Secondary Logo

Journal Logo

Spanish HIV-1-Infected Long-Term Nonprogressors of More Than 15 Years Have an Increased Frequency of the CX3CR1 249I Variant Allele

Vidal, Francesc, MD, PhD*; Viladés, Consuelo, MD*; Domingo, Pere, MD, PhD; Broch, Montserrat, PhD*; Pedrol, Enric, MD, PhD; Dalmau, David, MD, PhD§; Knobel, Hernando, MD, PhD; Peraire, Joaquim, MD*; Gutiérrez, Cristina, PhD*; Sambeat, Ma Antònia, MD, PhD; Fontanet, Àngels; Deig, Elisabeth, MD; Cairó, Mireia, MD§; Montero, Milagros, MD; Richart, Cristóbal, MD, PhD*; Mallal, Simon, MD, PhD on behalf of the Chemokines LTNP Study Group

JAIDS Journal of Acquired Immune Deficiency Syndromes: December 15th, 2005 - Volume 40 - Issue 5 - p 527-531
doi: 10.1097/01.qai.0000186362.50457.e0
Basic Science
Free

Background and Objectives: The influence of the polymorphisms of the CX3CR1 chemokine receptor gene on the natural history of HIV-1 infection is controversial. This study aimed to determine whether functionally active CX3CR1 genetic variants are associated with long-term nonprogressive infection of >15 years in HIV-1-infected Spanish patients.

Patients and Methods: Two single-nucleotide polymorphisms, V249I (G > A) and T280M (C > T), of the CX3CR1 gene were assessed in 271 Spaniards. These included 60 HIV-1-infected patients who were long-term nonprogressors (LTNPs) of >15 years, 109 HIV-1-infected patients who were usual progressors (UPs), and 102 control subjects. The CCR5Δ32 was also assessed. Genotyping was performed using polymerase chain reaction and automatic sequencing analysis methods on white cell DNA. Genotype and allele frequencies were compared by the χ2 test and the Fisher exact test.

Results: The frequencies of the 249I variant allele were 42% for LTNPs, 24.5% for UPs, and 35% for healthy controls; the differences between LTNPs and UPs were significant (odds ratio 0.46; 95% CI: 0.27 to 0.75; P = 0.0017). For 280M the distribution was 16% for LTNPs, 14% for UPs, and 17% for healthy controls (P = NS). The haplotype 249I280T was significantly more common in LTNPs than in UPs (P = 0.0007). These results persisted after excluding from the analysis the individuals carrying the CCR5Δ32.

Conclusions: CX3CR1 249I variant allele is more frequent in Spanish HIV-1-infected LTNPs of >15 years. This effect is independent of the presence of the CCR5Δ32 allele.

From the *Hospital Universitari de Tarragona Joan XXIII and Universitat Rovira i Virgili, Tarragona, Catalonia, Spain; †Hospital de la Santa Creu i Sant Pau and Universitat Autònoma de Barcelona, Spain; ‡Hospital General de Granollers, Spain; §Fundacio per a la Recerca. Hospital Mútua de Terrassa, Universitat de Barcelona, Spain; ∥Hospital del Mar de Barcelona, Spain; and ¶Royal Perth Hospital and Murdoch University, Perth, Western Australia.

See appendix for the Chemokines and LTNP Study Group members.

Received for publication April 14, 2005; accepted September 2, 2005.

Funded by The Marató de TV3 (02/1830, 02/1831, 02/1832, 02/1833, 02/1834); the Spanish AIDS Research Network (RIS G03/173); and the Fondo de Investigación Sanitaria (FIS 02/1282).

This work was presented in part at the 45th annual Interscience Conference on Antimicrobial Agents and Chemotherapy (ICAAC) Washington, DC; December 16-19, 2005; abstract no. ICAAC05-A-1860-ASM.

Reprints: Francesc Vidal, Department of Internal Medicine and Infectious Diseases, Hospital Universitari de Tarragona Joan XXIII, Universitat Rovira i Virgili Mallafré Guasch, 4 43007 Tarragona, Catalonia, Spain (e-mail: fvidal@comt.es).

A striking feature in HIV-1 infection is that the natural evolution varies broadly among infected patients. To test the hypothesis that disease progression may be genetically determined, attention has recently been paid to diverse host-cell proteins that are used by HIV-1 to perpetuate infection. Among these, genetic variants of the chemokine receptors used by HIV-1 to enter the target cells such as CCR5, CXCR4, and CCR2 have been investigated.1-6

CX3CR1, a leukocyte chemotactic and adhesion receptor for the human chemokine fractalkine, is also used by some HIV-1 strains as a coreceptor.7 Two common and functional single-nucleotide polymorphisms within the human CX3CR1 gene have been reported: a G to A nucleotide substitution, which translates isoleucine instead of valine at the position 249 (V249I), and a C to T nucleotide substitution, which translates methionine instead of threonine at the position 280 (T280M).8 Information about the impact of these single-nucleotide polymorphisms on the natural history of HIV-1 infection is discordant, and reasons for discrepancy should be sought mainly in the different ethnic origins, definitions, and composition of the cohorts studied.8-14 Noteworthy is that most reports8-11 have studied these allelic variants in rapid progressors and typical (or usual) progressors (UPs), rather than in true long-term nonprogressors (LTNPs). In this study we aimed to evaluate whether CX3CR1 genetic variants were associated with LTNP infection of >15 years' duration in a cohort of Spanish HIV-1-infected patients.

Back to Top | Article Outline

PATIENTS AND METHODS

Design and Setting

This was a multicenter observational case-control study. All subjects were recruited from a prospectively collected cohort of almost 3000 HIV-1-infected patients treated at the HIV outpatient clinics of the 5 participating hospitals. These hospitals are located in Catalonia in the northeast of Spain in a geographical area <100 km in diameter and they treat a homogeneous population.

Back to Top | Article Outline

Population

Two subsets of HIV-1-infected patients were studied: LTNPs and UPs. Criteria for LTNP were as follows: asymptomatic HIV-1 infection known to be of >15 years' duration; in the absence of any antiretroviral treatment, a stable CD4+ cell count persistently >500 cells/μL; and a plasma HIV-1 viral load repeatedly <5000 copies/mL.15 Patients were categorized as UPs if HIV-1 infection had progressed to advanced disease, ie, the appearance of class C HIV-1 disease, according to the 1993 Centers for Disease Control criteria,16 and had plasma HIV-1 viral load >35,000 copies/mL and a CD4+ cell count that declined over time and that was <350 cells/μL at least once in the first 10 years of infection. For a few patients whose date of infection was not available, this was assumed to be the midpoint between the first positive and the last negative HIV-1 blood test.17 As a control group we also studied a sample of healthy subjects recruited from blood donors. All subjects in our study were white Spaniards. Immigrants from other countries, including those from other European countries, and their descendants were excluded. Informed oral consent was obtained from each participant. The project was approved by local ethical research committees.

Back to Top | Article Outline

Samples

Blood, DNA, and Plasma

Blood samples with ethylenediamine tetra-acetic acid were obtained from an antecubital vein. Five milliliters of whole blood was used to determine CD4+ cell count, and 500 μL was used for DNA isolation by a MagNa Pure LC Instrument (Roche Diagnostics, Basel, Switzerland). Plasma for determining HIV-1 viral load was obtained by centrifugation at 3500 g, for 15 minutes at 4C°.

Back to Top | Article Outline

Laboratory Methods

CX3CR1 Genotypes

The CX3CR1 V249I and T280M mutations were studied by polymerase chain reaction and sequencing analysis.8 Amplification reactions were performed with the following primers: primer forward 5′CAGAATCATCCAGACGCTGT3′ and primer reverse 5′ AGGCATTTCCCATACAGGTG3′ (Genbank Accession number: BC028078.1) and under the following conditions: in a final volume of 50 μL with 0.2 mM of deoxyribonucleoside triphosphate, 0.2 μM of primers, 3 mM MgCl2, and 1 unit of Taq DNA polymerase (GeneCraft, Lüdinghausen, Germany). The program was as follows: 30 cycles of 30 seconds of denaturation at 94°C, 30 seconds of annealing at 60°C, and 30 seconds of extension at 72°C. Polymerase chain reaction products of 300 bp were electrophoresed on a 2% agarose gel. The amplified products were diluted in formamide solution, denaturated at 95°C for 5 minutes, and analyzed by automatic sequencing in an ABI PRISM 310 DNA sequencer (Applied Biosystems, Foster City, CA).

Back to Top | Article Outline

HIV-1 Infection-Related Parameters and CCR5Δ32 Mutation

HIV-1 infection, plasma HIV-1 viral load, blood CD4+ cell count, and CCR5Δ32 were assessed as previously described.18

Back to Top | Article Outline

Statistical Analysis

Statistical analysis was performed using the SPSS/PC+ statistical package (v. 12.0 for Windows; Chicago, IL). Descriptive data are expressed as mean ± SD or median (range) for nonparametric distributions. Differences in levels between groups were compared using a Student t test, Mann-Whitney U test, or analysis of variance when necessary. Hardy-Weinberg equilibrium was assessed by the χ2 goodness-of-fit test. Genotype and allele frequencies in the different groups were compared by the χ2 test or Fisher exact test when necessary. A P value of <0.05 was considered significant. For multiple comparisons of allelic frequencies, the Bonferroni correction was used and the calculated level of significance was a P value ≤0.003.

Back to Top | Article Outline

RESULTS

A total of 271 individuals were studied: 169 HIV-1-infected patients and 102 healthy controls. All subjects were white Spaniards. Of these patients, 60 were LTNPs and 109 UPs. Most (>90%) of the latter had progressed to advanced infection and were receiving antiretroviral drugs. The age, gender, and risk factors of LTNPs and UPs for acquiring HIV-1 were similar. Table 1 shows the characteristics and main data on the population studied. As expected by the case definition of LTNPs and UPs, they differed in duration of infection, CD4+ cell count, and plasma viral load.

TABLE 1

TABLE 1

Back to Top | Article Outline

CX3CR1Gene Polymorphisms

Table 2 shows the genotype distribution and allele frequencies in the CX3CR1 gene at the positions V249I and T280M for the groups defined. The genotype distribution in the population studied fits the expected Hardy-Weinberg equilibrium.

TABLE 2

TABLE 2

No significant differences were detected in the genotype distribution and allele frequencies of the 280M variant between the 3 groups defined. With respect to 249I, no differences were observed between healthy controls and HIV-1-infected subjects taken as a whole (P = NS). However, there were significant differences in the CX3CR1 V249I genotype distribution (P = 0.007) and allele frequencies (P = 0.0017) between UPs and LTNPs, which showed that the mutated allele A (249I) was more frequent in the LTNP subset (odds ratio: 0.46; 95% CI: 0.27 to 0.75). This was maintained after excluding the 45 individuals heterozygous for CCR5Δ32.

The analysis of extended genotypes of the 2 CX3CR1 polymorphisms showed no differences in the whole distribution between healthy controls and HIV-1-infected subjects. However, in the infected cohort, there were significant differences between UPs and LNTPs due to an increase in the genotypes carrying the A allele in the LNTP subset (P = 0.01; Table 3). Likewise the observed haplotypes revealed a predominance of the 249I280T in the LNTP group (P = 0.0007; Table 3). This was maintained when the individuals carrying the CCR5Δ32 mutation were excluded. The haplotypes detected also revealed that the 280M mutation was always associated with 249I polymorphism.

TABLE 3

TABLE 3

Back to Top | Article Outline

CCR5Δ32

Table 2 shows that there were no significant differences in CCR5 genotype distribution and allele frequencies between the different groups. CCR5Δ32 homozygosity was not observed.

Back to Top | Article Outline

DISCUSSION

In this study we have observed that Spanish LTNPs have an increased frequency of the CX3CR1 249I variant allele. No relation was established between the 280M variant allele and LTNPs. The haplotype 249I280T was also significantly associated with LTNP, and this did not depend on the presence of the CCR5Δ32 allele. Neither the 249I nor the 280M allele influenced the risk of infection. Additionally, our data confirm a close linkage disequilibrium between 249I and 280M.19 The 280M mutation is always inherited with the 249I variant allele, whereas 249I can occur as an isolated polymorphism.

Our results therefore suggest that the CX3CR1 249I allele has a modulator effect over the disease. The higher prevalence of this mutant allele in LTNPs could represent a protective factor over disease progression because a more rapid immunologic slope was detected in the group that we have called UPs, in whom this allele was underrepresented. It is difficult to assign just a protective or a deleterious role for this genetic marker, because the genotypic distribution in both UPs and LNTPs had no differences compared with the healthy population. In this sense, the A mutated allele was significantly lower in UPs compared with healthy subjects (Table 2), but when genotypic combination of 249I and 280M was analyzed, a clear increase in the genotype 5 including the A allele was observed in LNTPs with respect to healthy controls (Table 3). Moreover, no clear differences were observed in haplotype combinations for both HIV-1 cohorts and healthy controls (Table 3).

These new findings are in contrast with some previous published reports. Thus, in the French cohorts, patients homozygous for the 249I280M haplotype had a trend to more rapid progression toward AIDS and death than patients with the wild-type alleles or those who were heterozygous.8 In further studies in 3 North American cohorts, this accelerating effect in mutant homozygotes was not found, but heterozygosity was associated with a weak delay in developing AIDS and death.9 An absence of effect of the 280M genetic variant on disease progression among infected subjects, as is observed in our study, has also been reported in 2 studies from French10 and Dutch12 cohorts. There are some possible explanations for this apparently discordant data. First, in the Spanish population analyzed here, the genotype distribution of the CX3CR1 V249I allele differs from that reported for other whites.8 It is difficult to explain the higher 249I frequency in our population, but it perhaps reflects genuine genetic diversity due to migration patterns and the occupation of Spain historically by eastern populations. Second, the characteristics of the cohorts evaluated largely differ among studies because the mean duration of HIV-1 infection of our LNTPs subjects was much longer (>15 years) than that of the French Assymptomatiques à Long Terme (ALT)8 and Genetic Resistance to HIV (GRIV)14 cohorts, whose average duration of HIV-1 infection was markedly lower (8 years). These more strict phenotypic criteria in the selection of the nonprogressor patients may have facilitated the finding of differences in CX3CR1 polymorphisms between both HIV-1 subsets presented here. The low number of subjects homozygous for this mutation in our study does not permit us to discard an implication of this allele in the progression of the disease, in agreement with findings reported by Kwa et al.12 However, the similar distribution of extended genotypes in UPs and in LTNPs allowed us to think that the allelic influence of the 280M variant on disease progression must be low, if any.

In summary, our results suggest that CX3CR1 V249I polymorphism partly explains the diversity of HIV-1 disease progression among individuals. Further studies are needed to reproduce and validate these data in larger cohorts of well-defined UP and LTNP HIV-1-infected patients. If so, our results would then provide an insight for continued investigation of this chemokine receptor as a possible target for future antiretroviral drugs.

Back to Top | Article Outline

ACKNOWLEDGMENT

The authors thank Dr. M. Olona for her help in epidemiologic and statistical assessment.

Back to Top | Article Outline

REFERENCES

1. McDermott DH, Zimmerman PA, Guignard PF, et al. CCR5 promoter polymorphism and HIV-1 disease progression. Lancet. 1998;352:866-870.
2. Cohen O, Paolucci S, Bende SM, et al. CXCR4 and CCR5 genetic polymorphisms in long-term nonprogressive human immunodeficiency virus infection: lack of association with mutations other than CCR5. J Virol. 1998;72:6215-6217.
3. Hogan CM, Hammer SM. Host determinants in HIV infection and disease. Part II: Genetic factors and implications for antiretroviral therapeutics. Ann Intern Med. 2001;134:978-996.
4. Ioannidis JPA, Rosenberg PS, Goedert JJ, et al. Effects of CCR5, CCR2-64I, and SDF-1 3′A alleles of HIV-1 disease progression: an international meta-analysis of individual-patient data. Ann Intern Med. 2001;135:782-795.
5. Tang J, Kaslow RA. The impact of host genetics on HIV infection and disease progression in the era of highly active antiretroviral therapy. AIDS. 2003;17(Suppl 1):S51-S60.
6. Nolan D, Gaudieri S, John M, et al. Impact of host genetics on HIV-disease progression and treatment: new conflicts on an ancient battleground. AIDS. 2004;18:1231-1240.
7. Combadiere C, Salzwedel K, Smith ED, et al. Identification of CX3CR1: a chemotactic receptor for the human CX3C chemokine fractalkine and a fusion coreceptor for HIV. J Biol Chem. 1998;273:23799-23804.
8. Faure S, Meyer L, Costagliola D, et al. Rapid progression to AIDS in HIV+ individuals with a structural variant of the chemokine receptor CX3CR1. Science. 2000;287:2274-2277.
9. McDermott DH, Colla JS, Kleeberg CA, et al. Genetic polymorphism in CX3CR1 and risk of HIV disease. Science. 2000;290:2031a.
10. Hendel H, Winkler C, An P, et al. Validation of genetic case-control studies in AIDS and application to the CX3CR1 polymorphism. J Acquir Immune Defic Syndr. 2001;26:507-511.
11. Faure S, Meyer L, Genin E, et al. Deleterious genetic influence of CX3CR1 genotypes in HIV disease progression. J Acquir Immune Defic Syndr. 2003;32:335-337.
12. Kwa D, Boeser-Nunnink B, Schuitemaker H. Lack of evidence for an association between a polymorphism in CX3CR1 and the clinical course of HIV infection or virus phenotype evolution. AIDS. 2003;17:759-761.
13. Liu MX, Wang FS, Hong WG, et al. Distribution of HIV-1 coreceptor CX3CR1 allelic polymorphisms in general population, HIV-1 high-risk group and HIV carriers of Chinese indigenous Han and Uygur people. Zhonghua Liu Xing Bing Xue Za Zhi. 2003;24:595-598.
14. Puissant B, Abbal M, Blancher A. Polymorphism of human and primate RANTES, CX3CR1, CCR2 and CXCR4 genes with regard to HIV/SIV infection. Immunogenetics. 2003;55:275-283.
15. Mikhail M, Wang B, Saksena NK. Mechanisms involved in non-progressive HIV disease. AIDS Rev. 2003;5:230-244.
16. Castro KG, Ward JW, Slutsker L, et al. CDC 1993 revised classification system for HIV infection and expanded surveillance case definition for AIDS among adolescents and adults. MMWR Recomm Rep. 1992;41 (RR-17):1-20.
17. McDermott D, Beecroft MJ, Kleeberger CA, et al. Chemokine RANTES promoter polymorphism affects risk of both HIV infection and disease progression in the Multicenter AIDS Cohort Study. AIDS. 2000;14:821-826.
18. Vidal F, Peraire J, Domingo P, et al. Lack of association of SDF-1 3′A variant allele with long-term non-progressive HIV-1 infection is extended beyond 16 years. J Acquir Immune Defic Syndr. 2005 (In press).
19. DeVries MD, Cao H, Wang J, et al. Genomic organization and evolution of the CX3CR1/CCR8 chemokine receptor locus. J Biol Chem. 2003;278:11985-11994.
Back to Top | Article Outline

APPENDIX

The members of the Chemokines & LTNP Study Group and coauthors of the paper are: Francesc Vidal, Consuelo Viladés, Joaquim Peraire, Montserrat Broch, Cristina Gutiérrez, Miguel López, Sergi Veloso, Maria Saumoy, Montserrat Olona, Cristóbal Richart (Hospital Universitari de Tarragona Joan XXIII and Universitat Rovira i Virgili, Tarragona, Spain); Pere Domingo, Ma Antonia Sambeat, Àngels Fontanet, Josep Cadafalch, Montserrat Fuster (Hospital de la Santa Creu i Sant Pau and Universitat Autònoma de Barcelona, Barcelona, Spain); Enric Pedrol, Elisabeth Deig, Anna Soler (Unitat d'Infeccions-VIH, Hospital General de Granollers, Observatori de la Salut Dr. Carles Vallbona, Granollers, Spain); David Dalmau, Anna Ochoa, Mireia Cairó (HIV Unit. Infectious Diseases Service. Fundacio per a la Recerca. Hospital Mútua de Terrassa. Universitat de Barcelona, Spain); Hernando Knobel, Milagros Montero, Ana Guelar (Hospital del Mar, Barcelona, Spain); Judit González (Pius Hospital, Valls, Spain); Simon Mallal (Royal Perth Hospital and Murdoch University, Perth, Western Australia).

Keywords:

AIDS; HIV-1 infection; long-term nonprogressors; CX3CR1; chemokines; chemokine receptor; CCR5

© 2005 Lippincott Williams & Wilkins, Inc.