Because oxalate is excreted by the kidneys, reduced renal function results in increased plasma oxalate (Pox ) concentration as observed in patients with CKD and ESKD.1 , 2 ox concentration in the development of cardiovascular complications in patients with ESKD. For instance, elevated Pox concentrations have been associated with cardiac fibrosis and elevated hemodynamic parameters, such as pulse wave velocity and central aortic BP.3 , 4 5 , 6
Slc26a6 is an oxalate transporter expressed in multiple epithelial tissues, including the kidney and intestine.7 Slc26a6 can function in several exchange modes but primarily operates as a chloride-oxalate exchanger.8 via Slc26a6 in the intestine plays a pivotal role in mediating back flux of oxalate to limit its net absorption. Slc26a6 −/− 9 , 10 ox and urine oxalate in Slc26a6 −/− 9 Slc26a6 -mediated oxalate secretion leads to an increased net intestinal oxalate absorption and renal oxalate excretion.
Upregulation of oxalate secretion in the colon in rat models of CKD was described by different groups of investigators over 20 years ago prior to the molecular identification of oxalate transporters.11–12 13 Slc26a6 in oxalate homeostasis described above, we examined whether intestinal expression of Slc26a6 is upregulated in CKD and whether Slc26a6 -mediated oxalate secretion in the intestine mitigates the hyperoxalemia of CKD.
Methods
Animal Studies
All animal studies were performed on 12- to 16-week-old male wild-type mice. All experiments except those using Slc26a6 −/− Slc26a6 −/− Slc26a6 −/− 9
AA Injections
Mice received a single or weekly intraperitoneal injections with AA (Sigma-Aldrich Chemie GmBH, Steinheim, Germany). The average injection volume contained 200 µ l of AA diluted in PBS to a dose of 1.5 mg/kg and was individually adapted for each mouse depending on the body weight on the day of injection. The stock solution of AA consisting of powder was dissolved in 100% DMSO and diluted in PBS. Fresh AA injection solution was prepared prior to each injection. Control mice received DMSO/PBS as vehicle.
Assessment of Renal Function
Retro-orbital blood samples were obtained weekly. In order to prevent clotting, 5–20 μ l 125 μ M EDTA was added to a sterile 1.5-ml collection tube. The blood was centrifuged for 10 minutes at 7000 rpm at room temperature using a BIOFUGE fresco Heraeus centrifuge (Thermo Fisher Scientific Inc., Waltham, MA) in order to separate plasma from blood cells. Plasma was collected and stored at −20°C. Plasma creatinine and BUN levels were measured using a Cobas Integra 800 autoanalyzer (Roche, Mannheim, Germany) by enzymatic measurement.
Measurement of Fecal Oxalate and Pox Concentrations
Pox and fecal oxalate were measured by an oxalate-oxidase assay as previously described.9 , 14
Real-Time RT-PCR
Mice were anesthetized with 2% isoflurane mixed with 1 L oxygen per minute and euthanized by neck fracture. Intestinal tissue was harvested, snap frozen in liquid nitrogen, and stored at −80°C until further use. Total RNA was isolated using a PureLink RNA Mini Kit (catalog no. 12183018A; Ambion, Austin, TX) following the manufacturer’s instructions. The frozen tissue was homogenized by a T25 basic ULTRA-TURRAX dispersing device (IKA-Werke GmbH & Co. KG, Staufen, Germany) in 500 μl lysis buffer containing 1% 2-mercaptoethanol. RNA was quantified and subjected to reverse transcription using Thermo Scientific RevertAid Reverse Transcription (Thermo Fisher Scientific Inc.). Gene expression measurement was performed using StepOnePlus Real-Time PCR System (Thermo Fisher Scientific Inc.) with SYBR Green PCR master mix. Detection and evaluation of the samples were performed using StepOne Software (Version 2.3). Expression data were analyzed using the comparative threshold cycle method, and mRNA ratios were calculated by 2−Δcomparative threshold cycle ; 18S RNA served as the housekeeping gene to normalize all mRNA expression values. In order to compare groups, expression of each gene in wild-type animals receiving a control diet was set to one. All primers were obtained from Sigma-Aldrich Chemie GmBH and are listed in Table 1 .
Table 1. -
Primer sequences used to determine mRNA expression levels
Target
Primer Sequence (5′ to 3′)
18s
Forward: TTGATTAAGTCCCTGCCCTTTGT
Reverse: CGATCCGAGGGCCTCACTA
Slc26a6 Forward: CAGTTCTTTCTACCCCGTCTTC
Reverse: CACACTGCCCACCATCACAG
Slc26a1
Forward: ACAACACTGATCATTGGGCTACA
Reverse: GCCGGAGGATACCCATGAG
Slc26a2
Forward: ACCTTCATGGCTGGAGTTTATCAG
Reverse: CTGAGACGTGAGGATGGTGAAG
Slc26a3
Forward: CTGCAGCCGCTACAAAAGTC
Reverse: TTTTCCACAATCTGCCTATTTCAG
Sglt-1
Forward: GACATCTCAGTCATCGTCATC
Reverse: TGTGATTGTATAAAGGGCAGTG
Cat-1
Forward: GGGTTTATGCCCTTTGGATT
Reverse: TAAGGCATCATGAGCGTGAG
Western Blot Analysis
Mice were anesthetized with 2% isoflurane mixed with 1 L oxygen per minute and euthanized by neck fracture. Proximal colon was harvested and cleared with ice-cold PBS containing protease inhibitors (Roche cOmplete; Sigma-Aldrich, St. Louis, MO). Connective tissue was removed, and intestinal segments were opened longitudinally. The mucosa was then scraped into cold PBS containing protease inhibitors and homogenized using a Thomas-style glass homogenizer and a serrated pestle. Samples were stored at −80°C until further use. Intestinal homogenates were solubilized in SDS sample buffer and subjected to SDS-PAGE and western blot analysis. Western blots were probed with a primary rabbit anti-human Slc26a6 antibody (R29; 1:50,000 dilution). As secondary antibody, horseradish peroxidase-conjugated anti-rabbit antibody (Jackson ImmunoResearch Laboratories, West Grove, PA) at 1:20,000 dilution was used. Antibody labeling was visualized by enhanced chemiluminescence (Clarity; Bio-Rad, Hercules, CA) and captured on film. Membrane staining with Coomassie Brilliant Blue was used as loading control. Specificity of R29 antibody was verified by comparison of immunoblotting of wild-type and Slc26a6 −/−
Immunocytochemistry for Intestinal Slc26a6 Expression
Tissue was embedded in Epon 812 (Electron Microscopy Sciences, Hatfield, PA) and processed for immunocytochemistry as described previously.15 μ m sections were subjected to antigen retrieval and then labeled with a rabbit polyclonal antibody directed against Slc26a6 (R29; 1:10,000 dilution). Primary antibody labeling was visualized by incubation with a fluorochrome-labeled secondary antibody (donkey anti-rabbit Alexa-Fluor 488; 1:200 dilution; Thermo Fisher Scientific, Grand Island, NY). Specificity of R29 was verified by western analysis15 Slc26a6 −/−
Statistical Analyses
Data are presented as mean ± SEM. Unpaired, two-tailed t test was used for determining statistical significance, in which a P value <0.05 was considered as significant.
Results
A Diet High in Soluble Oxalate or Weekly Injections of AA Induce Progressive CKD
We have recently demonstrated that feeding a diet high in soluble oxalate causes progressive kidney failure.14 , 16 ox because it requires feeding of supraphysiologic dietary oxalate concentrations resulting in severe hyperoxalemia and hyperoxaluria.14 , 16 17 , 18 Figure 1 , weekly injections of AA or feeding mice a diet high in soluble oxalate leads to progressive CKD as indicated by rising BUN and creatinine.
Figure 1.: A diet high in soluble oxalate or weekly injections of AA induce CKD. Wild-type mice were fed a control diet (0% calcium and 0% oxalate) or a diet high in soluble oxalate (0% calcium and 0.67% oxalate; termed OX-CKD). In addition, mice on a control diet received weekly intraperitoneal injections of PBS or 1.5 mg/kg AA (termed AA-CKD). (A) Plasma BUN and (B) plasma creatinine were measured at baseline and days 7, 14, and 21. Data are means ± SEM; n =8 for mice on a control diet and receiving PBS injections, n =24 for mice receiving AA injections, and n =18 for mice on a high-soluble oxalate diet. ***P <0.001 versus control group.
Fecal Oxalate Excretion Is Reduced and Pox Concentration Is Increased in Slc26a6 −/− Mice
In the next series of experiments, we examined whether fecal oxalate excretion is increased in mice with AA-induced CKD. Animals were maintained on an oxalate-free diet so that fecal oxalate must represent net intestinal oxalate secretion. As shown in Figure 2A , following induction of CKD there was a fivefold increase in fecal oxalate excretion. This increase was abrogated in Slc26a6 −/− Slc26a6 is absolutely required for enhanced fecal oxalate secretion of endogenously produced oxalate accumulating in CKD. The reduced fecal oxalate excretion in Slc26a6 −/− ox concentration compared with wild-type mice with CKD (Figure 2B ), indicating that enteric oxalate secretion mediated by Slc26a6 plays a significant role in defending against hyperoxalemia in CKD.
Figure 2.: Slc26a6 −/−ox concentrations in CKD. (A) Fecal oxalate and (B) Pox concentrations were measured in wild-type (WT) and Slc26a6 −/−P =0.01, *** P <0.001 versus control group.
Slc26a6 Expression Is Upregulated in Ileum and Proximal Colon in CKDEnhanced fecal oxalate excretion in CKD may possibly be explained by the increased Pox concentration in CKD and the resulting more favorable driving force for secretion. However, given the critical role of Slc26a6 for fecal oxalate excretion in CKD, we examined whether there might be increased expression of Slc26a6 in any segments of the intestine as an additional mechanism for enhanced fecal oxalate secretion in CKD.
Baseline expression of Slc26a6 along the intestinal tract was measured by quantitative PCR. As shown in Figure 3A , highest expression of Slc26a6 was observed in the duodenum followed by decreasing expression in more distal segments of the small intestine and extremely low expression in the colon, confirming previous findings.19 Slc26a6 along the intestine in the models of progressive CKD (Figure 1 ). Slc26a6 expression was increased in CKD in the ileum and the proximal colon, reaching 8- to 12-fold upregulation in the latter segment (Figure 3B ). In addition, we observed an increased expression of the oxalate transporters Slc26a1, Slc26a2, and Slc26a320–21 22 Figure 3C ). To exclude the possibility that the increased expression of members of the Slc26a family of transporters results from general upregulation of intestinal transport processes, we also measured proximal colon expression levels of glucose (Sglt-1) and amino acid transporters (Cat-1), other representative intestinal transport processes. We observed a slight increase of Sglt-1 expression in the oxalate-induced CKD model but otherwise, no changes in Cat-1 or Sglt-1 in AA-induced CKD, suggesting that the changes observed are specific to transporters involved in oxalate homeostasis (Figure 3C ).
Figure 3.: Intestinal Slc26a6 is upregulated in mouse models of CKD. (A) Slc26a6 mRNA expression levels were measured in different intestinal segments of wild-type mice and relative to housekeeping genes. Data are means ± SEM from five mice. (B) Slc26a6 mRNA expression levels were measured and normalized to control condition in intestinal segments of wild-type mice maintained on a control diet (0% calcium and 0% oxalate) and receiving weekly intraperitoneal injections of PBS (control). In addition, one group of mice received a high-soluble oxalate diet (0% calcium and 0.67% oxalate; termed OX-CKD) or weekly intraperitoneal injections of 1.5 mg/kg AA (termed AA-CKD) for 21 days. Data are means ± SEM; n =8 for mice on a control diet and receiving PBS injections, n =12 for mice on a high-soluble oxalate diet, and n =10 for mice receiving AA injections. PC= proximal colon, DC= distal colon. (C) Slc26a6 , Slc26a1, Sglt-1, and Cat-1 mRNA expression levels were measured and normalized to control condition in proximal colon of control mice compared with mice on a diet high in soluble oxalate or receiving AA injections following 21 days. Data are means ± SEM. For Slc26a6 , Slc26a1, Cat-1, and Sglt-1, n =8 for mice on a control diet and receiving PBS injections, n =10 for mice receiving AA injections, and n =12 for mice on a high-soluble oxalate diet. For Slc26a3 and Slc26a2, n =6 for mice on a control diet and receiving PBS injections, n =8 for mice receiving AA injections, and n =6 for mice on a high-soluble oxalate diet. ns, not significant versus control group. *P =0.05 versus control group; **P =0.01 versus control group; ***P <0.001 versus control group.
Slc26a6 Protein Expression Is Increased in Proximal Colon of Mice with CKDTo confirm the striking upregulation of Slc26a6 in the proximal colon in CKD, we performed immunohistochemistry. As shown in Figure 4 , immunofluorescence microscopy revealed low baseline expression of Slc26a6 that was greatly increased in colonocytes in CKD (Figure 4B ). Staining was absent in Slc26a6 −/− Figure 4C ). To evaluate the expression of Slc26a6 by a more quantitative method, we performed immunoblotting of homogenates of epithelial cells from proximal colon of mice with CKD. As illustrated in Figure 5 , Slc26a6 polypeptide abundance was clearly higher in mice with CKD than in proximal colon cell homogenates from control tissue. In order to demonstrate the specificity of anti-Slc26a6 antibody, western blot of mouse proximal colon of sections prepared from Slc26a6 −/− Slc26a6 expression is increased on a transcriptional and protein level in proximal colon of mice with CKD.
Figure 4.: Slc26a6 expression is increased on the apical membrane of colonocytes in mice with CKD. Immunolocalization of Slc26a6 in the proximal colon of (A) wild-type (WT) mice on a control diet, (B) WT mice on a control diet receiving weekly intraperitoneal injections of 1.5 mb/kg AA, and (C) Slc26a6 −/−Slc26a6 antibody R29 at a dilution of 1:10,000. All sections were matched for magnification and exposure, and asterisks label the lumen of proximal colon tissue. Scale bar: 16 μm.
Figure 5.: Slc26a6 protein expression is increased in proximal colon of mice with CKD. (A) Western analysis of proximal colon homogenates isolated from wild-type (WT) mice maintained on a control diet (CT). In addition, there are tissues of WT mice and Slc26a6 −/− A6 −/− Slc26a6 antibody R29, and the lower panel of each blot was stained with Coomassie Brilliant Blue for use as a protein loading control. All lanes came from the same gel, blot, and film exposure. MW, molecular mass. (B) Densitometric analysis of Slc26a6 expression levels depicted in (A). Slc26a6 densitometry values were normalized to corresponding Coomassie Brilliant Blue densitometry before statistical analysis. Data are means ± SEM from three separate mice per group, except for one Slc26a6 −/− P =0.01 versus control group.
Dietary Oxalate and Pox May Not Serve to Regulate Slc26a6 Activity
One possible mechanism leading to the adaptive upregulation of colonic Slc26a6 in CKD is elevation in Pox . Several intestinal transporters are regulated by their respective substrate. For example, intestinal glucose transporters are modulated by dietary carbohydrate content.23 , 24 Slc26a6 expression. In order to dissect the effect of increased dietary and Pox on Slc26a6 expression from changes secondary to reduced GFR, we established a dietary oxalate content that raises Pox concentration yet does not induce CKD. Therefore, we reduced the dietary oxalate content from 50 μ mol/g sodium oxalate that caused advanced CKD (Figure 1 ) to 10 μ mol/g sodium oxalate. Feeding 10 μ mol/g sodium oxalate does not induce CKD as measured by BUN and creatinine yet significantly raises Pox concentration as shown in Figure 6, A–C . We compared the group of mice receiving 10 μ mol/g dietary sodium oxalate with a group of mice with CKD following AA injections. The latter group was maintained on an oxalate-free diet. Under these conditions, an elevation of Pox concentration reflects the accumulation of endogenously produced oxalate. Feeding mice dietary oxalate raised Pox concentration but did not alter intestinal A6 expression significantly compared with control mice on an oxalate-free diet (Figure 6D ). Moreover, as previously shown in Figure 3C , upregulation of Slc26a6 in proximal colon was similar in both the AA-induced and high oxalate–induced CKD models despite high ingested oxalate in the latter. Taken together, our findings suggest that elevated dietary and Pox concentrations may not serve as the signal to regulate enteric Slc26a6 expression.
Figure 6.: Enteric Slc26a6 expression is not directly regulated via oxalate. Wild-type mice were fed a control diet (0% calcium and 0% oxalate) and additionally received weekly intraperitoneal injections of PBS (control). A separate group of mice was fed a soluble low-oxalate diet (0% calcium and 0.134% oxalate; termed Low-Ox) or injected weekly with 1.5 mg/kg AA (AA-CKD) for 21 days. (A) Plasma BUN and (B) plasma creatinine were measured at baseline and days 7, 14, and 21. (C) Pox concentrations were measured in each group of mice at 21 days. (D) Slc26a6 mRNA expression levels were measured and normalized to control condition in proximal colon of control mice, mice receiving a low-oxalate diet, or mice receiving weekly AA injections. Data are means ± SEM; n =8 for mice on a control diet and receiving PBS injections, n =14 for mice receiving AA injections, and n =8 for mice on a low-soluble oxalate diet. ns, not significant versus control group. *P =0.05 versus control group; ***P <0.001 versus control group.
Discussion
In this study, we confirm that substantial extrarenal clearance of oxalate occurs via the mouse intestine in CKD, consistent with reports from different groups of investigators using rat models.11–12 13 Slc26a6 is required for the increased intestinal oxalate secretion in CKD, thereby lowering the body burden of oxalate as reflected by Pox as schematically summarized in Figure 7 .
Figure 7.: Slc26a6 plays a pivotal role to defend against hyperoxalemia in CKD, as shown schematically. (A) As kidney function declines, reduced renal oxalate clearance is partially compensated via increased fecal excretion mediated by oxalate transporter Slc26a6 . (B) In the absence of Slc26a6 , augmentation of enteric oxalate secretion is abrogated, aggravating hyperoxalemia.
Enhanced fecal oxalate excretion in CKD may possibly be explained by the increased Pox concentration in CKD and the resulting more favorable driving force for secretion. However, we also identified upregulation of Slc26a6 in the ileum and proximal colon on the basis of mRNA expression. The marked upregulation of Slc26a6 expression in the proximal colon was confirmed at the protein level by immunohistochemistry and immunoblotting. It is therefore possible that upregulation of intestinal Slc26a6 expression may also contribute to the enhanced fecal excretion of oxalate in CKD. However, the absolute level of expression of Slc26a6 in the proximal colon even in CKD is much lower than transporter expression in the small intestine, and therefore, it is unclear to what extent the proximal colon contributes to enhanced fecal oxalate excretion in CKD. Indeed, we were unable to detect active transcellular oxalate secretion across proximal colon tissue mounted in Ussing chambers in vitro (data not shown), although this could be due to the absence of critical agonists or factors that stimulate secretion in vivo . We therefore cannot determine to what extent Slc26a6 -mediated fecal oxalate excretion in CKD is the result of oxalate secretion in the proximal colon versus the small intestine.
In series with Slc26a6 expressed on the apical membrane of the colonocyte, basolateral uptake of oxalate is required for transcellular oxalate secretion. Of interest in this regard, we also demonstrated increased expression of the basolateral oxalate transporter Slc26a1 in proximal colon in both CKD models. Although previous studies of Slc26a1 −/− 25 , 26 21 Slc26a6 −/− 22 27 , 28
Human SLC26A6 has been shown to mediate efflux of oxalate in exchange for extracellular chloride at a greater rate than the mouse ortholog.29 SLC26A6 expression to oxalate homeostasis in humans is further demonstrated by a report of a patient with subclinical celiac disease and absence of fat malabsorption in whom hyperoxaluria correlated with markedly reduced expression of SLC26A6 in the intestine.30 SLC26A6 in humans in order to define whether SLC26A6 may be a suitable pharmacologic target to enhance extrarenal clearance of oxalate and mitigate hyperoxalemia in oxalate-related disorders with CKD.
Disclosures
All authors have nothing to disclose.
Funding
This study was supported by Deutsche Forschungsgemeinschaft Oxalosis and Hyperoxaluria Foundation Deutscher Akademischer Austauschdienst National Institutes of Health
We thank Michaela Arend and Susanne Rößler for expert technical assistance.
Dr. Felix Knauf and Ms. Laura Neumeier designed the study and experiments; Ms. Laura Neumeier, Dr. Martin Reichel, and Dr. Robert Thomson performed the experiments; Dr. Peter S. Aronson, Dr. Kai-Uwe Eckardt, Dr. Felix Knauf, and Ms. Laura Neumeier supervised experiments and interpreted the data; Ms. Laura Neumeier, Dr. Peter S. Aronson and Dr. Felix Knauf wrote the paper; and Dr. Peter S. Aronson, Dr. Kai-Uwe Eckardt, Dr. Felix Knauf, Ms. Laura Neumeier, Dr. Martin Reichel, and Dr. Robert Thomson reviewed the manuscript. Dr. Kai-Uwe Eckardt reports personal fees from Akebia, Bayer, Fresenius, Genzyme, and Vifor, and grant support from Amgen and Shire, outside the submitted work. Dr. Felix Knauf reports personal fees from Allena, Oxthera, Fresenius, and Sanofi, outside the submitted work.
References
1. Marangella M, Cosseddu D, Petrarulo M, Vitale C, Linari F: Thresholds of serum calcium oxalate supersaturation in relation to renal function in patients with or without primary hyperoxaluria. Nephrol Dial Transplant 8: 1333–1337, 1993 8159301
2. Hoppe B, Kemper MJ, Bökenkamp A, Langman CB: Plasma calcium-oxalate saturation in children with renal insufficiency and in children with primary hyperoxaluria. Kidney Int 54: 921–925, 1998 9734617
3. Tomson CR, Channon SM, Ward MK, Laker MF: Plasma oxalate concentration, oxalate clearance and cardiac function in patients receiving haemodialysis. Nephrol Dial Transplant 4: 792–799, 1989 2516611
4. Salyer WR, Keren D: Oxalosis as a complication of chronic renal failure. Kidney Int 4: 61–66, 1973 4723994
5. Palsson R, Chandraker AK, Curhan GC, Rennke HG, McMahon GM, et al.SS: The association of calcium oxalate deposition in kidney allografts with graft and patient survival. Nephrol Dial Transplant 35: 888–894, 202030165691
6. Pinheiro HS, Câmara NO, Osaki KS, De Moura LA, Pacheco-Silva A: Early presence of calcium oxalate deposition in kidney graft biopsies is associated with poor long-term graft survival. Am J Transplant 5: 323–329, 2005 15643992
7. Knauf F, Yang CL, Thomson RB, Mentone SA, Giebisch G, Aronson PS: Identification of a chloride-formate exchanger expressed on the brush border membrane of renal proximal tubule cells. Proc Natl Acad Sci U S A 98: 9425–9430, 2001 11459928
8. Jiang Z, Grichtchenko II, Boron WF, Aronson PS: Specificity of anion exchange mediated by mouse
Slc26a6 . J Biol Chem 277: 33963–33967, 2002 12119287
9. Jiang Z, Asplin JR, Evan AP, Rajendran VM, Velazquez H, Nottoli TP, et al.: Calcium oxalate urolithiasis in mice lacking anion transporter
Slc26a6 . Nat Genet 38: 474–478, 2006 16532010
10. Freel RW, Hatch M, Green M, Soleimani M: Ileal oxalate absorption and urinary oxalate excretion are enhanced in
Slc26a6 null mice. Am J Physiol Gastrointest Liver Physiol 290: G719–G728, 2006 16373425
11. Costello JF, Smith M, Stolarski C, Sadovnic MJ: Extrarenal clearance of oxalate increases with progression of renal failure in the rat. J Am Soc Nephrol 3: 1098–1104, 1992 1482750
12. Hatch M, Freel RW, Vaziri ND: Intestinal excretion of oxalate in chronic renal failure. J Am Soc Nephrol 5: 1339–1343, 1994 7893999
13. Dobson DM, Finlayson B: Oxalate transport from plasma to intestinal lumen in the rat. Surg Forum 24: 540–542, 1973 4806090
14. Mulay SR, Eberhard JN, Pfann V, Marschner JA, Darisipudi MN, Daniel C, et al.: Oxalate-induced chronic kidney disease with its uremic and cardiovascular complications in C57BL/6 mice. Am J Physiol Renal Physiol 310: F785–F795, 2016 26764204
15. Knauf F, Thomson RB, Heneghan JF, Jiang Z, Adebamiro A, Thomson CL, et al.: Loss of cystic fibrosis transmembrane regulator impairs intestinal oxalate secretion. J Am Soc Nephrol 28: 242–249, 2017 27313231
16. Knauf F, Asplin JR, Granja I, Schmidt IM, Moeckel GW, David RJ, et al.: NALP3-mediated inflammation is a principal cause of progressive renal failure in oxalate nephropathy. Kidney Int 84: 895–901, 2013 23739234
17. Debelle FD, Nortier JL, De Prez EG, Garbar CH, Vienne AR, Salmon IJ, et al.: Aristolochic acids induce chronic renal failure with interstitial fibrosis in salt-depleted rats. J Am Soc Nephrol 13: 431–436, 2002 11805172
18. Huang L, Scarpellini A, Funck M, Verderio EA, Johnson TS: Development of a chronic kidney disease model in C57BL/6 mice with relevance to human pathology. Nephron Extra 3: 12–29, 2013 23610565
19. Wang Z, Petrovic S, Mann E, Soleimani M: Identification of an apical Cl(-)/HCO3(-) exchanger in the small intestine. Am J Physiol Gastrointest Liver Physiol 282: G573–G579, 2002 11842009
20. Dawson PA, Russell CS, Lee S, McLeay SC, van Dongen JM, Cowley DM, et al.: Urolithiasis and hepatotoxicity are linked to the anion transporter Sat1 in mice. J Clin Invest 120: 706–712, 2010 20160351
21. Heneghan JF, Akhavein A, Salas MJ, Shmukler BE, Karniski LP, Vandorpe DH, et al.: Regulated transport of sulfate and oxalate by SLC26A2/DTDST. Am J Physiol Cell Physiol 298: C1363–C1375, 2010 20219950
22. Freel RW, Whittamore JM, Hatch M: Transcellular oxalate and Cl- absorption in mouse intestine is mediated by the DRA anion exchanger Slc26a3, and DRA deletion decreases urinary oxalate. Am J Physiol Gastrointest Liver Physiol 305: G520–G527, 2013 23886857
23. Dyer J, Hosie KB, Shirazi-Beechey SP: Nutrient regulation of human intestinal sugar transporter (SGLT1) expression. Gut 41: 56–59, 1997 9274472
24. Ferraris RP, Diamond J: Regulation of intestinal sugar transport. Physiol Rev 77: 257–302, 1997 9016304
25. Ko N, Knauf F, Jiang Z, Markovich D, Aronson PS: Sat1 is dispensable for active oxalate secretion in mouse duodenum. Am J Physiol Cell Physiol 303: C52–C57, 2012 22517357
26. Whittamore JM, Stephens CE, Hatch M: Absence of the sulfate transporter SAT-1 has no impact on oxalate handling by mouse intestine and does not cause hyperoxaluria or hyperoxalemia. Am J Physiol Gastrointest Liver Physiol 316: G82–G94, 2019 30383413
27. Chernova MN, Jiang L, Shmukler BE, Schweinfest CW, Blanco P, Freedman SD, et al.: Acute regulation of the SLC26A3 congenital chloride diarrhoea anion exchanger (DRA) expressed in Xenopus oocytes. J Physiol 549: 3–19, 2003 12651923
28. Alper SL, Stewart AK, Vandorpe DH, Clark JS, Horack RZ, Simpson JE, et al.: Native and recombinant Slc26a3 (downregulated in adenoma, Dra) do not exhibit properties of 2Cl-/1HCO3- exchange. Am J Physiol Cell Physiol 300: C276–C286, 2011 21068358
29. Clark JS, Vandorpe DH, Chernova MN, Heneghan JF, Stewart AK, Alper SL: Species differences in Cl- affinity and in electrogenicity of
SLC26A6 -mediated oxalate/Cl- exchange correlate with the distinct human and mouse susceptibilities to nephrolithiasis. J Physiol 586: 1291–1306, 2008 18174209
30. Capolongo G, Abul-Ezz S, Moe OW, Sakhaee K: Subclinical celiac disease and crystal-induced kidney disease following kidney transplant. Am J Kidney Dis 60: 662–667, 2012 22739230
