Secondary Logo

Journal Logo

Translational Science

Total HIV-1 DNA Dynamics and Influencing Factors in Long-Term ART-Treated Japanese Adults

A Retrospective Longitudinal Analysis

Stanoeva, Kamelia R. MD, MSc*; König, André PhD; Fukuda, Asami BSc; Kawanami, Yoko BSc*; Kuwata, Takeo PhD*; Satou, Yorifumi MD, PhD; Matsushita, Shuzo MD, PhD*

Author Information
JAIDS Journal of Acquired Immune Deficiency Syndromes: June 1, 2018 - Volume 78 - Issue 2 - p 239-247
doi: 10.1097/QAI.0000000000001662

Abstract

INTRODUCTION

With more than 36 million people living with HIV (PLHIV) worldwide,1 the number of patients on antiretroviral treatment (ART) and the health care costs are steadily rising. Therefore, the international HIV cure initiative2 targeted a therapy-free solution.3 Working on eradication or permanent control strategies3 requires long-term HIV persistence quantification and monitoring that are more informative than routine plasma viral load (VL) testing.

Many approaches are used to measure HIV in peripheral blood including quick polymerase chain reaction techniques to laborious viral outgrowth assays.4–17 Among them, total HIV DNA assays measure cell-associated HIV DNA (both integrated and nonintegrated) by quantifying replication-competent and defective proviruses.18 Although still unavailable worldwide as a standardized assay, total HIV DNA quantification is becoming cheaper and more accessible. It has been applied to cases of special interest including early therapy initiation in adults10,19–24 and infants,25–28 controlled treatment interruption,21,29 posttreatment controllers,30 and intensification of regimens.24,31 Data on such HIV DNA specifics are abundant, although not for the average patient on ART. Several studies described its levels in treated patients10,12,19,20,22,32–37 but were often restricted by single timepoint sampling, number of patients, or short-term treatment follow-up. Furthermore, recent cohorts included whites primarily, whereas data on Asians are insufficient. Much remains unknown about the long-term HIV reservoir characteristics,3 especially over multiple regimen switches, or in populations with comorbidities and coinfections.

Therefore, we undertook a retrospective observation of long-term treated HIV-positive Japanese adults to measure the dynamics of total HIV DNA levels over multiple timepoints throughout the ART course. We specifically targeted how the regimen affects total HIV DNA and how patients with hematological comorbidities and hepatitis C virus (HCV) compared with the rest of the group. We used a fast peripheral blood mononuclear cells (PBMC) DNA method for screening to provide a background for future studies on HIV-1 persistence mechanisms.

METHODS

Study Subjects

Overall, 155 PLHIV monitored in Kumamoto University Hospital were screened, and clinical records including demographics, laboratory data (CD4, CD8 cell counts, CD4/CD8 ratio, and HIV RNA VL), ART regimen history, and current status were collected. The eligibility criteria included adults older than 18 years, ART-treated with achieved viral suppression, and monitored for more than 3 years with minimum of 2 blood samples collected at different timepoints.

Antiretrovirals were classified by group: nucleoside and nonnucleoside reverse-transcriptase inhibitors (RTIs), protease inhibitors (PIs), entry inhibitors (EIs), and integrase inhibitors (INIs). “Outdated” label was added to filter antiretrovirals outside current clinical use. Outdated RTIs were stavudine, didanosine, and zidovudine, and outdated PIs were nelfinavir, indinavir, and fosamprenavir.

This study followed the principles of the Declaration of Helsinki and the Japanese Standards for Good Clinical Practice. The study protocol, consent forms, and other relevant documents were reviewed and approved by the Ethics Committee for Human Genome and Gene Analysis at the Faculty of Life Science, Kumamoto University (“Genome No. 248”).

Sample Preparation and Total HIV DNA Quantification

Blood samples collected between January 1992 and March 2016 were Ficoll-separated, and PBMCs were cryopreserved. Samples were selected as follows: at a date before ART initiation, at least 1 sample per regimen aiming at 1–3 months after any event (ART initiation, regimen change, treatment interruption, achieved viral suppression, and viral rebound), and at yearly intervals throughout uneventful treatment. PBMC DNA was extracted using the QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany).

Total HIV DNA was quantified by quantitative polymerase chain reaction (qPCR) (StepOne Plus machine; Applied Biosystems, Foster City, CA). Measurements were performed between May 2014 and March 2016 and preceded the 2016 Kumamoto earthquakes. Published primers6 for a conserved gag sequence (795gagF: GGTGCGAGAGCGTCAGTATTAAG and 911gagR: AGCTCCCTGCTTGCCCATA) were used as well as albumin (Alb) primers (AlbF: TGCATGAGAAAACGCCAGTAA and AlbR: ATGGTCGCCTGTTCACCAA). Thunderbird SYBR Green qPCR reagents (Toyobo, Osaka, Japan) were used with the following cycling conditions: 95°C (1 minute), 40 cycles of 95°C (15 seconds), and 60°C (1 minute), melting curve. Plasmids were constructed38 and validated as standards using ACH-2 cells (obtained through the NIH AIDS Reagent Program, Division of AIDS, NIAID, and NIH: ACH-2 from Dr. Thomas Folks39,40) as previously described by Douek et al.6 The method validation showed that the gag coefficient of variation [CV% calculated as (Ct SD/Ct Mean) × 100] was 0.39% at the 100 copies/million cells level and 0.75% at the 1 copy/million cells level. Serial dilutions from 106 to 10 copies/mL were used to construct a standard curve, and gag was detected at 1 copy/reaction mix.6 All samples were run in triplicate wells containing 1 µL template DNA and master mix up to a total volume of 12 µL. Data were initially analyzed with StepOne Plus Software v 2.2.2 (Applied Biosystems). Wells with a weak signal, lacking a reference ROX signal, insufficient melting (MELT) curve, or Ct >38 were excluded from the analysis, and where needed a sample run was repeated. Mean values were used to calculate cell counts (Alb mean/2) and viral DNA (gag mean). Total HIV DNA was calculated as gag copies/million PBMC.

Statistical Methods

For regression over time analysis, sample dates were assigned to 1 of 5 time intervals: pre-ART, first year of ART, second to fourth year of ART, fifth to seventh year of ART, and from the eighth year of ART onward. As reported by Besson et al,37 the slope of a simple regression model for each subject and time interval was calculated (imputation of the last sample date before the time interval and the first sample date after the time interval was used in cases of less than 2 data points per time interval and patient). Wilcoxon signed-rank tests were applied to test whether the slopes within a time interval were equal to 0 and whether the slope medians per hemophilia group were equal.

For therapy responses, a linear regression model was used to analyze the dynamics of total HIV DNA. The response variable was included on a logarithmic scale to meet the normality assumption of the model (natural logarithms were used in all logarithmic transformations). The complete model included the following as dependent variables: a baseline effect for each patient (individual intercept), the patient's age at the qPCR sample date [calculated as (date–birth date)/365.25], the CD4/CD8 ratio at the sample date (imputed to the nearest available date if no matching date available), a variable of clinical detection of HIV VL, the actual treatment at the sample date (ie, 7 dichotomous variables representing EIs, INIs, outdated PIs, PIs, outdated RTIs, RTIs, and interruption of therapy), the duration in years of each treatment regimen in the patient's medical history until the sample date [duration defined as (days under specified treatment from beginning of observation until qPCR sample date)/365.25], and all interaction terms of the former listed treatment-related variables with hemophiliac status. The regression model includes 91 covariables in total, of which 59 represent the baseline effect for each subject in the cohort (54 were significant with respect to the 5% significance level). The regression model resulted in an adjusted R2 of 0.88, ie, the model explains around 90% of the variance in the data. Because of the logarithmic regression [log (total HIV DNA per million)], each regression coefficient can be interpreted as factor exp (coefficient × variable) multiplied with the exp (baseline Patient ID coefficient) on the original scale. The R statistical software package, version 3.3.2 was used for all computation.

RESULTS

Participant Characteristics

Fifty-nine Japanese PLHIV met the study criteria and were included with 5548 records on CD4 counts, CD4/CD8 ratio, and/or VL along with 840 PBMC samples for polymerase chain reaction. Twenty-four patients initiating ART in the period 1995–2012 participated with pre- and on-treatment records and samples. Participants were divided into 2 groups: 36 infected via sexual contact plus 1 intravenous drug user (IVDU) and 22 infected via blood transfusions (Table 1). The latter were treated for hemophilia A, except for a single female with von Willebrand disease, and were all coinfected with HCV. The transfused group (also referred to as “hemophiliacs”) had higher mortality: 2 cases of HCV-induced liver failure and 1 multiorgan failure. Both groups had around 90% treatment coverage and more than a mean of 10 years of treatment (see Table 1 and Figure, Supplemental Digital Content 1, http://links.lww.com/QAI/B130).

TABLE 1
TABLE 1:
Characteristics of Japanese PLHIV Monitored and Treated Long Term at the Kumamoto University Hospital in the Period 1992–2016

Total HIV DNA Dynamics Vary Under ART and Differ by the Comorbidity Group

Total HIV DNA dynamics have been estimated using 1–5 timepoints.10,19,21,22,34,36,37,41,42 We used a mean of 14 samples/patient (min 3, max 28, and median 14 samples) to plot individual total HIV DNA dynamics over time. Surprisingly, total HIV DNA patterns followed decay on ART initiation and stable condition afterward,18,37 as well as showing variations and instability (see Tables A and B, Supplemental Digital Content 2, http://links.lww.com/QAI/B130). No hemophiliacs and 4 nontransfused patients (11%) had the previously described pattern. More than half of the transfused patients (59%) had unstable total HIV DNA levels compared with 27% showing stable levels with some fluctuations and 14% with stable levels throughout the ART. In the nontransfused group, there was a balance between unstable vs. stable and fluctuations vs. stable total HIV DNA levels: 27% vs. 35% vs. 35% (data unavailable for 1 patient, 3%). A single IVDU in the cohort (patient 29) showed a profile similar to other patients infected via sexual intercourse: total HIV DNA decay on ART initiation followed by relatively stable total HIV DNA levels with some fluctuations. In summary, total HIV DNA level dynamics were independent of HIV VL and showed individual fluctuations (Fig. 1) that could not be linked with other clinical events.

FIGURE 1
FIGURE 1:
Total HIV DNA profiles of 4 Japanese PLHIV. A, Patient 2, heterosexual, HIV-1/HCV coinfection, hemophilia A, mean total HIV DNA 385 copies/million PBMC for 19 years of treatment. B, Patient 128, heterosexual, HIV-1/HCV coinfection, hemophilia A, mean total HIV DNA 338 copies/million PBMC for 18 years of treatment. C, Patient 49, MSM, HIV-1 infection, mean total HIV DNA 531 copies/million PBMC for 15 years of treatment. D, Patient 77, MSM, HIV-1 infection, mean total HIV DNA 92 copies/million PBMC for 17 years of treatment. Antiretrovirals are shown at the top as follows: nucleoside and nonnucleoside RTIs—blue right diagonal lines, PIs—blue left diagonal lines, EIs—green horizontal lines, and INIs—black vertical lines. Drugs no longer in clinical use are marked as outdated: stavudine (d4T), didanosine (ddI), and zidovudine (AZT) as outdated RTIs—orange right diagonal lines, and nelfinavir (NFV), indinavir (IDV), and fosamprenavir (FPV) as outdated PIs—orange left diagonal lines. Detectable HIV RNA VL is shown as a VL event—red triangles. Total HIV DNA measurements are shown as open circles with black lines, whereas CD4/CD8 ratio dynamics are shown as blue dashed lines.

Regarding correlations with clinical monitoring,22 a significant negative correlation of total HIV DNA levels and CD4 counts (778 records, Pearson correlation coefficient −0.1193 and P = 0.0008) was found. The negative correlation was stronger for total HIV DNA loads and logCD4/CD8 ratio (771 records, correlation coefficient −0.2268 and P < 2 × 10−9). Therefore, a high CD4/CD8 ratio corresponded to a lower level of HIV DNA present in PBMC.

Total HIV DNA Levels Differ Insignificantly If Calculated by On-Treatment Mean

Total HIV DNA was detected in all PBMC samples as expected.18 Mean on-treatment total HIV DNA levels in the cohort varied (see Table, Supplemental Digital Content 3, http://links.lww.com/QAI/B130 and Figure, Supplemental Digital Content 4, http://links.lww.com/QAI/B130) but remained below 500 copies/million PBMC (mean 284, median 193, Q1 80, and Q3 354 copies/million PBMC). The combination of HCV and hematological comorbidity suggested an increase in total HIV DNA levels under treatment (mean 380, median 274, Q1 107, and Q3 339 copies/million PBMC for hemophiliacs vs. mean 227, median 171, Q1 49, and Q3 369 copies/million PBMC for nontransfused patients), although Welch t test analysis indicated no significant difference (t = −1.19, df = 24.94, P = 0.246, 95% CI: −416.80 to 111.96).

Total HIV DNA Dynamics Over Time Are Affected by Hemophilia

Although previous studies demonstrated the decay of HIV DNA levels on treatment,21,22,37 our data also showed long-term variability. Thus, we estimated the regression over time in a comparable manner37 for 58 patients with a known ART initiation date (Table 2). Although most patients had a negative slope over time, others did not. Furthermore, the number of negative slopes decreased over time when on ART. Hemophiliacs differed mostly during the first year or after 7 years on treatment. Curing HCV in a small group (interferon and early direct-acting antivirals-based regimens) did not bring a significant change in the total HIV DNA regression over time (Table 2). Thus, only hematological diseases slightly affected the regression course of total HIV DNA under treatment.

TABLE 2
TABLE 2:
Total HIV DNA Regression Slope Estimates Over Time on Therapy in Japanese PLHIV

Total HIV DNA Decreases on ART Initiation Regardless of the Regimen Type

A decrease in HIV DNA on ART initiation has been described18,21,37 but is not routinely used compared with HIV RNA VL. The baseline total HIV DNA level for 26 PLHIV with available sampling was a mean of 633 copies/million PBMC (min 10, max 3309, median 170, Q1 36, and Q3 839 copies/million PBMC). Treatment initiation decreased the total HIV DNA regardless of the regimen type (mean difference −286, min −2906, max 3364, median −65, Q1 −332, and Q3 3 copies/million PBMC). RTI- and PI-based regimens, including outdated drugs, had comparable effects on immune reconstitution and total HIV DNA levels (Table 3).

TABLE 3
TABLE 3:
ART Initiation Effects on CD4 Counts and Total HIV DNA Levels in 26 Japanese PLHIV Including 7 HIV-Infected via Blood Transfusion

In summary, by groups, the total HIV DNA on ART initiation was increased in hemophiliacs (mean difference 451, min −255, max 3364, median 4, Q1 −37, and Q3 57 copies/million PBMC) and decreased in nontransfused PLHIV (mean difference −558, min −2906, max 74, median −92, Q1 −850, and Q3 −10 copies/million PBMC).

Effect of Regimen Switching on Total HIV DNA Levels

We further investigated the effect of regimen switching on total HIV DNA and proposed a fitting mathematical model. Comparing our regression model estimates of maintaining a regimen for a year vs. switching (Table 4), we found significant differences between hemophiliacs and nontransfused patients. Hemophiliacs had considerably less favorable treatment effects on their total HIV DNA levels: switching and maintaining most regimens led to increases as did treatment interruption for a year. RTIs, in particular, caused a statistically significant increase of total HIV DNA in hemophiliacs. Sudden treatment interruptions in the hemophilia group increased the total HIV DNA to a level higher than that in nontransfused patients, although at 1 year, the difference was no longer significant. Introducing outdated regimens increased the reservoir in all patients. Nontransfused PLHIV experienced a higher impact: outdated PIs caused a statistically significant increase in HIV DNA on switching, maintaining for 1 year and in comparison with hemophiliacs (P < 0.05). RTIs in the nontransfused group led to a significant decrease in HIV DNA levels, whereas the outdated RTIs failed to do so. Newer drugs such as INIs and EIs decreased the total HIV DNA levels in nontransfused patients but failed to (INIs) or decreased them to a lesser extent (EIs) in transfused patients. Nonetheless, compared with the PI-related increase in HIV DNA, they had a more favorable effect in both patient groups.

TABLE 4
TABLE 4:
Regression Model Estimates for the Effects of Switching Antiretrovirals in Japanese PLHIV

DISCUSSION

We retrospectively measured the total HIV DNA levels in the PBMCs of 59 long-term ART-treated Japanese adults and estimated via a regression model the effects of treatment and switching between these regimens. Recent data on HIV DNA in the Japanese population are lacking,43,44 as well as follow-up on hemophiliacs infected with HIV and HCV via blood transfusions.43,45–47 The mean follow-up period in our cohort was greater than 10 years and supplemented previous cohorts covering a mean of 1–10.7 years.10,12,19,20,22,32–37,41,48,49 Moreover, with more than a mean of 800 samples and 14 timepoints/patient, we overcame the single timepoint bias and generated long-term profiles for the dynamics of total HIV DNA.

Previous studies described high pretreatment total HIV DNA levels: 20–3100 copies/million PBMC,19,24,29,31,32,34,50 and our results showing a decrease on ART initiation were similar. Given that total HIV DNA levels are low in early infection,20,24,31,50 we assumed that our cohort included both patients initiating ART with early and chronic infection. In the course of decade-long treatment, we observed a tendency toward stable total HIV DNA levels with patient-specific mean values. The mean of 284 (2.45 log10) copies/million PBMC in our patients was comparable with previous studies10,19,22,32,34 as were a few patients with 2-phase total HIV DNA decay.20,24,37 Hemophiliacs failed to suppress VL or to decrease total HIV DNA more often than nontransfused patients suggesting the urgent need for controlled studies of HIV persistence in patients with comorbidities.18

We propose a new regression modeling system and estimation of the effects of antiretrovirals on total HIV DNA levels. Such estimates, especially in prospective cohorts, might allow the tailoring of individual regimens. Small differences between switching and maintaining some regimens were attributed to stable HIV reservoir control51 as seen in simplification trials.51,52 Furthermore, high HIV DNA levels maintained over regimen switches in some patients might be an early sign of potential virological failure or other comorbidity issues. Hemophiliacs often showed total HIV DNA fluctuations and distinctively different responses than nontransfused patients by our regression model estimates. The role of HCV coinfection is yet to be clarified as being cured had no significant impact on total HIV DNA regression dynamics. Delayed ART initiation20–22 might also play a role: infections via contaminated blood products in Japan occurred in the 1980s, whereas the first antiretrovirals became available in the early 1990s.47,53

Our study had some limitations including its retrospective character. However, it was justified in the view of a lack of recent HIV DNA data or planned prospective observations in Japan. Our cohort was predominantly male and included 1 IVDU. Such ratios are common with men who have sex with men (MSM) and IVDU representing 57.3% and 0.4% of Japanese HIV infections reported in 2014.54 The diversity of regimens was another issue, and thus, we divided ART by groups with similar actions. Furthermore, total HIV DNA qPCR quantification in PBMC does not specifically target integrated replication-competent HIV, nor select CD4+ cells only.3,10,18 How and to what extent HIV DNA can reactivate is still being determined,3,55,56 and therefore, we opted for a broader definition of HIV reservoir.3,18,57 Moreover, total HIV DNA quantification did not discriminate between replication-competent and defective HIV proviruses.10,58 Although the latter are a large fraction unlikely to contribute to viral rebound during ART interruption, they are suspected to play a role in chronic immune activation and inflammation.17,59,60 Because high-volume blood samples were unavailable, we could not perform sequencing, integration site analysis,58 or RNA expression tests17 for all patients, which would have given further information on HIV proviral DNA characteristics and latency mechanisms.

Although the thresholds for total HIV DNA levels under treatment are yet to be defined, this method has shown promise as a useful predictor of disease progression, treatment response, and virological failure,21,29,50 as well as in guided treatment interruptions.21,61,62 Our study demonstrates that retrospective long-term total HIV DNA monitoring might also be applied to prospective cohorts focusing on regimen switching outcomes. Further directions also include prospective studies on specifics in patients with comorbidities/coinfections and a wider use of total HIV DNA as a clinical tool.

ACKNOWLEDGMENTS

The authors express their gratitude to Radka Argirova and Junko Hattori for their comments on the manuscript and useful discussions on the work; Nedyalko Vasilev for IT support throughout the cohort data processing; K. Tanaka for assisting the hospital data collection; Mohammad Saiful Islam for assisting the qPCR method validation; and Miki Tsukiashi, Chizu Kozuki, and Mikiko Shimizu for technical assistance. They sincerely thank the patients who participated in the Kumamoto cohort and their attending physicians and staff at the Kumamoto University Hospital. They also thank the Edanz Group (www.edanzediting.com/ac) for editing a draft of this manuscript.

REFERENCES

1. Joint United Nations Programme on HIV/AIDS (UNAIDS). Global AIDS update 2016. 2016. Available at: http://www.unaids.org/en/resources/documents/2016/Global-AIDS-update-2016. Accessed September 1, 2017.
2. Deeks SG, Autran B, Berkhout B, et al. Towards an HIV cure: a global scientific strategy. Nat Rev Immunol. 2012;12:607–614.
3. Deeks SG, Lewin SR, Ross AL, et al. International AIDS Society global scientific strategy: towards an HIV cure 2016. Nat Med. 2016;22:839–850.
4. Christopherson C, Kidane Y, Conway B, et al. PCR-based assay to quantify human immunodeficiency virus type 1 DNA in peripheral blood mononuclear cells. J Clin Microbiol. 2000;38:630–634.
5. O'Doherty U, Swiggard WJ, Jeyakumar D, et al. A sensitive, quantitative assay for human immunodeficiency virus type 1 integration. J Virol. 2002;76:10942–10950.
6. Douek DC, Brenchley JM, Betts MR, et al. HIV preferentially infects HIV-specific CD4+ T cells. Nature. 2002;417:95–98.
7. Brussel A, Sonigo P. Analysis of early human immunodeficiency virus type 1 DNA synthesis by use of a new sensitive assay for quantifying integrated provirus. J Virol. 2003;77:10119–10124.
8. Siliciano JD, Siliciano RF. Enhanced culture assay for detection and quantitation of latently infected, resting CD4+ t-cells carrying replication-competent virus in HIV-1-infected individuals. Hum Retrovir Protoc. 2005;304:003–016.
9. Laird GM, Eisele EE, Rabi SA, et al. Rapid quantification of the latent reservoir for HIV-1 using a viral outgrowth assay. PLoS Pathog. 2013;9:e1003398.
10. Eriksson S, Graf EH, Dahl V, et al. Comparative analysis of measures of viral reservoirs in HIV-1 eradication studies. PLoS Pathog. 2013;9:e1003174.
11. Strain MC, Lada SM, Luong T, et al. Highly precise measurement of HIV DNA by droplet digital PCR. Wu Y, ed. PLoS One. 2013;8:e55943.
12. Vandergeeten C, Fromentin R, Merlini E, et al. Cross-clade ultrasensitive PCR-based assays to measure HIV persistence in large-cohort studies. J Virol. 2014;88:12385–12396.
13. Procopio FA, Fromentin R, Kulpa DA, et al. A novel assay to measure the magnitude of the inducible viral reservoir in HIV-infected individuals. EBioMedicine. 2015;2:872–881.
14. Metcalf Pate KA, Pohlmeyer CW, Walker-Sperling VE, et al. A murine viral outgrowth assay to detect residual HIV type 1 in patients with undetectable viral loads. J Infect Dis. 2015;212:1387–1396.
15. Malatinkova E, Kiselinova M, Bonczkowski P, et al. Accurate quantification of episomal HIV-1 two-long terminal repeat circles by use of optimized DNA isolation and droplet digital PCR. J Clin Microbiol. 2015;53:699–701.
16. Hong F, Aga E, Cillo AR, et al. Novel assays for measurement of total cell-associated HIV-1 DNA and RNA. Caliendo AM, ed. J Clin Microbiol. 2016;54:902–911.
17. Wiegand A, Spindler J, Hong FF, et al. Single-cell analysis of HIV-1 transcriptional activity reveals expression of proviruses in expanded clones during ART. Proc Natl Acad Sci U S A. 2017;114:E3659–E3668.
18. Avettand-Fènoël V, Hocqueloux L, Ghosn J, et al. Total HIV-1 DNA, a marker of viral reservoir dynamics with clinical implications. Clin Microbiol Rev. 2016;29:859–880.
19. Garrigue I, Pellegrin I, Hoen B, et al. Cell-associated HIV-1-DNA quantitation after highly active antiretroviral therapy-treated primary infection in patients with persistently undetectable plasma HIV-1 RNA. AIDS. 2000;14:2851–2855.
20. Buzon MJ, Martin-Gayo E, Pereyra F, et al. Long-term antiretroviral treatment initiated at primary HIV-1 infection affects the size, composition, and decay kinetics of the reservoir of HIV-1-infected CD4 T cells. J Virol. 2014;88:10056–10065.
21. Williams JP, Hurst J, Stöhr W, et al. HIV-1 DNA predicts disease progression and post-treatment virological control. Elife. 2014;3:e03821.
22. Malatinkova E, De Spiegelaere W, Bonczkowski P, et al. Impact of a decade of successful antiretroviral therapy initiated at HIV-1 seroconversion on blood and rectal reservoirs. Elife. 2015;4:e09115.
23. Crooks AM, Bateson R, Cope AB, et al. Precise quantitation of the latent HIV-1 reservoir: implications for eradication strategies. J Infect Dis. 2015;212:1361–1365.
24. Ananworanich J, Chomont N, Eller LA, et al. HIV DNA set point is rapidly established in acute HIV infection and dramatically reduced by early ART. EBioMedicine. 2016;11:68–72.
25. Persaud D, Gay H, Ziemniak C, et al. Absence of detectable HIV-1 viremia after treatment cessation in an infant. N Engl J Med. 2013;369:1828–1835.
26. Luzuriaga K, Tabak B, Garber M, et al. HIV type 1 (HIV-1) proviral reservoirs decay continuously under sustained virologic control in HIV-1-infected children who received early treatment. J Infect Dis. 2014;210:1529–1538.
27. Uprety P, Chadwick EG, Rainwater-Lovett K, et al. Cell-associated HIV-1 DNA and RNA decay dynamics during early combination antiretroviral therapy in HIV-1-infected infants. Clin Infect Dis. 2015;61:1862–1870.
28. Frange P, Faye A, Avettand-Fenoël V, et al. HIV-1 virological remission lasting more than 12 years after interruption of early antiretroviral therapy in a perinatally infected teenager enrolled in the French ANRS EPF-CO10 paediatric cohort: a case report. Lancet HIV. 2016;3:e49–e54.
29. Yerly S, Gunthard HF, Fagard C, et al. Proviral HIV-DNA predicts viral rebound and viral setpoint after structured treatment interruptions. AIDS. 2004;18:1951–1953.
30. Sáez-Cirión A, Bacchus C, Hocqueloux L, et al. Post-treatment HIV-1 controllers with a long-term virological remission after the interruption of early initiated antiretroviral therapy ANRS VISCONTI Study. Lifson J, ed. PLoS Pathog. 2013;9:e1003211.
31. Ananworanich J, Schuetz A, Vandergeeten C, et al. Impact of multi-targeted antiretroviral treatment on gut T cell depletion and HIV reservoir seeding during acute HIV infection. Emery S, ed. PLoS One. 2012;7:e33948.
32. Izopet J, Salama G, Pasquier C, et al. Decay of HIV-1 DNA in patients receiving suppressive antiretroviral therapy. J Acquir Immune Defic Syndr Hum Retrovirol. 1998;19:478–483.
33. Finzi D, Blankson J, Siliciano JD, et al. Latent infection of CD4+ T cells provides a mechanism for lifelong persistence of HIV-1, even in patients on effective combination therapy. Nat Med. 1999;5:512–517.
34. Burgard M, Izopet J, Dumon B, et al. HIV RNA and HIV DNA in peripheral blood mononuclear cells are consistent markers for estimating viral load in patients undergoing long-term potent treatment. AIDS Res Hum Retroviruses. 2000;16:1939–1947.
35. Chun TW, Nickle DC, Justement JS, et al. HIV-infected individuals receiving effective antiviral therapy for extended periods of time continually replenish their viral reservoir. J Clin Invest. 2005;115:3250–3255.
36. Chomont N, El-Far M, Ancuta P, et al. HIV reservoir size and persistence are driven by T cell survival and homeostatic proliferation. Nat Med. 2009;15:893–900.
37. Besson GJ, Lalama CM, Bosch RJ, et al. HIV-1 DNA decay dynamics in blood during more than a decade of suppressive antiretroviral therapy. Clin Infect Dis. 2014;59:1312–1321.
38. Miyazato P, Katsuya H, Fukuda A, et al. Application of targeted enrichment to next-generation sequencing of retroviruses integrated into the host human genome. Sci Rep. 2016;6:28324.
39. Clouse KA, Powell D, Washington I, et al. Monokine regulation of human immunodeficiency virus-1 expression in a chronically infected human T cell clone. J Immunol. 1989;142:431–438.
40. Folks TM, Clouse KA, Justement J, et al. Tumor necrosis factor alpha induces expression of human immunodeficiency virus in a chronically infected T-cell clone. Proc Natl Acad Sci U S A. 1989;86:2365–2368.
41. Yerly S, Perneger TV, Vora S, et al. Decay of cell-associated HIV-1 DNA correlates with residual replication in patients treated during acute HIV-1 infection. AIDS. 2000;14:2805–2812.
42. Kiselinova M, De Spiegelaere W, Buzon MJ, et al. Integrated and total HIV-1 DNA predict ex vivo viral outgrowth. PLoS Pathog. 2016;12:e1005472.
43. Oka S, Urayama K, Hirabayashi Y, et al. Quantitative analysis of human immunodeficiency virus type-1 DNA in asymptomatic carriers using the polymerase chain reaction. Biochem Biophys Res Commun. 1990;167:1–8.
44. Oka S, Urayama K, Hirabayashi Y, et al. Quantitative estimation of human immunodeficiency virus type-1 provirus in CD4+ T lymphocytes using the polymerase chain reaction. Mol Cell Probes. 1991;5:137–142.
45. Takayama S, Taki M, Meguro T, et al. Virological characteristics of HCV infection in Japanese haemophiliacs. Haemophilia. 1997;3:131–136.
46. Tatsunami S, Taki M, Shirahata A, et al. The number of people in Japan with coagulation disorders: 2001 update. Int J Hematol. 2003;77:96–98.
47. Tatsunami S, Mimaya J, Shirahata A, et al. Current status of Japanese HIV-infected patients with coagulation disorders: coinfection with both HIV and HCV. Int J Hematol. 2008;88:304–310.
48. Viard JP, Burgard M, Hubert JB, et al. Impact of 5 years of maximally successful highly active antiretroviral therapy on CD4 cell count and HIV-1 DNA level. AIDS. 2004;18:45–49.
49. Furtado MR, Callaway DS, Phair JP, et al. Persistence of HIV-1 transcription in peripheral-blood mononuclear cells in patients receiving potent antiretroviral therapy. N Engl J Med. 1999;340:1614–1622.
50. Rouzioux C, Hubert JB, Burgard M, et al. Early levels of HIV-1 DNA in peripheral blood mononuclear cells are predictive of disease progression independently of HIV-1 RNA levels and CD4+ T cell counts. J Infect Dis. 2005;192:46–55.
51. Geretti AM, Arribas JR, Lathouwers E, et al. Dynamics of cellular HIV-1 DNA levels over 144 weeks of darunavir/ritonavir monotherapy versus triple therapy in the MONET trial. HIV Clin Trials. 2013;14:45–50.
52. Sarmati L, Parisi SG, Nicastri E, et al. Cellular HIV-1 DNA quantitation in patients during simplification therapy with protease inhibitor-sparing regimens. J Med Virol. 2007;79:880–886.
53. Swinbanks D. Documents confirm delays in Japanese HIV blood scandal. Nature. 1996;379:760.
54. Report to UNAIDS—HIV/AIDS trends in Japan. 2016. Available at: http://www.unaids.org/sites/default/files/country/documents/JPN_narrative_report_2016.pdf. Accessed October 5, 2016.
55. Ho YC, Shan L, Hosmane NN, et al. Replication-competent noninduced proviruses in the latent reservoir increase barrier to HIV-1 cure. Cell. 2013;155:540–551.
56. Noel N, Pena R, David A, et al. Long-term spontaneous control of HIV-1 relates to low frequency of infected cells and inefficient viral reactivation. J Virol. 2016;90:6148–6158.
57. Sloan RD, Wainberg MA. The role of unintegrated DNA in HIV infection. Retrovirology. 2011;8:52.
58. Cohn LB, Silva IT, Oliveira TY, et al. HIV-1 integration landscape during latent and active infection. Cell. 2015;160:420–432.
59. Klatt NR, Chomont N, Douek DC, et al. Immune activation and HIV persistence: implications for curative approaches to HIV infection. Immunol Rev. 2013;254:326–342.
60. Imamichi H, Dewar RL, Adelsberger JW, et al. Defective HIV-1 proviruses produce novel protein-coding RNA species in HIV-infected patients on combination antiretroviral therapy. Proc Natl Acad Sci U S A. 2016;113:8783–8788.
61. Nasi M, Pinti M, Manzini S, et al. Predictive value of intracellular HIV-1 DNA levels during CD4-guided treatment interruption in HIV+ patients. AIDS Res Hum Retroviruses. 2010;26:553–558.
62. Assoumou L, Weiss L, Piketty C, et al. A low HIV-DNA level in peripheral blood mononuclear cells at antiretroviral treatment interruption predicts a higher probability of maintaining viral control. AIDS. 2015;29:2003–2007.
Keywords:

HIV-1 DNA; HIV persistence; human; anti-HIV agents; hepatitis C; hemophilia A

Supplemental Digital Content

Copyright © 2018 Wolters Kluwer Health, Inc. All rights reserved.