Secondary Logo

Journal Logo

Basic and Translational Science

Prevalence of HIV-1 Dual Infection in Long-Term Nonprogressor–Elite Controllers

Pernas, María PhD*; Casado, Concepción PhD*; Sandonis, Virginia PhD*; Arcones, Carolina BSc*; Rodríguez, Carmen PhD; Ruiz-Mateos, Ezequiel PhD; Ramírez de Arellano, Eva PhD§; Rallón, Norma PhD; Del Val, Margarita PhD§,¶; Grau, Eulalia BSc#; López-Vazquez, Mariola PhD; Leal, Manuel MD; Del Romero, Jorge MD; López Galíndez, Cecilio PhD*

Author Information
JAIDS Journal of Acquired Immune Deficiency Syndromes: November 1st, 2013 - Volume 64 - Issue 3 - p 225-231
doi: 10.1097/QAI.0b013e31829bdc85

INTRODUCTION

Human immunodeficiency virus type 1 (HIV-1) infection with more than 1 strain, termed dual infection (DI), includes coinfection (CO) and superinfection (SI). DI is occurring in HIV natural infections, and its prevalence in different groups of patients have yielded inconsistent results. One study found no evidence of HIV-1 DI/SI neither in a cohort of 718 highly active antiretroviral therapy–treated patients1 nor in 37 injecting drug user patients with high-risk behaviors.2 In contrast, other works in high-risk populations found DI/SI prevalences similar to those in primoinfection (14%)3 or (17%).4 However, no specific studies on the prevalence of DI in groups of patients with special clinical progression patterns have been reported.

According to viral load (VL), 3 groups of long-term nonprogressor (LTNP) patients have been defined as follows: noncontrollers (NC) (with VL >2000 copies/mL), viremic controllers (with VL from 50 to 2000 copies/mL), and elite controllers (EC) (VL <50 copies/mL).5 EC constitute a rare group of individuals, below 1% of the HIV-1–infected patients, of special interest because they are able to spontaneously control viral replication. In relation to the clinical consequences of DI in LTNPs, studies in LTNP-EC6 and in LTNP-viremic controller7,8 suggested that, in some cases, SI was associated with loss of viral control and accelerated disease progression. In contrast, a previous study by our group with 1 LTNP-EC, infected for more than 20 years, showed SI without clinical consequences.9 Loss of EC status was described in a patient who recovered the viremic control after SI, although with higher VL than before SI.10 Some authors associated control after SI to the presence of protective human leukocyte antigen (HLA) alleles,10 whereas our group linked the control to a combination of low replicating viruses and strong immune responses.11

Aside the sporadic cases of HIV DI in LTNPs,6–11 there are no specific studies about the prevalence of HIV DI in LTNP-EC patients, allowing the clarification of the clinical consequences of DI in this special group of patients. In this work, we analyzed the incidence and clinical consequences of DI in a cohort of 20 LTNP-EC patients. The presence of host genetic polymorphism and HLA-B alleles associated with viral control was analyzed.

METHODS

Patients and Samples

Twenty patients with available samples were kindly provided by the Centro de Salud Sandoval (Madrid), Fundació IrsiCaixa (Barcelona), Hospital Virgen del Rocio (Sevilla), Hospital Carlos III (Madrid), and by the HIV BioBank integrated in the Spanish AIDS Research Network (Red de Investigacion en SIDA [RIS]).12 All selected patients met the LTNP-EC criteria defined as patients with HIV-1 infection for more than 10 years (median: 22 years; range: 10–28), with undetectable VLs (<50 copies/mL) since the first HIV-1 detection, and without clinical symptoms in absence of therapy during the follow-up. All patients participating in the study gave their informed consent, and protocols were approved by the institutional ethical committees.

In general, a median of 15.5 samples were obtained from the 20 patients for a median of 10.2 years of follow-up, and 1–5 of these samples were subjected to phylogenetic analysis (see Table S1, Supplemental Digital Content, http://links.lww.com/QAI/A432). In particular, clinical follow-up of DI patients was performed in 13–21 samples for 2.5–17.2 years (Fig. 1; see Table S1, Supplemental Digital Content, http://links.lww.com/QAI/A432). In DI patients, except for patient 10246788, where only 1 sample was available for sequence analysis, 4–5 samples, marked with arrows in Figure 1, were subjected to phylogenetic analysis.

FIGURE 1
FIGURE 1:
Clinical follow-up of the HIV-1 DI-infected patients. In the 4 HIV-1 DI patients, CD4+ T-cell counts in cells per microliter (black squares) and VL copies per milliliter (gray circles) are represented in theY axis against time expressed as years (6–23) after diagnosis in the X axis. In patient EC4, we used a different time scale in X axis. In each patient, arrows indicate samples subjected to phylogenetic analysis.

Phylogenetic Analysis for Detection of HIV-1 DI

Patients's peripheral blood mononuclear cells were separated by Phycoll–hypaque centrifugation. Proviral DNA was obtained from 1 × 107 cells by a standard phenol extraction method. A fragment of 653 nucleotides in the C2-V5 region in env gene was amplified by Single Genome Amplification after nested polymerase chain reaction (PCR) as previously described.13 All PCRs were done using the Expand High Fidelity enzyme (Roche Applied Science, Basel, Switzerland). To exclude cross-contamination between patients and to ascertain the identification of patients, all positive PCRs from the same patient were amplified in the mitochondrial human gene 16s using the first PCR product as template. This amplification reaction was performed with Expand High Fidelity (Roche Applied Science) with primers 5′ ctccaccattagcacccaaagc 3′ and 5′ggggaacgtgtgggctatttagg 3′ (positions 15975 and 16527, respectively of the Homo sapiens mitochondrion, NCBI accession number 012920).

Nucleotide sequences were determined with the Big Dye Terminator Cycle in an ABI Prism 3730 XL Sequencer (Applied Biosystem, Life Technologies Corporation, Foster City, CA) in the Genomic Unit of the Centro Nacional de Microbiología–ISCIII. All nucleotide positions containing gaps were eliminated. Sequences were aligned and manually edited with Bioedit Sequence Aligment Editor Version 7.1.3.0 (DNASTAR Inc., Madison, WI) and Gblocks program14 was used to eliminate poorly aligned positions. Phylogenies were estimated using a maximum likelihood (ML) approach using the best-fit model of nucleotide substitution (general time reversible + G + I) implemented in MEGA 5 Software program.15 Internal branches support was tested in 100 bootstrap replicas. For the classification of single or DI infections, at least 6 sequences per patient were analyzed, and DI was identified when env sequences from the same patient were segregated in 2 or more different clusters of the ML phylogenetic tree.

Confirmation of HIV-1 DI in the Complete env Gene

To distinguish between DI and viral evolution, in cases where the sequences of the patient formed 2 or more clusters in the C2-V5 ML tree, the gp160 env gene (2010 nucleotide long) was amplified by Single Genome Amplification as previously described.13 Phylogenetic analysis was performed as above.

Host Genetic Factors, Clinical Data, and Epidemiological Markers From Patients

Host genetic polymorphisms, CCR5[INCREMENT]32 (rs333), CCR2V64I (rs1799864), HLA-C-35 (rs9264942) variant were studied for all patients as described.16–18 HLA typing was done by sequencing5 and by reverse strip dot-blot kit with sequence-specific oligonucleotide probes (Dynal RELISSO HLA-A and HLA-B typing kits, Dynal Biotech, Bromborough, United Kingdom) following the manufacturer’s instructions.

During patient’s follow-up, age, years after diagnosis, gender, transmission route, and clinical and immunological parameters, like the CD4+ T-cell and CD8+ T-cell counts and CD4+/CD8+ ratios, were recorded for all patients in every sample. These parameters and its median were compared between the dual and single infected groups of patients. With the values obtained during the follow-up, a regression analysis of the median of the CD4+/CD8+ ratios and time since diagnosis was carried out for the single infected patients.

Statistical Analysis

Epidemiological and host characteristics were compared between single and DI patients. For the comparison, a statistical analysis was performed with the nonparametric Mann–Whitney U test with a restrictive significance at the 95%. Slopes of CD4+/CD8+ ratio for single infected patients against years after diagnosis were calculated by linear regression with a 95% of confidence using GraphPad Prism V 4.0 software or SPSS19 Statistic software (IBM, Armonk, NY). The P values of <0.05 were considered statistically significant.

RESULTS

Prevalence of HIV-1 DI in LTNP-EC Patients

For the study of DI in LTNP-EC patients, multiple envelope sequences were subjected to ML phylogenetic analysis. The phylogenetic analysis, performed in the C2-V5 region of env gene, included 333 unique sequences of which 237 were from the 20 LTNP-EC patients and the remaining from Spanish LTNPs, chronic patients, and from reference viruses of B and D subtypes (Fig. 2). This analysis showed that all patients were infected with subtype B viruses. Nucleotide sequences obtained from the LTNP-EC formed monophyletic groups with significant bootstrap values above 80%, except for 9 patients, 56, EC3, EC4, MDM, 10246788, 5, 2057906, 20020753, and 3227058 (Fig. 2). Although 4 of them, patients 56, EC3, 2057906, and 20020753 clustered in monophyletic groups but with bootstrap values below 80%, 5 patients EC4, MDM, 10246788, 5, and 3227058 had nucleotide sequences segregated in 2 or 3 different clusters with bootstrap above 80% (Fig. 2). Then, these last individuals were considered as potential DI patients.

FIGURE 2
FIGURE 2:
Phylogenetic tree in the C2-V5 env region. The sequence analysis was carried out by the Maximum Likelihood method using an heuristic search. All nucleotide positions containing gaps were eliminated. The analysis included 333 nucleotide sequences that comprised quasispecies sequences (237 sequences) from the 20 LTNP-EC patients, 67 sequences from 31 LTNPs Spanish patients and 26 sequences from HIV-1 Spanish patients with chronic infection. Two subtype B (Spanish 89SP061 virus, GeneBank accession number AJ006287 and, B.FR.83. HXB2, K03455) marked by (★) were included. A subtype D sequence (D.CD.83.ELI, K03454I) marked by (★) was used as outgroup. Sequences were obtained from the Los Alamos National Laboratory (LANL) database (http://www.hiv.lanl.gov). Only bootstrap values above 80% are marked. Patients with bootstrap below 80% but clustering in a single cluster are underlined and in italic with the following symbols: 56 [Black Square], 2057906 [Black Down-Pointing Triangle], 20020753 [White Diamond] and EC3 □. Potentially DI patients are marked in bold and with the following symbols: EC4 •, MDM [Black Square], 10246788 ○, 5 •, and 3227058[Black Down-Pointing Triangle]. Bar shows the genetic distance.

Viral evolution can generate among sequences within patients high genetic distances that could be misinterpreted, in some circumstances, as infection by 2 distinct viruses. To clarify this misinterpretation, phylogenetic analysis of a longer fragment is recommended. Accordingly, the complete gp160 env gene was amplified in the 5 potential DI patients and in adequate controls. After this analysis, sequences of 3227058 patient formed a single phylogenetic group in the tree and then was considered a single infected individual (Fig. 3). Sequences of patients MDM, 10246788, and 5 segregated in 2 different clusters of the tree with high bootstrap value (>90%) confirming that these patients were indeed HIV-1 DI patients (Fig. 3).

FIGURE 3
FIGURE 3:
Phylogenetic tree in the gp160env gene. The sequence analysis of the complete env sequences from the patients was carried out by the maximum likelihood method using an heuristic search. The analysis included 101 nucleotide sequences, 37 from the LTNP-EC patients, 48 from LTNP patients, and 13 from Spanish patients with chronic infection. Two subtype B (Spanish 89SP061 virus, geneBank accession number AJ006287 and, B.FR.83. HXB2, K03455) marked by (★) were also included. A subtype D sequence (D.CD.83.ELI, K03454I) marked by (★) was used as outgroup. Sequences were obtained from the LANL database (http://www.hiv.lanl.gov). DI patients are marked as in Figure 2. Bar indicates the genetic distance.

In patient EC4, phylogenetic tree of the C2-V5 region (Fig. 2) displayed 3 groups of sequences, 2 groups (a and b), with several sequences in each group and a third group (c) with only 1 sequence. The c sequence showed a high genetic distance (8%) to all the other sequences obtained in the same sample, making unlikely that it is the result of viral evolution (Fig. 2). However, when the complete gp160 was analyzed, only 1 group of sequences was obtained with sequences from groups a and b. Sequences for the third c group were not detected. Probably this sequence could not be amplified in the larger fragment due to its low proportion in the patient quasispecies (only 1 of 45 sequences in the shorter fragment). Despite this lack of confirmation, patient EC4 was considered a DI patient. In summary, 4 (MDM, 10246788, 5, and EC4) of the 20 (20%) LTNP-EC were identified as HIV-1 DI patients (Fig. 3).

Epidemiological and Clinical Characteristic of the Patients

For the study of potential epidemiological factors associated with DI, age, years after diagnosis, gender, and transmission route were examined (Table 1), but no statistical significant differences were observed between single infected (n = 16) and DI patients (n = 4). As drug use was the predominant route of infection in the beginning of AIDS epidemic in Spain,19 intravenous drug use was the most frequent route of transmission in both groups (62% and 75%, respectively) (Table 1).

TABLE 1
TABLE 1:
Epidemiological characteristics of the Patients

Genetic polymorphisms associated with slow progression like CCR5Δ32, CCR2V64I, and HLA-C-35 were also analyzed in the patients. No statistical significant differences in the prevalence of these polymorphisms were observed between groups (Table 2). The frequency of protective alleles (HLA-B*57 or B*27) was high in both single and DI patients (71% and 50%, respectively). This was an expected result because all patients were LTNP-EC (Table 2). There was a statistical significant overrepresentation (P = 0.022) of the HLA-B*35 allele in the DI patients in comparison to single infected patients (Table 2).

TABLE 2
TABLE 2:
Host Genetic Characteristics of the Patients

Clinical Consequences of HIV-1 DI

Regarding clinical consequences of HIV-1 DI, 3 the 4 DI patients (MDM, 5, and 10246788) maintained the status of LTNP-EC despite DI (Fig. 1). These patients controlled viral replication with VLs below 50 copies per milliliter after more than 20 years of HIV diagnosis (Fig. 1). Patient EC4, whose VL was <20 copies per milliliter for 15 years, suffered a peak of viremia of 13,900 copies per milliliter. VL dropped to 1730 copies per milliliter 1 year later; because this patient lost its EC status during follow-up, only the CD4+ T-cell and CD8+ T-cell counts and CD4+/CD8+ values obtained although the patient VL fulfilled the LTNP-EC criteria were included in the study.

Clinical and immunological parameters during the patient’s follow-up are represented in Figure 4. Median of CD4+ T-cell counts (Fig. 4A) were not different between single and DI patients (median: 997; range: 597–1355 and median: 925; range: 393–1190, respectively). Median of CD8+ T-cell counts were higher and with statistical significance (P < 0.02) in the DI group (median: 1213; range: 882–2438) compared with the single infected patients (median: 808; range: 234–1227) (Fig. 4B). When the median of CD4+/CD8+ ratio was compared between groups, DI patients showed a lower value (median: 0.8; range: 0.2–1) than single infected patients (median: 1.3; range: 0.6–3.0) (P < 0.01) (Fig. 4C). A linear regression analysis was carried out between the median of CD4+/CD8+ and years after diagnosis resulting in a negative slope of −0.076 (95% of confidence) and a statistical significance of P <0.05. The CD4+/CD8+ ratio of the DI patients was projected into the linear regression plot, and the corresponding points were localized outside or in the boundaries of the 95% confidence intervals. Taking into account the number of years (26, 24, 20, and 18) after HIV-1 diagnosis in the DI patients for patient 5, MDM, 10246788, and EC4, respectively, the CD4+/CD8+ values extrapolated from the linear regression should be 1.13, 1.28, 1.58, and 1.73, respectively. These extrapolated values were much higher than the observed values in these patients 0.72, 0.9, 1, and 0.2, respectively, confirming that DI patients showed lower CD4+/CD8+ ratio than expected. These low ratios were mainly contributed by an increase in the CD8+ T-cell counts.

FIGURE 4
FIGURE 4:
Comparison of the clinical and immunological parameters between single and DI patients. Median of CD4 T+ and CD8 T+ cell counts expressed in cells per microliter for single ([Black Square]) and DI ([Black up-pointing triangle]) patients recorded during the patient follow-up are represented in panels A and B. Panel C represents the median CD4+/CD8+ ratio in both groups. TheP values for comparison between both groups were calculated using a 2-tailed Mann–Whitney test, and significant values are marked with (**). In panel D, years after diagnosis for single infected patients during the follow-up were plotted in the X axis against the median of CD4+/CD8+ ratio in the Y axis ([Black Square]). A linear regression analysis was performed and the 95% confidence intervals are shown. CD4+/CD8+ ratios of the DI patients are represented by triangles ([Black up-pointing triangle]). In all panels, values corresponding to patient EC4 data are marked with an asterisk (*).

DISCUSSION

The prevalence and clinical consequences of HIV-1 DI in LTNP-EC are poorly established because of the lack of specific studies. In this work, in a group of 20 LTNP-EC, 4 (20%) cases of DI were detected. This prevalence was similar to the prevalence observed in other groups of patients with chronic progression.3,20

Studies during primary infection in cohorts of men having sex with men with high-risk practices detected cases of DI in 10 (27%) of 37 individuals21 or even higher 11 (38%) of 29 individuals.22 A recent study with 110 Kenyan women detected 20 (18%) cases of SI.23 The first study to directly compare HIV SI prevalence in a general heterosexual population showed that SI occurred at approximately the same rate (18.2%) as the incidence of primary HIV-1 infection.24 The prevalence of DI in the present study (20%) suggested that LTNP-ECs are as susceptible as HIV-1 chronic progressor patients to HIV-1 DI.

DIs have been associated with diverse clinical consequences in chronic progressor patients25–27 and in LTNP patients.6,7,9–11 In this work, no differences in CD4+ T-cell counts between dual or single infected patients were found (Fig. 4). However, a statistical difference in the CD8+T cells and the CD4+/CD8+ ratio was observed between single and DI patients (Fig. 4). Increases in CD8+ T cells have been previously reported in a LTNP patient after SI.10 In addition, in another retroviral infection where cats were experimented DI with feline immunodeficiency virus also showed higher CD8+ T-cell numbers than the single infected cats.28 In the single infected patients, there is a significant negative correlation between time since first HIV-1 diagnosis and the rate of CD4+/CD8+ (Fig. 4). The DI patients did not follow this correlation showing values below those of the single infected patients. The increase of CD8+ numbers and lower CD4+/CD8+ ratios in LTNPs-EC DI patients could be a marker of HIV-1 DI and point to the potential pathogenic consequences of HIV DI.

Another important finding of the study is that 3 of 4 DI LTNP-EC patients did not lose the clinical nonprogressor characteristic. This result indicated that LTNP-EC patients were able to effectively control viral replication of 2 different viruses. Control of viral replication in LTNPs has been associated with host genetics, efficient immune response, and viral factors individually or in combination.11,29,30 The most relevant host factors associated with viral control in HIV-1–infected patients are certain major histocompatibility complex class I group B and HLA I alleles.31 Among them, HLA B*57, B*27, and B*58 haplotypes are consistently overrepresented in LTNP patients29; and they were present in 2 of the DI patients (Table 2). DI patients showed, in addition, different combinations of host genetic polymorphism like CCR2V64I, CCR5Δ32, HLA-C-35 implicated in clinical control (Table 1). Infection by low fitness viruses has been found in LTNP patients.11,32 In one of the DI patients (MDM), we previously described a combination of a strong cellular and humoral immune responses but also infection by low replicating viruses.11

The HLA typing permitted the detection of the HLA-B*35 allele in 3 of the 4 DI patients. This HLA-B*35 allele has also been found more frequently in SI patients.33 Further studies with larger number of patients should be carried out to confirm the presence of this allele in HIV-1 DI patients and to investigate how this allele could facilitate DI.

This is the first study that specifically investigates DI in LTNP-EC patients. Although the number of DI patients is limited, because they represent less than 1% of infected patients, we detected similar prevalence of DI than in other groups of patients. In these DI patients we noticed high levels of CD8+ T cells, low CD4+/CD8+ ratio and the presence of HLA-B*35 allele. Confirmation of these results in larger number of patients and specific studies on the role of these markers could give important information on HIV-1 DI.

ACKOWNLEDGMENTS

The authors acknowledge the critical reading of the article by J. M. Benito, Monica Gutierrez-Rivas, and Isabel Olivares. The authors thank the Genomic Unit in the Centro Nacional de Microbiología for the nucleotide sequencing. The authors want to particularly acknowledge the patients in this study for their participation and to the HIV BioBank integrated in the Spanish AIDS Research Network and collaborating Centers for the generous gifts of clinical samples used in this work.

REFERENCES

1. Gonzales MJ, Delwart E, Rhee SY, et al.. Lack of detectable human immunodeficiency virus type 1 superinfection during 1072 person-years of observation. J Infect Dis. 2003;188:397–405.
2. Tsui R, Herring BL, Barbour JD, et al.. Human immunodeficiency virus type 1 superinfection was not detected following 215 years of injection drug user exposure. J Virol. 2004;78:94–103.
3. Chohan B, Lavreys L, Rainwater SM, et al.. Evidence for frequent reinfection with human immunodeficiency virus type 1 of a different subtype. J Virol. 2005;79:10701–10708.
4. Piantadosi A, Chohan B, Chohan V, et al.. Chronic HIV-1 infection frequently fails to protect against superinfection. PLoS Pathog. 2007;3:e177.
5. Casado C, Colombo S, Rauch A, et al.. Host and viral genetic correlates of clinical definitions of HIV-1 disease progression. PLoS One. 2010;5:e11079.
6. Clerc O, Colombo S, Yerly S, et al.. HIV-1 elite controllers: beware of super-infections. J Clin Virol. 2010;47:376–378.
7. Braibant M, Xie J, Samri A, et al.. Disease progression due to dual infection in an HLA-B57-positive asymptomatic long-term nonprogressor infected with a nef-defective HIV-1 strain. Virology. 2010;405:81–92.
8. Fang G, Weiser B, Kuiken C, et al.. Recombination following superinfection by HIV-1. AIDS. 2004;18:153–159.
9. Casado C, Pernas M, Alvaro T, et al.. Coinfection and superinfection in patients with long-term, nonprogressive HIV-1 disease. J Infect Dis. 2007;196:895–899.
10. Rachinger A, Navis M, van Assen S, et al.. Recovery of viremic control after superinfection with pathogenic HIV type 1 in a long-term elite controller of HIV type 1 infection. Clin Infect Dis. 2008;47:e86–e89.
11. Pernas M, Casado C, Arcones C, et al.. Low-replicating viruses and strong anti-viral immune response associated with prolonged disease control in a superinfected HIV-1 LTNP elite controller. PLoS One. 2012;7:e31928.
12. Garcia-Merino I, de Las Cuevas N, Jimenez JL, et al.. The Spanish HIV BioBank: a model of cooperative HIV research. Retrovirology. 2009;6:27.
13. Sandonis V, Casado C, Alvaro T, et al.. A combination of defective DNA and protective host factors are found in a set of HIV-1 ancestral LTNPs. Virology. 2009;391:73–82.
14. Castresana J. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol. 2000;17:540–552.
15. Tamura K, Peterson D, Peterson N, et al.. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 28:2731–2739.
16. Bello G, Casado C, Sandonis V, et al.. A subset of human immunodeficiency virus type 1 long-term non-progressors is characterized by the unique presence of ancestral sequences in the viral population. J Gen Virol. 2005;86:355–364.
17. Alagarasu K, Selvaraj P, Swaminathan S, et al.. CCR2, MCP-1, SDF-1a & DC-SIGN gene polymorphisms in HIV-1 infected patients with & without tuberculosis. Indian J Med Res. 2009;130:444–450.
18. van Manen D, Kootstra NA, Boeser-Nunnink B, et al.. Association of HLA-C and HCP5 gene regions with the clinical course of HIV-1 infection. AIDS. 2009;23:19–28.
19. Casado C, Urtasun I, Saragosti S, et al.. Different distribution of HIV type 1 genetic variants in European patients with distinct risk practices. AIDS Res Hum Retroviruses. 2000;16:299–304.
20. Piantadosi A, Ngayo MO, Chohan B, et al.. Examination of a second region of the HIV type 1 genome reveals additional cases of superinfection. AIDS Res Hum Retroviruses. 2008;24:1221.
21. Cornelissen M, Pasternak AO, Grijsen ML, et al.. HIV-1 dual infection is associated with faster CD4+ T-cell decline in a cohort of men with primary HIV infection. Clin Infect Dis. 2012;54:539–547.
22. Pacold M, Smith D, Little S, et al.. Comparison of methods to detect HIV dual infection. AIDS Res Hum Retroviruses. 2010;26:1291–1298.
23. Ronen k, McCoy C, Matsen F, et al.. Detection of frequent superinfection among Kenyan women using ultra-deep pyrosequencing. Paper presented at: 19th Conference on Retrovirus and Opportunistic Infections; 2012; Seattle, WA.
24. Redd AD, Collinson-Streng A, Martens C, et al.. Identification of HIV superinfection in seroconcordant couples in Rakai, Uganda, by use of next-generation deep sequencing. J Clin Microbiol. 2011;49:2859–2867.
25. Gottlieb GS, Nickle DC, Jensen MA, et al.. Dual HIV-1 infection associated with rapid disease progression. Lancet. 2004;363:619–622.
26. Smith DM, Richman DD, Little SJ. HIV superinfection. J Infect Dis. 2005;192:438–444.
27. Grobler J, Gray CM, Rademeyer C, et al.. Incidence of HIV-1 dual infection and its association with increased viral load set point in a cohort of HIV-1 subtype C-infected female sex workers. J Infect Dis. 2004;190:1355–1359.
28. Roy S, Lavine J, Chiaromonte F, et al.. Multivariate statistical analyses demonstrate unique host immune responses to single and dual lentiviral infection. PLoS One. 2009;4:e7359.
29. Migueles SA, Sabbaghian MS, Shupert WL, et al.. HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proc Natl Acad Sci U S A. 2000;97:2709–2714.
30. Frahm N, Kiepiela P, Adams S, et al.. Control of human immunodeficiency virus replication by cytotoxic T lymphocytes targeting subdominant epitopes. Nat Immunol. 2006;7:173–178.
31. Deeks SG, Walker BD. Human immunodeficiency virus controllers: mechanisms of durable virus control in the absence of antiretroviral therapy. Immunity. 2007;27:406–416.
32. Miura T, Brumme ZL, Brockman MA, et al.. Impaired replication capacity of acute/early viruses in persons who become HIV controllers. J Virol. 2010;84:7581–7591.
33. Pacold ME, Pond SL, Wagner GA, et al.. Clinical, virologic, and immunologic correlates of HIV-1 intraclade B dual infection among men who have sex with men. AIDS. 2012;26:157–165.
Keywords:

LTNP; elite controller; HIV dual infection; HLA; CD4+/CD8+

© 2013 by Lippincott Williams & Wilkins