with 400 PFU of SARS-CoV-2 (nCoV/Wasington1/2020; provided by the Bational Biocontainment Laboratory, Galveston, TX) in DMEM for 1 hour at 37°C and then used to infect kidney organoid cells for 3 days. Advanced RPMI medium without ACE2 was used as the not treated reference. Cells were washed and lysed in RNA extraction buffer and purified using a NucleoSpin 96 RNA kit following the manufacturer’s instructions (Macherey-Nagel). SARS-CoV-2 RNA was quantified by qRT-PCR using the SuperScript III Platinum One-Step qRT-PCR Kit with ROX (ThermoFisher Scientific) and normalized using Eukaryotic 18S rRNA Endogenous Control (VIC/MGB probe; 29Applied Biosystems) via a StepOnePlus real-time PCR system (Applied Biosystems). All reactions were performed in a dual-plex qRT-PCR using the Centers for Disease Control and Prevention recommended primers for N1. Primer and probe sequences are as follows: 2019-nCoV_N1 Forward Primer (2019-nCoV_N1-F), GACCCCAAAATCAGCGAAAT; 2019-nCoV_N1 Reverse Primer (2019-nCoV_N1-R), TCTGGTTACTGCCAGTTGAATCTG; Probe (2019-nCoV_N1-P), FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1.
Results
Catalytic Efficiency of Human ACE2 1–618 and ACE2 1–618-ABD as Determined by Phenylalanine Assay
Information is in Supplemental Material
Prolonged In Vivo Activity of Human ACE2 Variant 1–618-ABD
The peak plasma ACE2 activity for the naked ACE2 1–618 and the native ACE2 1–740 was between 2 and 4 hours (Figure 1 ). The ACE2 1–618-ABD variant resulted in a higher peak plasma ACE2 activity as compared with the naked ACE2 1–618 and the native ACE2 1–740. Whereas the activity of the naked ACE2 1–618 and ACE2 1–740 had decreased markedly by 8 hours, the ACE2 1–618-ABD resulted in persistent activity at 72 and 96 hours (Figure 1 ). The t 1/2 of the ACE2 proteins is in Supplemental Material
Figure 1.: Pharmacokinetics of soluble human recombinant ACE2 variants in vivo after intraperitoneal injection. Mice were injected intraperitoneally with ACE2 1–618-ABD (red), the naked ACE2 1–618 (green), or the native ACE2 1–740 (blue). Plasma ACE2 activity was measured at various time points, starting 1 hour postinjection. The ACE2 1–618-ABD variant resulted in higher-peak plasma ACE2 activity as compared with the naked ACE2 1–618 and the native ACE2 1–740. Whereas the activity of the naked ACE2 1–618 and ACE2 1–740 had decreased markedly by 8 hours, the ACE2 1–618-ABD resulted in persistent activity at 72 and 96 hours, therefore demonstrating a marked extension of in vivo t 1/2 of ACE2 1–618 achieved by adding the ABD tag. RFU, relative fluorescence unit.
BP-Lowering Effect of Human ACE2 1–618 and ACE2 1–618-ABD during Acute Ang II Infusion
SBP was monitored noninvasively every 30 seconds for a period of 20 minutes. This approach is suitable for acute studies, whereas for chronic studies, radiotelemetry is the preferred approach. In one set of experiments, mice were pretreated with vehicle (PBS), ACE2 1–740, ACE2 1–618, or ACE2 1–618-ABD by a single intraperitoneal injection (at 1 mg/kg body wt) 1 hour before receiving a bolus injection of Ang II (0.2 mg/kg body wt). The injection of Ang II 1 hour later resulted in a rapid increase in BP in the control group that had received PBS as preinjection vehicle, followed by its decline. In contrast, the increase in BP was markedly blunted and normalized to about the same extent by the three proteins (Figure 2, A–C ).
Figure 2.: BP-lowering effect of human ACE2 proteins in Ang II–induced hypertension in mice. In (A–C), the ACE2 proteins were given intraperitoneally 1 hour prior to Ang II injection. The increase in SBP was blunted and the recovery was enhanced by (A) ACE2 1–740 (blue, n =6; P =0.002), (B) ACE2 1–618 (green, n =5; P =0.01), and (C) ACE2 1–618-ABD (red, n =5; P =0.007). Each protein was examined with a group of separate controls (n =6 for [A] and n =4 for [B and C] each). In (D–F), the ACE2 proteins were given intraperitoneally 3 days prior to Ang II injection. (D) Both the naked ACE2 1–618 (green, n =5) and the ACE2 1–740 (blue, n =5) were no longer effective in normalizing the SBP after Ang II injection as compared with controls (n =4). (E) In contrast, ACE2 1–618-ABD (red, n =4) significantly attenuated Ang II–induced hypertension as compared with controls (n =9; P =0.008). In (F), ACE2 1–618-ABD protein (red, n =5) was given intraperitoneally 7 days prior to Ang II injection and was no longer effective in lowering the SBP after Ang II injection like the controls that received PBS (n =9).
To examine their duration of action, the same injection protocol was used except that Ang II was injected 3 days after injection of ACE2 1–740, naked ACE2 1–618, and ACE2 1–618-ABD. Three days after their injection, neither ACE2 1–740 nor the naked ACE2 –618 were effective in normalizing the BP after Ang II injection (Figure 2D ). By contrast, ACE2 1–618-ABD, when given 3 days prior to Ang II injection, still had a significant attenuation of BP (Figure 2E ). When ACE2 1–618-ABD was given 7 days prior to Ang II injection, however, the response was no longer different from the PBS-treated control (Figure 2F ).
Human Kidney Organoids Express ACE2 , Which Can Bind to the RBD Domain of the SARS-CoV-2 S Spike
The kidney organoids were generated as described in Methods.26 , 32 Figure 3A ). Lotus Tetragonolobus Lectin staining confirmed that kidney organoids were filled with proximal tubules (Figure 3B ). We then examined the presence of ACE2 and TMPRSS2, a protease needed for SARS-CoV-2 S spike and ACE2 activation.16 ACE2 was expressed in tubular-like structures mainly in what appears to represent the apical membrane (Figure 3D ). Staining for the protease TMPRSS2 was also present in these structures, and moreover, there was colocalization with ACE2 staining (Figure 3D ).
Figure 3.: Human kidney organoids express ACE2 , which can bind to the RBD domain of the SARS-CoV-2 S2 spike protein. Kidney organoids were generated from asynchronous mixing of two differentiating human embryonic stem cell–derived kidney progenitors at the air-liquid interface. (A) Representative photomicrograph of kidney organoid showing tightly packed tubular clusters on day 18, and (B) Lotus Tetragonolobus Lectin (LTL) staining showing that kidney organoids were filled with proximal tubules. (C) In silico pull-down assay showing binding of ACE2 to the RBD domain of SARS-CoV-2 S1 spike protein. ACE2 from cytosol, nuclear, or membrane fractions of kidney organoids (n =3 per group). (D) Immunofluorescence staining showing high expression of ACE2 and TMPRSS2 in the proximal tubules of kidney organoids and areas of colocalization in the apparent apical membrane.
Human kidney organoids were used to isolate cytosolic, nuclear, and membrane fractions for subsequent evaluation of ACE2 activity. Consistent with immunostaining, in the membrane fraction ACE2 activity was clearly detectable (0.55±0.18 ng Eq rACE2 per microgram of total protein, n =3). ACE2 activity was also found in the nuclear fraction, but none could be detected in the cytosolic fraction (not shown).
To establish whether ACE2 from kidney organoids is capable of binding the RBD of the SARS-CoV-2 S1 spike protein, the same isolated cell fractions were tested in an in vitro pull-down assay capable of detecting human ACE2 -RBD interaction (see Methods). The interaction of the SARS-CoV-2 S1 spike protein and ACE2 was found to take place mainly in the membrane fraction of the kidney organoids . This shows that the ACE2 that is present in the human kidney organoids plasma membrane can bind the SARS-CoV-2 S1 spike protein (Figure 3C ). Negligible ACE2 -RBD interaction was measured in the nuclear fraction and in the cytosolic fraction, consistent with low ACE2 activity measured in these fractions.
Neutralization of SARS-CoV-2 in Kidney Organoids Exposed to Soluble ACE2 Proteins
Naked and ABD-tagged human ACE2 1–618 were used at a concentration that was previously found effective in maximally neutralizing SARS-CoV-2 (200 µ g/ml) by soluble native human ACE2 1–740.22 ACE2 1–740 was used as a positive control, and mouse ACE2 1–740 (lack of binding to SARS-CoV-2 S1 spike) was used as negative control at the same concentration. The ACE2 proteins were mixed with SARS-CoV-2 particles (MOI 0.02 for 30 minutes at 37°C) in an advanced RPMI medium.
Kidney organoids were then infected for 1 hour at 37°C and washed with PBS, and a new medium was added. On the third day after infection, levels of viral RNA were assessed by qRT-PCR. As expected, mouse ACE2 1–740 did not prevent viral infectivity, as shown by similar high viral mRNA levels as in the untreated group (Figure 4 ). By contrast, both naked and ABD-tagged ACE2 1–618 markedly reduced viral replication to the same extent as human ACE2 1–740 used as positive control (Figure 4 ).
Figure 4.: Effect of recombinant soluble ACE2 proteins on SARS-CoV-2 infection of human kidney organoids . Kidney organoids were infected with a combination of infectious viral particles (400 PFU) and soluble mouse (m) or human (h) ACE2 proteins (n =3 per each group) for 1 hour. Three days postinfection, levels of viral RNA were assessed by qRT-PCR. All three human ACE2 variants markedly reduced RNA levels of SARS-CoV-2 , whereas the mouse ACE2 1–740 counterpart did not. Single data points and means are shown for each group.
Discussion
Here, we report the generation of a shorter truncate of human soluble ACE2 with 618 amino acids and its fusion with ABD to extend its duration of action. Both forms are as active as the native human soluble ACE2 (740 amino acids) as demonstrated by their catalytic efficiency and biologic activity. The latter was demonstrated by the pharmacokinetic profile of plasma ACE2 activity (Figure 1 ) and by the response of BP to infused Ang II (Figure 2 ). In this model of acute Ang II–induced hypertension, the BP-lowering effect was sustained for 3 days with the fused ACE2 1–618-ABD chimera, consistent with the enzymatic activity in plasma shown in the pharmacokinetic analysis. We then went on to demonstrate that the novel ACE2 1–618-ABD variant was capable to neutralize SARS-CoV-2 infectivity in human kidney organoids . This approach was recently used by Monteil et al. 22 ACE2 protein (ACE2 1–740) can neutralize SARS-CoV-2 infection in this surrogate human kidney model. Consistent with their findings, we confirmed that this native protein neutralizes SARS-CoV-2 at a dose comparable with that used by these authors to achieve a maximal neutralizing effect. By contrast, the mouse counterpart protein mACE2 1–740 used as a negative control did not reduce infectivity whatsoever.
We also demonstrated that human kidney organoids have membrane-bound ACE2 that can interact with the RBD of the SARS-CoV-2 S1 spike protein. This is in support of the findings of a recent preprint, also demonstrating ACE2 expression in a three-dimensional renal epithelial tubuloid system, similar to our human kidney organoids but derived from human kidney tissue.33 (preprint) Of interest, this preprint also reports the novel finding that Kidney injury molecule-1 is an alternative receptor for SARS-CoV-2 .33 (preprint) Moreover, we show the presence of TMPRSS2 with areas of colocalization with ACE2 in proximal tubule–like structures. This protease is critically needed for activation of the ACE2 –SARS-CoV-2 –spike complex and subsequent internalization into the cell.16 , 34 SARS-CoV-2 , studies in lung tissue, preferably lung organoids , are desirable to demonstrate efficacy of ACE2 proteins to neutralize SARS-CoV-2 infectivity. The kidney organoids we used were of female origin, and ideally, one should examine this model originating from both sexes to consider that ACE2 is on the X chromosome and that in clinical studies, men appear more susceptible for severe COVID-19 .35 organoids , moreover, would also be important to better replicate the mature human kidney. Therefore, it would be important to test ACE2 treatment and SARS-CoV-2 in three-dimensional kidney spheroids/organoids of adult origin harboring mature phenotypes.36
Human soluble ACE2 1–740 is a large molecule of approximately 110 kD in size.11 , 37 ACE2 1–740 is even bigger, as it forms homodimers roughly double the size of the monomeric protein,31 ACE2 (amino acids 616–726).38 ACE2 1–618, reported here, is the counterpart to the mouse ACE2 1–619 that we have recently reported.15 COVID-19 –associated kidney disease because the shorter molecular size should render it filterable by the kidney. Indeed, AKI and collapsing glomerulopathy are frequent complications of COVID-19 .39 40–41 ACE2 1–619 protects against AKI in the ischemia-reperfusion model. Here, we report, moreover, that the human ACE2 1–618 variant when fused with ABD has an extended duration of action. One approach that has been used to elongate the t 1/2 of ACE2 1–740 is the fusion with Fragment crystallizable (Fc).30 ACE2 1–740 can be extended to about 7 days.30 ACE2 1–740 that has a t 1/2 of only a few hours. In addition, after viral binding, the ABD-tagged ACE2 could direct the SARS-CoV-2 –ACE2 complex to a different cell sorting pathway as compared with naked ACE2 . ACE2 -ABD, when bound to albumin, might direct the complex into the FcRn-mediated recycling pathway, which would be away from the lysosome-endosome pathway that seems crucial for viral processing and replication.42 ACE2 1–618 protein fused with ABD over the naked ACE2 1–740 protein.
Infection with SARS-CoV-2 may result in internalization and loss of membrane-bound FL-ACE2 , similar to what was reported for SARS-CoV.43 ACE2 , the degradation of its substrates, namely Ang II and des 9 Arg bradykinin, would be impaired.21 ACE2 acting as a guardian to prevent excessive levels of peptides with proinflammatory effects, the lungs but also, other organs, like the kidneys, are prone to local injury.21 , 43 , 44 ACE2 in the form of soluble protein should have therapeutic benefit, not only due to its decoy effect but also, by restoring the altered balance of Ang II and bradykinins that ensues with depletion of this enzyme. In this regard, it is important to perform studies in vivo using animal models that are sensitive to SARS-CoV-2 infection, like hamsters or ferrets.45 , 46 SARS-CoV-2 infectivity by expressing human FLACE2 (k18-hACE2 mice).47 soluble ACE2 proteins on mortality and organ injury should be examined.
Of note, the native form of soluble ACE2 1–740 is currently being studied in a clinical trial (NCT04335136) and was also successfully administered intravenously twice a day for compassionate use in a single patient case report recently.23 ACE2 1–618-ABD variant should offer a better way to prevent viral escape and afford more convenient dosing schedules. The potential protective effect on the kidneys of our shorter long-acting soluble ACE2 and its prolonged in vivo t 1/2 are important differences as compared with the native human recombinant soluble ACE2 . Comparative studies in permissive animal models of SARS-CoV-2 infection should determine the efficacy and relative advantages of each ACE2 protein.
Disclosures
D. Batlle and J. Wysocki are coinventors of the issued patent “Active Low Molecular Weight Variants of Angiotensin Converting Enzyme 2” and provisional patents “Active low molecular weight variants of Angiotensin Converting Enzyme 2 (ACE2 ) for the treatment of diseases and conditions of the eye” and “Shorter soluble forms of Angiotensin Converting Enzyme 2 (ACE2 ) for treating and preventing coronavirus infection.” D. Batlle is founder/owner of Angiotensin Therapeutics Inc. D. Batlle has received consulting fees from AstraZeneca, Relypsa, and Tricida, all unrelated to this work. During the conduct of these studies, D. Batlle received unrelated support from National Institute of Diabetes and Digestive and Kidney Diseases grant R01DK104785, as well as AstraZeneca and Feinberg Foundation; received honoraria from AstraZeneca, Relypsa, and Tricida; and was a scientific advisor member with Relypsa and Tricida. G. Randall reports consultancy agreements with Optikira. J.A. Wertheim reports consultancy agreements with Miromatrix Medical; ownership interest in Bristol-Myers Squib and Merk & Co.; honoraria from Ann and Robert H. Lurie Children’s Hospital of Chicago, Dartmouth College, Miromatrix Medical, National Institutes of Health, Springer Publishing Company, and Taylor and Francis; patents and inventions via a patent that is not receiving any royalties; and being a scientific advisor or member with Standards Coordinating Body, Organogenesis, Alliance for Regenerative Medicine. J. Wysocki reports scientific advisor capacity for Angiotensin Therapeutics Inc. All remaining authors have nothing to disclose.
Funding
D. Batlle was funded by National Institute of Diabetes and Digestive and Kidney Diseases
J. Wysocki designed and performed many of the experiments and wrote parts of the paper. M. Ye did the staining studies. L. Hassler helped with the writing of the manuscript and data analysis. J.A. Wertheim oversaw the generation of kidney organoids by A.K. Gupta and Y. Wang. A.K. Gupta, Y. Wang, and J.A. Wertheim edited the manuscript. G. Randall supervised the infectivity studies in the Biosafety Level 3 facility done by V. Nicoleascu. D. Batlle designed experiments and wrote most of the paper.
Supplemental Material
This article contains the following supplemental material online at http://jasn.asnjournals.org/lookup/suppl/doi:10.1681/ASN.2020101537/-/DCSupplemental
Supplemental Material ACE2 variants; generation of human kidney organoids ; and in vitro assay for detection of hACE2-RBD interaction) and supplemental results (catalytic efficiency of human ACE2 1-618 and human ACE2 1-618 with an ABD tag and prolonged in vivo activity of human ACE2 variant 1-618-ABD).
References
1. Guy JL, Lambert DW, Warner FJ, Hooper NM, Turner AJ: Membrane-associated zinc peptidase families: Comparing ACE and
ACE2 . Biochim Biophys Acta 1751: 2–8, 2005 16054014
2. Tipnis SR, Hooper NM, Hyde R, Karran E, Christie G, Turner AJ: A human homolog of angiotensin-converting enzyme. Cloning and functional expression as a captopril-insensitive carboxypeptidase. J Biol Chem 275: 33238–33243, 2000 10924499
3. Donoghue M, Hsieh F, Baronas E, Godbout K, Gosselin M, Stagliano N, et al.: A novel angiotensin-converting enzyme-related carboxypeptidase (
ACE2 ) converts angiotensin I to angiotensin 1-9. Circ Res 87: E1–E9, 2000 10969042
4. Vickers C, Hales P, Kaushik V, Dick L, Gavin J, Tang J, et al.: Hydrolysis of biological peptides by human angiotensin-converting enzyme-related carboxypeptidase. J Biol Chem 277: 14838–14843, 2002 11815627
5. Guy JL, Jackson RM, Acharya KR, Sturrock ED, Hooper NM, Turner AJ: Angiotensin-converting enzyme-2 (
ACE2 ): Comparative modeling of the active site, specificity requirements, and chloride dependence. Biochemistry 42: 13185–13192, 2003 14609329
6. Brosnihan KB, Li P, Ganten D, Ferrario CM: Estrogen protects transgenic hypertensive rats by shifting the vasoconstrictor-vasodilator balance of RAS. Am J Physiol 273: R1908–R1915, 1997 9435644
7. Ferrario CM:
ACE2 : More of Ang-(1-7) or less Ang II? Curr Opin Nephrol Hypertens 20: 1–6, 2011 21045683
8. Chappell MC, Marshall AC, Alzayadneh EM, Shaltout HA, Diz DI: Update on the Angiotensin converting enzyme 2-Angiotensin (1-7)-MAS receptor axis: Fetal programing, sex differences, and intracellular pathways. Front Endocrinol (Lausanne) 4: 201, 2014 24409169
9. Wysocki J, Ye M, Rodriguez E, González-Pacheco FR, Barrios C, Evora K, et al.: Targeting the degradation of angiotensin II with recombinant angiotensin-converting enzyme 2: Prevention of angiotensin II-dependent hypertension. Hypertension 55: 90–98, 2010 19948988
10. Batlle D, Wysocki J, Soler MJ, Ranganath K: Angiotensin-converting enzyme 2: Enhancing the degradation of angiotensin II as a potential therapy for diabetic nephropathy. Kidney Int 81: 520–528, 2012 22113528
11. Wysocki J, Garcia-Halpin L, Ye M, Maier C, Sowers K, Burns KD, et al.: Regulation of urinary
ACE2 in diabetic mice. Am J Physiol Renal Physiol 305: F600–F611, 2013 23761674
12. Haber PK, Ye M, Wysocki J, Maier C, Haque SK, Batlle D: Angiotensin-converting enzyme 2-independent action of presumed angiotensin-converting enzyme 2 activators: Studies
in vivo ,
ex vivo , and
in vitro . Hypertension 63: 774–782, 201424446061
13. Serfozo P, Wysocki J, Gulua G, Schulze A, Ye M, Liu P, et al.: Ang II (angiotensin II) conversion to angiotensin-(1-7) in the circulation is POP (prolyloligopeptidase)-dependent and
ACE2 (angiotensin-converting enzyme 2)-independent. Hypertension 75: 173–182, 2020 31786979
14. Marquez A, Wysocki J, Pandit J, Batlle D: An update on
ACE2 amplification and its therapeutic potential. Acta Physiol (Oxf) 231: e13513, 2021 32469114
15. Wysocki J, Schulze A, Batlle D: Novel variants of angiotensin converting enzyme-2 of shorter molecular size to target the kidney renin angiotensin system. Biomolecules 9: 886, 2019 31861139
16. Hoffmann M, Kleine-Weber H, Schroeder S, Krüger N, Herrler T, Erichsen S, et al.:
SARS-CoV-2 cell entry depends on
ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor. Cell 181: 271–280.e8, 2020 32142651
17. Walls AC, Park Y-J, Tortorici MA, Wall A, McGuire AT, Veesler D: Structure, function, and antigenicity of the
SARS-CoV-2 spike glycoprotein [published correction appears in
Cell 183: 1735, 2020 10.1016/j.cell.2020.11.032]. Cell 181: 281–292.e6, 2020
18. Wrapp D, Wang N, Corbett KS, Goldsmith JA, Hsieh CL, Abiona O, et al.: Cryo-EM structure of the 2019-nCoV spike in the prefusion conformation. Science 367: 1260–1263, 2020 32075877
19. Lan J, Ge J, Yu J, Shan S, Zhou H, Fan S, et al.: Structure of the
SARS-CoV-2 spike receptor-binding domain bound to the
ACE2 receptor. Nature 581: 215–220, 2020 32225176
20. Wang Q, Zhang Y, Wu L, Niu S, Song C, Zhang Z, et al.: Structural and functional basis of
SARS-CoV-2 entry by using human
ACE2 . Cell 181: 894–904.e9, 2020 32275855
21. Davidson AM, Wysocki J, Batlle D: Interaction of
SARS-CoV-2 and other coronavirus with ACE (Angiotensin-Converting Enzyme) 2 as their main receptor: Therapeutic implications. Hypertension 76: 1339–1349, 2020 32851855
22. Monteil V, Kwon H, Prado P, Hagelkrüys A, Wimmer RA, Stahl M, et al.: Inhibition of
SARS-CoV-2 infections in engineered human tissues using clinical-grade soluble human
ACE2 . Cell 181: 905–913.e7, 2020 32333836
23. Zoufaly A, Poglitsch M, Aberle JH, Hoepler W, Seitz T, Traugott M, et al.: Human recombinant soluble
ACE2 in severe
COVID-19 [published correction appears in
Lancet Respir Med 8: e78, 2020 10.1016/S2213-2600(20)30462-8]. Lancet Respir Med 8: 1154–1158, 2020 33131609
24. Haschke M, Schuster M, Poglitsch M, Loibner H, Salzberg M, Bruggisser M, et al.: Pharmacokinetics and pharmacodynamics of recombinant human angiotensin-converting enzyme 2 in healthy human subjects. Clin Pharmacokinet 52: 783–792, 2013 23681967
25. Wan Y, Shang J, Graham R, Baric RS, Li F: Receptor recognition by the novel coronavirus from Wuhan: An analysis based on decade-long structural studies of SARS coronavirus. J Virol 94: e00127-20, 2020 31996437
26. Morizane R, Bonventre JV: Generation of nephron progenitor cells and kidney
organoids from human pluripotent stem cells. Nat Protoc 12: 195–207, 2017 28005067
27. Morizane R, Lam AQ, Freedman BS, Kishi S, Valerius MT, Bonventre JV: Nephron
organoids derived from human pluripotent stem cells model kidney development and injury. Nat Biotechnol 33: 1193–1200, 2015 26458176
28. Wu H, Uchimura K, Donnelly EL, Kirita Y, Morris SA, Humphreys BD: Comparative analysis and refinement of human PSC-derived kidney organoid differentiation with single-cell transcriptomics. Cell Stem Cell 23: 869–881.e8, 2018
29. Liu P, Wysocki J, Serfozo P, Ye M, Souma T, Batlle D, et al.: A fluorometric method of measuring carboxypeptidase activities for angiotensin II and apelin-13. Sci Rep 7: 45473, 2017 28378780
30. Liu P, Wysocki J, Souma T, Ye M, Ramirez V, Zhou B, et al.: Novel
ACE2 -Fc chimeric fusion provides long-lasting hypertension control and organ protection in mouse models of systemic renin angiotensin system activation. Kidney Int 94: 114–125, 2018 29691064
31. Ye M, Wysocki J, Gonzalez-Pacheco FR, Salem M, Evora K, Garcia-Halpin L, et al.: Murine recombinant angiotensin-converting enzyme 2: Effect on angiotensin II-dependent hypertension and distinctive angiotensin-converting enzyme 2 inhibitor characteristics on rodent and human angiotensin-converting enzyme 2. Hypertension 60: 730–740, 2012 22777933
32. Kumar Gupta A, Sarkar P, Wertheim JA, Pan X, Carroll TJ, Oxburgh L: Asynchronous mixing of kidney progenitor cells potentiates nephrogenesis in
organoids . Commun Biol 3: 231, 2020 32393756
33. Ichimura T, Mori Y, Aschauer P, Das KMP, Padera RF, Weins A, et al.: KIM-1/TIM-1 is a receptor for
SARS-CoV-2 in lung and kidney. medRxiv. 10.1101/2020.09.16.20190694 (Preprint posted September 18, 2020)
34. Matsuyama S, Nao N, Shirato K, Kawase M, Saito S, Takayama I, et al.: Enhanced isolation of
SARS-CoV-2 by TMPRSS2-expressing cells. Proc Natl Acad Sci U S A 117: 7001–7003, 2020 32165541
35. Bienvenu LA, Noonan J, Wang X, Peter K: Higher mortality of
COVID-19 in males: Sex differences in immune response and cardiovascular comorbidities. Cardiovasc Res 116: 2197–2206, 2020 33063089
36. Harari-Steinberg O, Omer D, Gnatek Y, Pleniceanu O, Goldberg S, Cohen-Zontag O, et al.:
Ex vivo expanded 3D human kidney spheres engraft long term and repair chronic renal injury in mice. Cell Rep 30: 852–869.e4, 2020 31968258
37. Poglitsch M, Domenig O, Schwager C, Stranner S, Peball B, Janzek E, et al.: Recombinant expression and characterization of human and murine
ACE2 : Species-specific activation of the alternative renin-angiotensin-system. Int J Hypertens 2012: 428950, 2012 22518284
38. Yan R, Zhang Y, Li Y, Xia L, Guo Y, Zhou Q: Structural basis for the recognition of
SARS-CoV-2 by full-length human
ACE2 . Science 367: 1444–1448, 2020 32132184
39. Su H, Yang M, Wan C, Yi LX, Tang F, Zhu HY, et al.: Renal histopathological analysis of 26 postmortem findings of patients with
COVID-19 in China. Kidney Int 98: 219–227, 2020 32327202
40. Wu H, Larsen CP, Hernandez-Arroyo CF, Mohamed MMB, Caza T, Sharshir M, et al.: AKI and collapsing glomerulopathy associated with
COVID-19 and APOL1 high-risk genotype. J Am Soc Nephrol 31: 1688–1695, 2020 32561682
41. Batlle D, Soler MJ, Sparks MA, Hiremath S, South AM, Welling PA, et al.;
COVID-19 and
ACE2 in Cardiovascular, Lung, and Kidney Working Group: Acute kidney injury in
COVID-19 : Emerging evidence of a distinct pathophysiology. J Am Soc Nephrol 31: 1380–1383, 2020 32366514
42. Blaess M, Kaiser L, Sauer M, Csuk R, Deigner HP:
COVID-19 /
SARS-CoV-2 infection: Lysosomes and lysosomotropism implicate new treatment strategies and personal risks. Int J Mol Sci 21: 4953, 2020 32668803
43. Kuba K, Imai Y, Rao S, Gao H, Guo F, Guan B, et al.: A crucial role of angiotensin converting enzyme 2 (
ACE2 ) in SARS coronavirus-induced lung injury. Nat Med 11: 875–879, 2005 16007097
44. Sodhi CP, Wohlford-Lenane C, Yamaguchi Y, Prindle T, Fulton WB, Wang S, et al.: Attenuation of pulmonary
ACE2 activity impairs inactivation of des-Arg
9 bradykinin/BKB1R axis and facilitates LPS-induced neutrophil infiltration. Am J Physiol Lung Cell Mol Physiol 314: L17–L31, 2018 28935640
45. Sia SF, Yan LM, Chin AWH, Fung K, Choy KT, Wong AYL, et al.: Pathogenesis and transmission of
SARS-CoV-2 in golden hamsters. Nature 583: 834–838, 2020 32408338
46. Kim Y-I, Kim SG, Kim SM, Kim EH, Park SJ, Yu KM, et al.: Infection and rapid transmission of
SARS-CoV-2 in ferrets. Cell Host Microbe 27: 704–709.e2, 2020 32259477
47. Winkler ES, Bailey AL, Kafai NM, Nair S, McCune BT, Yu J, et al.:
SARS-CoV-2 infection of human
ACE2 -transgenic mice causes severe lung inflammation and impaired function [published correction appears in
Nat Immunol 21: 1327–1335, 2020 10.1038/s41590-020-0778-2]. Nat Immunol 21: 1470, 2020
