Secondary Logo

Journal Logo

Impact of Allogeneic Hematopoietic Stem Cell Transplantation on the HIV Reservoir and Immune Response in 3 HIV-Infected Individuals

Koelsch, Kersten K. MD*,†; Rasmussen, Thomas A. MD, PhD; Hey-Nguyen, William J. BSc (Hons), PhD*; Pearson, Chester MBBS, BSc (Hons)*; Xu, Yin MSc, PhD*; Bailey, Michelle BSc*; Marks, Katherine H. BSc, BA, MPH; Sasson, Sarah C. BA, BSc (Hons), MBBS (Hons), PhD; Taylor, Mark S. MBBS(Hons), BSc(Hons), PhD; Tantau, Robyn AMS; Obeid, Solange AMS; Milner, Brad MBBS; Morrissey, Orla MB BCh, PhD§,‖; Pinto, Angie N. BSc, MBBS, MPHTM*,†; Suzuki, Kazuo BSc (Hons), PhD*,†; Busch, Michael P. MD, PhD; Keating, Sheila M. PhD; Kaiser, Philipp MD#,**; Yukl, Steven MD#,**; Wong, Joseph K. MD#,**; Hiener, Bonnie M. BMedSci (Hons)††; Palmer, Sarah PhD††,‡‡; Zaunders, John BSc (Hons), PhD*,†; Post, Jeffrey J. MBBS, PhD§§,‖‖,¶¶; Chan, Derek J. MB ChB, MM, MPH, PhD‖‖,##; Avery, Sharon MBBS (Hons)§; Milliken, Sam T. MBBS†,***; Kelleher, Anthony D. BSc (Hons), MBBS (Hons), PhD*,†; Lewin, Sharon R. MBBS (Hons), PhD‡,§; Cooper, David A. DSc, MD*,†

JAIDS Journal of Acquired Immune Deficiency Syndromes: July 1, 2017 - Volume 75 - Issue 3 - p 328–337
doi: 10.1097/QAI.0000000000001381
Basic Science
Free
SDC

Background: Allogeneic hematopoietic stem cell transplantation (HSCT) can lead to significant changes to the HIV reservoir and HIV immune responses, indicating that further characterization of HIV-infected patients undergoing HSCT is warranted.

Methods: We studied 3 patients who underwent HSCT after either reduced intensity conditioning or myeloablative conditioning regimen. We measured HIV antigens and antibodies (Ag/Ab), HIV-specific CD4+ T-cell responses, HIV RNA, and DNA in plasma, peripheral blood mononuclear cells, isolated CD4+ T cells from peripheral blood, and lymph node cells. The patients remained on antiretroviral therapy throughout the follow-up period.

Results: All patients have been in continued remission for 4–6 years post-HSCT. Analyses of HIV RNA and DNA levels showed substantial reductions in HIV reservoir–related measurements in all 3 patients, changes in immune response varied with pronounced reductions in 2 patients and a less dramatic reduction in 1 patient. One patient experienced unexpected viral rebound 4 years after HSCT.

Conclusions: These 3 cases highlight the substantial changes to the HIV reservoir and the HIV immune response in patients undergoing allogeneic HSCT. The viral rebound observed in 1 patient indicates that replication competent HIV can re-emerge several years after HSCT despite these marked changes.

*The Kirby Institute, UNSW Medicine, UNSW Australia, New South Wales, Australia;

St Vincent's Hospital, Sydney, Darlinghurst, New South Wales, Australia;

The Peter Doherty Institute for Infection and Immunity, Royal Melbourne Hospital, The University of Melbourne, Victoria, Australia;

§The Alfred Hospital, Melbourne, Victoria, Australia;

Monash University, Victoria, Australia;

Blood Systems Research Institute, San Francisco, CA;

#University of California, San Francisco, CA;

**Veterans Affairs Medical Centre, San Francisco, CA;

††The Westmead Institute for Medical Research, Westmead, New South Wales, Australia;

‡‡University of Sydney, Sydney, New South Wales, Australia;

§§Prince of Wales Hospital, Randwick, New South Wales, Australia;

‖‖The Albion Centre, Surry Hills, New South Wales, Australia;

¶¶Prince of Wales Clinical School, UNSW Medicine, UNSW Australia, New South Wales, Australia;

##School of Public Health, UNSW Medicine, UNSW Australia, New South Wales, Australia; and

***The Kinghorn Cancer Centre, Darlinghurst, New South Wales, Australia.

Correspondence to: Kersten K. Koelsch, MD, The Kirby Institute, UNSW Medicine, UNSW Australia, Level 6, Wallace Wurth Building, Sydney, NSW 2052, Australia (e-mail: kkoelsch@kirby.unsw.edu.au).

Supported by the Australian National Health and Medical Research Council (NHMRC) through a Program Grant 1052979 (D.A.C., A.D.K., S.R.L.) and Fellowships 1020536 (A.D.K.) and 1063422 (J.Z.) and 1042654 (S.R.L.), a grant from the St.Vincent's Clinic Foundation (K.K.K.). The Kirby Institute is funded by the Australian Government Department of Health & Ageing. S.R.L is funded by the Delaney AIDS Research Enterprise (DARE), National Institutes of Health (U19 AI096109 and U19 AI126611) and a High Impact Research Grant from the American Foundation for AIDS Research (109226-58-RGRL).

The authors have no conflicts of interest to disclose.

Supplemental digital content is available for this article. Direct URL citations appear in the printed text and are provided in the HTML and PDF versions of this article on the journal's Web site (www.jaids.com).

Received July 01, 2016

Accepted February 22, 2017

Back to Top | Article Outline

INTRODUCTION

Human immunodeficiency type-1 (HIV) infection persists despite antiretroviral therapy (ART). Cessation of ART is followed by viral rebound in most patients. Current knowledge suggests that rebounding virus is released from stable, long-lived reservoirs, which pose the primary obstacle toward a cure for HIV infection.1,2 The mechanisms underlying the establishment of HIV reservoirs in various cells and tissue compartments, and the maintenance of these reservoirs are currently under intense investigation. In parallel, new therapeutic strategies that target HIV persistence are in development, although at this stage with limited success.3

Allogeneic hematopoietic stem cell transplantation (HSCT) is a well-established therapeutic procedure for haematological malignancies, often the approach of choice in the context of clinical relapse after conventional chemotherapy. In 2008, 1 patient, Timothy Brown, also widely known as the “Berlin patient,” received an allogeneic HSCT using donor cells with a homozygous deletion in their C–C chemokine receptor type 5 (CCR5) gene (CCR5-Δ32/Δ32) making them resistant to HIV infection. Remarkably, ART was ceased in this patient after HSCT, and he has since not experienced viral rebound.4 Detailed studies of plasma, cells, and tissues from this patient were unable to convincingly detect any residual virus.5 This case has fueled hopes that for example, gene therapeutic approaches attempting to artificially induce CCR5 deficiency in stem cells or autologous CD4+ T cells might achieve significant reductions of the HIV reservoir. However, in another 6 patients who received an allogeneic HSCT with CCR5-Δ32/Δ32 donor cells this approach resulted in either early viral rebound and/or death within the first 12 months after HSCT.6,7

Furthermore, a study of 2 patients (the “Boston patients”) who underwent reduced intensity conditioning (RIC) and received an allogeneic HSCT without the inclusion of CCR5-Δ32/Δ32 cells reported significant changes in their HIV immune response and the HIV reservoir. In both patients, ART was temporarily ceased, but both experienced viral rebound requiring re-initiation of ART.8,9 Despite these disappointing outcomes, no other intervention in chronically infected patients has shown such a dramatic effect on the HIV reservoir, and therefore further investigations into the effects of allogeneic HSCT in the HIV-infected population are warranted.

Here, we report results from 3 patients residing in Australia who underwent allogeneic HSCT. Immune responses to HIV and the size of the HIV reservoir were characterized in detail in peripheral blood as well as lymphoid tissue.

Back to Top | Article Outline

METHODS

We studied 3 patients (A, B, and C) who underwent allogeneic HSCT with RIC (patients A and B) or myeloablative conditioning (patient C). This was an observational study, HSCT was performed because of hematological malignancies. Patient C was enrolled prospectively to study the impact of HSCT on HIV persistence before receiving HSCT, patients A and B were followed retrospectively. Blood (patients A, B, and C) and lymphoid tissue from fine-needle biopsies of peripheral (inguinal) lymph nodes (LNs, patients A and B only) were collected at several time points before and after allogeneic HSCT. HIV RNA and DNA in blood and tissues, HIV immune responses and drug levels in blood, and HIV sequencing were performed using either routine clinical laboratory assays or specific in-house assays as detailed in the supplementary methods section. All 3 patients provided written and informed consent to participate in the study. The study was approved by the St Vincent's Hospital, Sydney and The Alfred Hospital, Melbourne Human Research Ethics committees.

Back to Top | Article Outline

Patient Specific Findings

Patient A Clinical History

Patient A is a man, diagnosed with HIV infection in 1987 at age 22. In 2006, he was first treated with chemotherapy for a plasmablastic non-Hodgkin lymphoma (NHL). The lymphoma subsequently multiply relapsed including after an autologous stem cell transplant (a poor prognostic factor), and he received an unrelated human leukocyte antigen (HLA)-matched allogeneic HSCT in April 2010 (Fig. 1 patient A) with RIC (fludarabine/melphalan, FluMel). He has been on ART throughout the procedure and during follow-up. Post-HSCT this patient developed moderate-to-severe systemic acute and chronic graft versus host disease (GVHD), prolonged lymphopenia, and cytomegalovirus (CMV) reactivation. Other comorbidities include steroid-related osteopenia, squamous cell carcinoma of the tongue and anal squamous cell carcinoma. The patient had good donor engraftment post-HSCT with full donor chimerism. We only have CCR5 information posttransplant on this patient. Blood samples, as well as buccal swabs, were ± for CCR5 in this patient posttransplant.

FIGURE 1

FIGURE 1

Back to Top | Article Outline

Patient A HIV Related Findings

A pre-HSCT HIV-specific serology obtained in 2008 was positive on both chemiluminescence microparticle immunoassay (CMIA) and western blot analysis (Table 1 patient A). CMV serology obtained in 2010 was positive for IgG (203 IU/mL). Nearly 4 years after the HSCT (February 2014), the HIV-specific serology was markedly changed with moderate antigen and antibody (Ag/Ab) detectability by CMIA and enzyme immunoassay (EIA) and predominantly trace Ab detectability on the western blot. HIV RNA in plasma was undetectable at the same time point by standard diagnostic assay (Roche HIV test version 2.0) and by single copy real-time PCR (Fig. 1). HIV DNA was absent in peripheral blood CD4+ T cells post-HSCT in early 2014 on 2 occasions and by 3 separate assays (University of California, San Francisco UCSF, St Vincent's Hospital (SVH) and the Kirby Institute (KI) laboratory). HIV DNA was not quantified before HSCT (Fig. 1 patient A). CMV IgG Ab was positive pre- and post-HSCT. There was a very strong CD4+ T-cell response against CMV Ag in this patient while CD4+ T-cell responses against HIV Ag were absent post-HSCT.

TABLE 1

TABLE 1

Surprisingly, in late 2014 this patient experienced HIV rebound with HIV plasma virus RNA levels of >10,000,000 copies/mL and immunological seroconversion, with detectable HIV Ag/Ab levels by CMIA, EIA, and western blot (Fig. 1 patient A, Table 1 patient A). A small increase in HIV-Ab concentration was detected using the LS-Vitros Anti-HIV 1 + 2 assay (Fig. 2). HIV DNA was readily detectable in peripheral blood cells after the HIV rebound (Fig. 1). Sequencing analyses postviral rebound confirmed that the rebounding virus was phylogenetically related to the pretransplant virus (Fig. 3). No antiretroviral resistance mutations were detectable by genotypic resistance testing of the rebounding virus. The patient reported strict treatment adherence, but ART drug levels were profoundly reduced at the time of viral rebound, possibly attributable to poor drug absorption because of an exacerbation of gastrointestinal GVHD or undisclosed poor adherence (Table 2). Longitudinal changes in CD4+ and CD8+ T-cell counts are summarized in the Supplemental Digital Content Figure, http://links.lww.com/QAI/B3.

FIGURE 2

FIGURE 2

FIGURE 3

FIGURE 3

TABLE 2

TABLE 2

Back to Top | Article Outline

Patient B Clinical History

Patient B is a man, diagnosed with HIV infection in 2002 at age 49. The zenith HIV RNA was 9940 copies/mL and CD4+ T-cell nadir count was 270 cells/µL (15%). In 2004, he was diagnosed with stage 4 diffuse large B-cell lymphoma with predominant hepatic involvement, which was treated successfully with chemoradiation therapy. He subsequently commenced zidovudine/lamivudine/lopinavir/ritonavir. In 2009, he was diagnosed with acute myeloid leukemia (AML) with dysplastic features (possibly secondary to previous chemo-radiotherapy), and following chemotherapy went into dysplastic clonal remission with overall poor prognosis. In 2011, he relapsed with AML and myelodysplastic syndrome (MDS) and again achieved a remission with further chemotherapy. He then underwent an unrelated, HLA-matched allogeneic HSCT in May 2011 after RIC (FluMel) (Fig. 1 patient B). Post-HSCT this patient only developed mild and self-limiting GVHD (macular trunk/shoulder rash). The only other significant adverse event relating to the HSCT was a prolonged lymphopenia posttransplant. Nonhaematological comorbidities include HIV-associated neurocognitive disorder, a cerebral aneurysm, and cerebral toxoplasmosis. The recipient CCR5 gene PCR results were +/+ and he had full donor chimerism after HSCT. He is being treated with tenofovir/emtricitabine/raltegravir since 2012.

Back to Top | Article Outline

Patient B HIV-Related Findings

Pre-HSCT, HIV-specific serology was positive by both CMIA assays and western blot (Table 1). Posttransplant western blot analyses showed a profound reduction in HIV antibodies. In fact, no HIV antibodies were detectable by western blot in late 2014. The LS-Vitros Anti-HIV 1 + 2 assay showed very low and unchanging levels at 2 separate time points (Fig. 2). Some low-level reactivity was measured by the EIA assay [Genscreen 0.308 and 0.319 absorbance units (duplicates), with a cutoff at 0.124 absorbance units] and CMIA assay (Architect 1.27 and 1.37 S/CO, with a cutoff at 0.80). HIV RNA in plasma was undetectable throughout the follow-up post-HSCT by routine laboratory testing, and by the single copy assay in May 2014. Post-HSCT HIV DNA was undetectable in this patient in both peripheral blood CD4+ T cells (3 separate laboratories, UCSF, SVH, and KI), and in lymphocyte cells from peripheral LN fine-needle biopsies (performed at KI only). HIV DNA was not quantified in this patient before HSCT. In addition, cell-associated unspliced (CA-US) HIV RNA was also not detectable in neither peripheral blood CD4+ T cells nor lymphoid tissue (all results Fig. 1 patient B) post-HSCT. Longitudinal changes in CD4+ and CD8+ T-cell counts are summarized in the Supplemental Digital Content Figure, http://links.lww.com/QAI/B3.

Back to Top | Article Outline

Patient C Clinical History

Patient C is a man, diagnosed with HIV infection in 2004 at age 43 and initiated on ART (tenofovir, emtricitabine, and efavirenz) in Nov 2007. His nadir CD4+ T-cell count was 256/μL, his plasma HIV RNA levels peaked at 35,700 copies/mL before initiating ART. He was diagnosed with AML (FLT3+/NPM1+) in July 2012 and underwent induction chemotherapy with high-dose cytarabine/idarubicin and a single course of idarubicin/cytarabine/etoposide (Little ICE) consolidation chemotherapy. At start of induction chemotherapy efavirenz was switched to raltegravir while continuing tenofovir/emtricitabine to minimize drug–drug interactions. Induction chemotherapy was complicated by Candida glabrata fungaemia, treated with caspofungin. Complete remission was achieved after induction chemotherapy, but as he was at high risk of AML relapse he underwent a myeloablative HLA-matched sibling HSCT in October 2012 and was enrolled in a prospective observational study to quantify his HIV reservoir after HSCT. The conditioning regimen included cyclophosphamide and total-body irradiation; GVHD prophylaxis was with cyclosporin and methotrexate. The HSCT was complicated by mucositis, Clostridium difficile diarrhea and dapsone-induced methaemoglobinaemia. Although routine chimerism analysis showed 98% donor chimerism for CD34+ cells on day 150 post-HSCT, this declined to 89.5% 180 days post-HSCT. As a result immunosuppressive therapy was discontinued, precipitating mild oral and cutaneous (biopsy proven) GVHD. Both resolved with topical corticosteroid treatment. Repeat testing on day 210 post-HSCT showed 100% donor chimerism in all cell subsets. Both the donor and the recipient were CCR5 ± as assessed by PCR genotyping of recipient cells pretransplant and posttransplant.

Back to Top | Article Outline

Patient C HIV-Related Findings

Patient C had a CD4+ T-cell count of 168 cells/μL (43%) at the time of transplant, but this increased steadily, reaching 371 cells μL (29%) in 12 months post-HSCT (Fig. 1 patient C). The level of HIV DNA in peripheral blood mononuclear cells (PBMCs) immediately before HSCT was 15 copies/106 cells and 4 copies/106 cells 6 months after HSCT, where CA HIV DNA was not detected in one of 2 replicates. CA HIV DNA was not detected at 3 and 9 months after HSCT (quantification limit was 14 and 18 copies/106 cells, respectively). CA HIV DNA was detected pre-HSCT (39 copies/106 cells) in isolated CD4+ T cells, but was beneath the lower limit of detection in CD4+ T cells obtained 12 and 36 months post-HSCT. Levels of CA-US RNA were analyzed in PBMCs immediately before and 3, 6, and 9 months post-HSCT. CA-US RNA was detected at 1 copy per million cell equivalents pre-HSCT and again at 9 months post-HSCT at 1 copy per million cell equivalents. At 3 and 6 months post-HSCT CA-US RNA was not detected. In isolated CD4+ T cells, the pre-HSCT CA-US RNA level was 199 copies per million cell equivalents. CA-US RNA could not be detected in CD4+ T cells obtained at 12 and 36 months post-HSCT. After having achieved ART-induced viral suppression in 2007, plasma HIV RNA remained below 20 copies/mL until HSCT except for 1 measurement of 29 copies/mL in 2012. Furthermore, plasma HIV RNA was below the limit of detection of the clinical assay (AmpliPrep/COBASTaqMan HIV test version 2.0; limit of detection 20 copies/mL) when analyzed immediately before HSCT and 3, 6, 9, 12, and 36 months post-HSCT. Similarly, plasma HIV RNA remained below the limit of detection of the single copy assay (<0.3 or <0.5 per mL of plasma) pre-HSCT and 6 and 12 months post-HSCT. The results of serological analyses for patient C did, overall, not indicate any change in antibody quantity in the 12 months after HSCT (Table 1 patient C). Thus, HIV-specific serology was positive with both the Liaison XL Ag/Ab assay and western blot analyses before HSCT and when analyzed 6 and 12 months post-HSCT. However, HIV-Ab concentration measured by the LS-Vitros Anti-HIV 1 + 2 assay showed a moderate decrease 12 months following HSCT (Fig. 2). Longitudinal changes in CD4+ and CD8+ T-cell counts are summarized in the Supplemental Digital Content Figure, http://links.lww.com/QAI/B3.

Back to Top | Article Outline

DISCUSSION

In this study, we assessed the HIV-specific immune responses and virological correlates of HIV persistence in 3 patients who underwent allogeneic HSCT in Australia. In 2 of 3 patients (patients B and C), we have been unable to measure any virus posttransplant in plasma, CD4+ T cells (B and C) and LN tissue (B only), despite applying a range of sensitive assays. In addition, in patients A and B, we detected a remarkable reduction of HIV serological markers (Ags and Abs). These cases confirm the ability of allogeneic HSCT to profoundly reduce the HIV reservoir size below the sensitivity of PCR-based detection methods and prompt the question of: under what circumstances one might consider suggesting an analytic treatment interruption (ATI) to definitively assess the extent of HIV suppression or possible eradication.

While all 3 patients remained on ART throughout the transplant procedure and follow-up period, 1 patient (A) experienced HIV rebound together with a second HIV seroconversion despite very low HIV antibodies and undetectable HIV RNA and DNA before viral rebound. Sequencing of the rebounding viral RNA and available pretransplant RNA strongly suggested relatedness of these respective viral strains, indicating that a superinfection was unlikely. The patient reported strict drug adherence, but antiretroviral drug levels were low in this patient before viral rebound, possibly explained by poor drug absorption or nondisclosed poor adherence.

Patient B also continued ART and experienced an even more pronounced reduction in HIV-specific antibodies post-HSCT, no detectable HIV RNA in plasma by either routine as well as single copy real-time PCR assays, and no detectable CA HIV DNA or CA-US HIV RNA in both peripheral blood CD4+ T cells or lymphoid tissue.

In patient C, levels of CA-US HIV RNA and HIV DNA were low but consistently detectable before HSCT. Conversely, apart from 6 months after HSCT where HIV DNA was detected, no CA or plasma virus has been detected during the 36 months of follow-up after HSCT despite applying sensitive detection methods. Similar to the Berlin patient, patient C underwent myeloablative conditioning before HSCT, but most likely did not receive CCR5 deficient donor cells. Patient C patient was not interested in undergoing treatment interruption. Therefore, we discussed with him and agreed that there was therefore no indication to perform leukapheresis or tissue biopsies as even if these were both negative, he would still not be interested in discontinuing ART, given the current available knowledge of risks of an ATI in this setting.10 In addition to Timothy Brown, we note only few other cases of myeloablative allogeneic HSCT in a patient with HIV who subsequently went on to discontinue ART. One patient from Essen, Germany, who stopped ART before myeloablation and CCR5-Δ32/Δ32 HSCT but experienced viral rebound 3 weeks post-HSCT.6 This patient had preexisting X4 virus minority variants. Also, at the recent AIDS 2016 conference in Durban other cases of SCT from CCR5-Δ32/Δ32 were presented.11

There are a number of limitations to our study. First, patients A and B were only studied retrospectively; therefore, information on the donors are unavailable, as well as baseline measurements of the HIV reservoir in these patients are unavailable. Similarly, we do not have results for viral tropism studies on our patients, but given their CCR5 genotypes we believe that this information would not add significantly to the interpretation of the study results. Also, for all 3 patients, we did not perform more extensive blood sampling such as leukapheresis or gut-biopsies, or have donor CCR5 genotyping results; however, these are available for all 3 recipients. For patients A and B, inguinal LN biopsies have been performed. There are also limitations in regard to the detectability of HIV-1 DNA in blood specimen, or biopsies, using any type of real-time PCR or other assays. The frequencies of CD4+ T cells carrying HIV DNA can vary widely from 1 copy per 106 cells to 500–1000 copies per 106 cells, and these numbers depend on the patient samples analyzed and on the assays used (for an overview see12). Therefore, we cannot rule out residual HIV DNA in our patients definitively. In fact, it is, based on our current knowledge regarding HIV reservoirs, conceivable that some HIV DNA may persist in these patients, in particular in tissues. Nevertheless, compared with other interventions described to date, the effects on HSCT on the HIV reservoir size measured here are remarkable.

Persisting HIV reservoirs despite ART are the prime obstacle toward eradication. Hopes that HIV eradication, or a functional cure, might be attainable were fueled by the report of the Berlin Patient who underwent allogeneic HSCT with CCR5-Δ32/Δ32 donor cells.5 Reports from the 2 Boston patients8,9,13 who underwent allogeneic HSCT without homozygous CCR5 deletions demonstrated that the success obtained in the Berlin patient could not be repeated in these patients. The question as to which was the key factor leading to the success in the Berlin patient, ie, changes associated with transplantation of CCR5-Δ32/Δ32 donor cells, the pretransplant conditioning regimen (which was more intense for the Berlin patient than it was for either the Boston patients, or the patients described here), the degree of GVHD, or indeed a combination of these factors, is not definitively resolved.

To date, there are only very few other published cases of allogeneic HSCTs involving donor cells carrying the CCR5-Δ32/Δ32 deletion, and none of these were able to repeat the curative success of the Berlin patient.6,7 Further studies of HIV-infected patients undergoing HSCTs will be required to advance our understanding of the effects of transplantations with CCR5-Δ32/Δ32 donor cells, but also CCR5 wild-type or heterozygous deletions. It will be important to assess the effects of less intense pretransplant conditioning regimens and thus higher survival rates, and it will be important to further explore gene therapeutic approaches targeting the expression of CCR5. Continuation of ART to prevent the establishment of HIV infection in the transplanted stem cells seems to be a safe practice.14 Whether interventions to reduce the degree of acute GVHD and/or peritransplant treatment with, eg, CCR5 inhibitors may be beneficial by reducing the HIV reservoir size will also need to be tested. Finally, questions relating to possible coreceptor switching have not been definitively resolved and will also require further exploration.4,7,15

Taken together, the cases described here highlight the significant changes to both the HIV-specific immune responses, and/or the total HIV burden reflected by measures of both plasma HIV RNA and CA HIV RNA and DNA in peripheral blood and tissue, after allogeneic HSCTs. However, the viral rebound observed in patient A also show that, despite these considerable changes, HIV can rapidly re-emerge years after the transplant procedure, and together with the 2 Boston patients, strongly suggest that eradication, or even a reduction of the HIV reservoir to levels allowing for a “functional cure” via allogeneic HSCT, remains a very rare event.

Finally, the viral rebound observed in patient A in our study also confirms that the current measures of the HIV reservoir are quite likely to have a poor predictive value for possible viral rebound in absolute terms, in particular in patients with extremely small HIV reservoirs who have minimal HIV-specific T-cell responses, underlining that there is an urgent need to identify better markers predicting possible viral rebound, possibly through ATIs in the context of studies investigating curative therapeutic approaches for HIV infection.

Back to Top | Article Outline

SUPPLEMENTARY METHODS

Molecular and Serological Analyses

HIV RNA in plasma was measured by either the COBAS Amplicor HIV Monitor test version 1.5 (Roche Diagnostics, Castle Hill, NSW, Australia, detection limit 50 copies/mL), the COBAS AmpliPrep/COBASTaqMan HIV test version 2.0 (Roche Diagnostics, Castle Hill, NSW, Australia, detection limit 20 copies/mL), or by a real-time PCR assay with single copy sensitivity as previously described.16

HIV antibodies and p24 antigen (Ag/Ab) were measured by fourth generation chemiluminescence microparticle immunoassay (CMIA, Architect HIV Ag/Ab Combo assay; Abbott Diagnostics, North Ryde, NSW, Australia), and the presence of HIV antibodies was confirmed by EIA (Genscreen HIV/2 Version 2; Bio-Rad Laboratories, Gladesville, NSW, Australia). The presence of HIV p24 antigen was also confirmed using a separate enzyme immunoassay (Genscreen HIV P24 antigen EIA; Bio-Rad Laboratories). Western Blot analyses were performed by New LAV Blot I, (Bio-Rad Laboratories). A lower sensitivity (LS) modification of the Vitros Anti-HIV 1 + 2 assay (Ortho-Clinical Diagnostics, Rochester, NY) was used to determine HIV-Ab concentration.17

CMV antibodies (IgG) were measured using CMIA Abbott ARCHITECT i2000 SR immunoassay analyzer (Abbott Diagnostics, North Ryde, NSW, Australia).

HIV DNA and RNA in cells from peripheral blood CD4+ T cells were measured in 4 different laboratories:

Sydpath laboratory at St Vincent's Hospital, Sydney (HIV DNA only): Roche AMPLICOR HIV DNA test, version 1.5 (Roche Diagnostics, Castle Hill, NSW, Australia)

University of California, San Francisco (UCSF): Genomic DNA and total RNA was extracted using Trizol reagent (Ambion, Foster City, USA) according to the manufacturer's protocol. HIV DNA was quantified using a Taqman assay specific for the U5 region of the HIV 5′LTR.18 Briefly, PCR was performed using Taqman Gene Expression Mastermix (Life Technologies, Carlsbad, CA) and primers F (gcctcaataaagcttgccttga), R (gggcgccactgctagaga) and fluorescent probe (FAM-ccagagtcacacaacagacgggcaca-TAMRA) at a final concentration of 200 nM each in a total volume of 50 μL. Amplification was performed as follows: 10 minutes at 95°C, then 60 cycles of 15 seconds at 95°C and 1 minute at 59°C. Samples were measured in triplicates of up to 1 μg of total DNA. Cell-associated HIV RNA was quantified with a 1-step reverse-transcription (RT)-qPCR assay using the Taqman RNA-to-Ct 1-Step Kit (Life Technologies) and the same primers and fluorescent probe as for HIV DNA quantification.18 Reverse transcription was performed at 48°C for 30 minutes. Otherwise the reaction conditions were similar to the ones mentioned for qPCR.

Kirby Institute, UNSW Medicine: Cell-associated (CA) DNA and RNA were extracted using the Trizol Reagent (Life Technologies), using the back extraction buffer modification for DNA. Two real-time qPCR, specific to the pol19 or gag16 gene were used to quantify total levels of CA HIV DNA. HIV DNA copies were calculated by comparison with a set of plasmid (pNL4-3) standards and normalized for DNA input by the measurement of β-actin using the Taqman β-actin Detection Reagents Kit (Life Technologies).

Residual DNA was removed from extracted RNA by treatment with DNase I (Promega, Madison). CA-unspliced (CA-US) HIV RNA was quantified by RT-qPCR.16 HIV RNA copies were determined by comparison with a set of plasmid (pNL4-3) standards and normalized for RNA input by quantification of GAPDH by RT-qPCR (primers; forward TCG ACA GTC AGC CGC ATC TT and reverse GGC AAC AAT ATC CAC TTT ACC AG; and probe FAM-AAG GTC GGA GTC AAC GGA TTT GGT CGT-BHQ1).

Doherty Institute, The University of Melbourne, Melbourne: Levels of CA HIV DNA and CA-US HIV RNA were analyzed in PBMCs and isolated CD4+ T cells using a minimum input of 10 million PBMCs per time point assayed. For quantification of CA-US RNA, a seminested quantitative PCR was performed in quadruplicate as previously described.20 Quantification of cell-associated HIV DNA was performed with a single-round quantitative PCR in duplicate as previously described.21

Back to Top | Article Outline

CCR5 Gene PCR: Presence of Mutations in the CCR5 Gene Were Determined by PCR by 2 Assays

CCR5 PCR Assay I (Patients A and B)

Extracted genomic DNA from both patients and control DNA was amplified by PCR using the following primers: Forward: CCR5F: 5′TTCATTACACCTGCAGCTCTC3′, Reverse:CCR5R:5′TCACAGCCCTGTGCCTCTTC3'. The cycling conditions were 95°C for 2 minutes, then 94°C for 20 seconds, 61°C for 30 seconds, 72°C for 45 seconds over 45 cycles followed by 72°C for 10 minutes. The resulting PCR products were visualized on a 2.5% agarose gel.

Back to Top | Article Outline

CCR5 PCR Assay II (Patient C Only)

Genomic DNA from both patient and control samples was extracted using a Qiagen All prep RNA/DNA Minikit and amplified by PCR. Positive controls consisted of CCR5 wild-type DNA, CCR5-Δ32 homozygous DNA and CCR5-Δ32 heterozygous DNA. Negative control was nuclease free water. PCR reaction mix consisted of AmpliTaq Gold polymerase and 10μM CCR5 sense and antisense primers. Two microliters of sample each were added per reaction. PCR products were visualized on a 2% agarose gel.

Back to Top | Article Outline

HIV Sequence Analysis

Protease/reverse transcriptase regions were analyzed with either a commercial drug resistance assay (TRUGENE HIV Genotyping Kit, Visible Genetics, Inc., Toronto, Canada), according to the manufacturer's instructions, or an in-house drug resistance assay. The in-house assay, including the integrase region, consists of 2 reaction steps. In the initial reaction step, the extracted RNA from plasma was amplified by 1-step RT-PCR with Platinum Taq High Fidelity PCR kit (Invitrogen, Mt Waverley, VIC, Australia) for 30 minutes at 52°C, 2 minutes at 94°C, and 50 cycles of 15 seconds at 94°C, 30 seconds at 55°C, 1 min 30 seconds at 68°C using a forward primer: 5′- TGA TGA CAG CAT GYC ARG GAG T -3′ and a reverse primer: 5′- CTG CTA TTA ADT CTT TTG CTG GG -3′. In the second step, a nested PCR was performed with VELOCITY DNA Polymerase PCR kit (Bioline, Alexandria, NSW, Australia) using a forward primer: 5′- GAA GGA CAC CAA ATG AAA GAY TG -3′ and a reverse primer: 5′- GTA TGT CAT TGA CAG TCC AGC -3′ for 2 minutes at 98°C and 40 cycles of 30 seconds at 98°C, 30 seconds at 55°C, 1 minute 30 seconds at 72°C. The amplified DNA was subjected to a standard BigDye sequence analysis with 7 sequencing primes: Primer-1: 5′- GAA GGA CAC CAA ATG AAA GAY TG -3′, Primer-2: 5′- ATT GTT TAA CYT TTG GGC CAT CC -3′, Primer-3: 5′- TAG GAC CTA CAC CTG TCA ACA TAA TTG G -3′, Primer-4: 5′- CCA AAA GTT AAA CAA TGG CCA TTG ACA GA -3′, Primer-5: 5′- TCT AAA AGG CTC TAA GAT TTT TGT CAT GC -3′, Primer-6: 5′- GCT TCC ACA GGG ATG GAA AGG -3′, and Primer-7: 5′- CAG CAC TAT AGG CTG TAC TGT CCA -3′.

Phylogenetic analyses were undertaken: 18 local control individual sequences obtained from recent laboratory confirmed seroconverters; a subtype B reference sequence (B.FR.83.HXB2_LAI_IIIB_BRU_K03455); and 4 patient A sequences. Local control multiple sequences obtained from same individual within the calendar year to demonstrate intrapatient sequence variability. Sequence alignment was performed using Geneious 8.1.7, and manually edited using Bioedit Version 7.2.5. Phylogenetic inference—using Geneious 8.1.7 using Tanura-Nei Neighbor-Joining method with boostrap value of 100, and 95% support threshold.

Antigen-specific CD4+ T cells were measured using the CD25/CD134 upregulation assay, as previously described.22,23 Briefly, PBMC at 1 × 106/mL in Iscove's Modified Dulbecco's medium (Life Technologies) containing 10% human AB serum (Sigma) were cultured for 44–48 hours in the presence of (1) no antigen (negative control); (2) SEB (1 μg/mL; Sigma; positive control); (3) CMV lysate (1/500 dilution; grade III purified; Meridian); and (4) HIV Gag peptide pool (123 peptides from HXB2 sequence; each at 2 μg/mL; AIDS Reagent Program). At the end of the incubation, cells were stained with CD3-PerCP-Cy5.5, CD4-Alexa Fluor700, CD25-APC, and CD134-PE (BD Biosciences) and analyzed on a 4-laser LSR II flow cytometer (BD Biosciences). Antigen-specific CD4+ T cells were identified as CD3+CD4+CD25+CD134+, using gates set on the negative and positive controls, respectively, as previously described.22

Back to Top | Article Outline

Lopinavir Drug Levels

Lopinavir was assayed using reverse phase high-performance liquid chromatography (HPLC) with ultraviolet detection on a C18 analytical column (Shimadzu Prominence, Shimadzu, Rydalmere, NSW, Australia). Samples, standards, and controls were prepared by liquid/liquid extraction. The method has been validated to ISO 17025 criteria.

Back to Top | Article Outline

ACKNOWLEDGMENTS

We are grateful to the patients for their generous participation in this study. We would also like to thank Karen MacRae and Annabel Horne for their support in coordinating the study visits; Kim Grassi, Bertha Fsadni, Beth Catlett, Melanie Lograsso, Kate Merlin, and Ajantha Rhodes for laboratory support; Tracey Barrett for administrative support; and Drs Nenad Mecasic and Christina Chang for assistance in the protocol development and ethics application to The Alfred Hospital; and Julia Stout and Jennifer Audsley for administrative and ethics support of the HIV Cure Program at the Alfred Hospital and Doherty Institute.

Back to Top | Article Outline

REFERENCES

1. Richman DD, Margolis DM, Delaney M, et al. The challenge of finding a cure for HIV infection. Science. 2009;323:1304–1307.
2. Kent SJ, Reece JC, Petravic J, et al. The search for an HIV cure: tackling latent infection. Lancet Infect Dis. 2013;13:614–621.
3. Spivak AM, Planelles V. HIV-1 eradication: early trials (and tribulations). Trends Mol Med. 2016;22:10–27.
4. Hutter G, Nowak D, Mossner M, et al. Long-term control of HIV by CCR5 Delta32/Delta32 stem-cell transplantation. N Engl J Med. 2009;360:692–698.
5. Yukl SA, Boritz E, Busch M, et al. Challenges in detecting HIV persistence during potentially curative interventions: a study of the Berlin patient. PLoS Pathog. 2013;9:.
6. Kordelas L, Verheyen J, Beelen DW, et al. Shift of HIV tropism in stem-cell transplantation with CCR5 Delta32 mutation. N Engl J Med. 2014;371:880–882.
7. Hutter G. More on shift of HIV tropism in stem-cell transplantation with CCR5 delta32/delta32 mutation. N Engl J Med. 2014;371:2437–2438.
8. Henrich TJ, Hanhauser E, Marty FM, et al. Antiretroviral-free HIV-1 remission and viral rebound after allogeneic stem cell transplantation: report of 2 cases. Ann Intern Med. 2014;161:319–327.
9. Henrich TJ, Hu Z, Li JZ, et al. Long-term reduction in peripheral blood HIV type 1 reservoirs following reduced-intensity conditioning allogeneic stem cell transplantation. J Infect Dis. 2013;207:1694–1702.
10. Sugarman J, Lewin SR, Henrich TJ, Rasmussen TA. Ethics of ART interruption after stem-cell transplantation. Lancet HIV. 2016;3:e8–e10.
11. Wensing AM, Diez-Martin DL, Huetter GK, et al. Allogeneic stem cell transplantation in HIV-1-infected individuals; EPISTEM Consortium In: AIDS 2016. (Durban, South Africa).
12. Eriksson S, Graf EH, Dahl V, et al. Comparative analysis of measures of viral reservoirs in HIV-1 eradication studies. PLoS Pathog. 2013;9:.
13. Henrich TJ, Hanhauser E, Hu Z, et al. Viremic control and viral coreceptor usage in two HIV-1-infected persons homozygous for CCR5 Delta32. AIDS. 2015;29:867–876.
14. Johnston C, Harrington R, Jain R, et al. Safety and Efficacy of combination antiretroviral therapy in human immunodeficiency virus-infected Adults undergoing autologous or allogeneic hematopoietic cell transplantation for hematologic malignancies. Biol Blood Marrow Transplant. 2016;22:149–156.
15. Symons J, Vandekerckhove L, Hutter G, et al. Dependence on the CCR5 coreceptor for viral replication explains the lack of rebound of CXCR4-predicted HIV variants in the Berlin patient. Clin Infect Dis. 2014;59:596–600.
16. Palmer S, Wiegand AP, Maldarelli F, et al. New real-time reverse transcriptase-initiated PCR assay with single-copy sensitivity for human immunodeficiency virus type 1 RNA in plasma. J Clin Microbiol. 2003;41:4531–4536.
17. Keating SM, Hanson D, Lebedeva M, et al. Lower-sensitivity and avidity modifications of the vitros anti-HIV 1+2 assay for detection of recent HIV infections and incidence estimation. J Clin Microbiol. 2012;50:3968–3976.
18. Yukl SA, Shergill AK, Ho T, et al. The distribution of HIV DNA and RNA in cell subsets differs in gut and blood of HIV-positive patients on ART: implications for viral persistence. J Infect Dis. 2013;208:1212–1220.
19. Althaus CF, Gianella S, Rieder P, et al. Rational design of HIV-1 fluorescent hydrolysis probes considering phylogenetic variation and probe performance. J Virol Methods. 2010;165:151–160.
20. Elliott JH, Wightman F, Solomon A, et al. Activation of HIV transcription with short-course vorinostat in HIV-infected patients on suppressive antiretroviral therapy. PLoS Pathog. 2014;10:.
21. Lewin SR, Murray JM, Solomon A, et al. Virologic determinants of success after structured treatment interruptions of antiretrovirals in acute HIV-1 infection. J Acquir Immune Defic Syndr. 2008;47:140–147.
22. Zaunders JJ, Munier ML, Seddiki N, et al. High levels of human antigen-specific CD4+ T cells in peripheral blood revealed by stimulated coexpression of CD25 and CD134 (OX40). J Immunol. 2009;183:2827–2836.
23. Seddiki N, Cook L, Hsu DC, et al. Human antigen-specific CD4(+) CD25(+) CD134(+) CD39(+) T cells are enriched for regulatory T cells and comprise a substantial proportion of recall responses. Eur J Immunol. 2014;44:1644–1661.
Keywords:

HIV; reservoirs; stem cell transplant; immune response; stem cells

Supplemental Digital Content

Back to Top | Article Outline
Copyright © 2017 Wolters Kluwer Health, Inc. All rights reserved.