Secondary Logo

Journal Logo

Human Naive CD4 T-Cell Clones Specific for HIV Envelope Persist for Years In Vivo in the Absence of Antigenic Challenge

Pira, Giuseppina Li PhD*; Bottone, Laura PhD; Ivaldi, Federico MD*; Galdo, Francesco Del MD; Papa, Francesca MD; Accolla, Roberto MD; Koopman, Gerrit PhD§; Abbate, Gianfranco MD; Berardinis, Piergiuseppe De MD; D'Apice, Luciana PhD; Palma, Raffaele De MD; Manca, Fabrizio MD*

JAIDS Journal of Acquired Immune Deficiency Syndromes: October 1st, 2005 - Volume 40 - Issue 2 - p 132-139
doi: 10.1097/01.qai.0000177842.67392.e2
Basic Science
Free
SDC

To study the persistence of HIV-specific human naive CD4-lymphocytes in vivo in the absence of antigenic stimulation, we identified 2 HIV-seronegative low-risk subjects carrying CD4-cells specific for gp120 that could be expanded in vitro. CD4 T-cell lines specific for gp120 were generated by stimulation cycles with antigen-pulsed antigen-presenting cells. Clonal analysis was performed by spectratyping and by sequencing of the CDR3 regions of the BV and AV-T-cell receptor (TCR) genes. HIV-specific T cells were expanded in vitro in 1989 and 2004. These lines were generated from naive precursors. Analysis of TCR-BV gene family use and sequencing of the TCR-BV22 hypervariable region revealed a BV22 clonotype in the 1989 line. The BV22-CDR3-based polymerase chain reaction primer confirmed that the 1989 and 2004 T-cell lines contained the same clonotype. In addition, the 1989 and 2004 T cells used the same TCR-AV38 gene family and identical CDR3-AV regions, confirming clonal identity. Similar data for a persistent clonotype defined by BV CDR3 sequencing were obtained from the second subject. In conclusion, naive CD4-cells specific for an HIV antigen not encountered in vivo persisted for more than 10 to 15 years. An extended lifespan, homeostatic proliferation, or the ability of the thymus to issue the same CD4 T-cell clone reiteratively might account for the phenomenon.

From the *Laboratory of Clinical and Experimental Immunology, G. Gaslini Institute, Genoa, Italy; †Department of Clinical and Biological Science, University of Insubria, Varese, Italy; ‡Department of Internal Medicine, Second University of Naples, Naples, Italy; §Biomedical Primate Research Center, Rijswjik, The Netherlands; and ∥National Research Council Institute of Protein Biochemistry, Naples, Italy.

Received for publication February 15, 2005; accepted July 6, 2005.

Supported by Istituto Superiore di Sanità, Rome, Italy (National AIDS Project, grants 40D.54 and 50D.18, Italian Concerted Action AIDS Vaccine); National Research Council (CNR Biotechnology Project), Rome, Italy; European Union, Brussels, Belgium (FAIR CT-97-3046, BHH4-CT97-2055, QLK2-CT-2000-01040 HIV-ComTher, and QLK2-CT-1999-01321 Eurovac); CIPE, Rome, Italy (17/2003); Regione Liguria, Genoa, Italy (1832/2003); and Ministry of Health PF 2005. G. Li Pira was recipient of a Comitato Interministeriale Programmazione Economica (CIPE) fellowship in 2005.

Reprints: Fabrizio Manca, Laboratory of Clinical and Experimental Immunology, G. Gaslini Institute, Largo G. Gaslini 5, 16148 Genoa, Italy (e-mail: manca@cba.unige.it).

Thelper (Th) cells specific for HIV are relevant in HIV infection because they correlate with a reduced viral load.1 The role of CD4 responses in the cytotoxic T-lymphocyte (CTL) response to HIV has been extensively reviewed.2 For these reasons, HIV-specific CD4-cells, along with effector CTLs, are promising from a vaccine perspective. When a prophylactic HIV vaccine is administered to a seronegative nonimmune subject, the viral antigens have an impact on the naive repertoire of the subject and stimulate primary responses. We therefore investigated the persistence of HIV gp120-specific CD4-cells in the naive repertoire of seronegative nonimmune subjects.

The persistence of lymphocytes has been studied with reference to B3 and T4 cells. Work on their lifespan has been done in mice, in which in vivo manipulations such as thymectomy5; lymphocyte transfer into irradiated animals,6 severe combined immunodeficiency (SCID) animals,7 or athymic animals8; or reconstitution with T-cell receptor (TCR) transgenic T cells9 can be performed. Naive and memory T cells have been investigated, as recently reviewed.10

The same studies are not feasible in human beings, although this issue has been debated for some time.11 Limited information in human beings dates back to the 1960s, when the lymphoid population was hardly subdivided between thymus- and bursa-dependent lymphocytes. Chromosomal alterations induced by irradiation allowed estimation of the longevity of human lymphocytes when cells were stimulated by phytohemagglutinin (PHA)12 or by tuberculin.13 The chromosomal abnormalities after in vitro activation suggested that the cell had not divided after irradiation or before stimulation.13 The half-life was estimated to be in the range of 212 or more years.14 Unfortunately, these data cannot address the question of the lifespan of human naive T cells, because PHA stimulates naive and memory cells and tuberculin-responsive lymphocytes are memory cells. Studies on irradiated subjects have calculated the lifespan of T lymphocytes according to their phenotype for memory or naive cells, defined as expression of CD45 isoforms.15

In the case of antigen-specific CD4-lymphocytes, lifespan can be estimated by evaluating their turnover and persistence supported by antigenic stimulation, which expands the relevant clones and produces effector and memory T cells.16 Nevertheless, when it comes to the study of naive CD4-cells with a defined specificity, these cells are at low frequency and undetectable by current methodologies.17 In fact, naive T cells, by definition, populate the repertoire as a consequence of TCR gene rearrangement and thymic selection18; however, contrary to memory T cells,19,20 they have not been triggered by antigen to undergo clonal expansion.

To evaluate the lifespan of HIV-specific human naive CD4-lymphocytes, we used culture conditions that allowed expansion of CD4-cells specific for primary antigens (ie, antigens that the subject has not previously encountered).21-25 This provides a sort of in vitro vaccination, in which a naive antigen primes the immune system for the first time. Low-frequency precursors expand clonally and eventually become detectable as the dominant population in vitro.

In this study, HIV gp120 was used as a primary antigen (not previously encountered by the seronegative subjects investigated here) to generate primary CD4-cell lines over a 10- to 15-year interval. The independently generated cell lines were then analyzed to assess persistence of the same clonal component defined on the basis of TCR hypervariable regions in the absence of antigenic stimulation in vivo.

Back to Top | Article Outline

MATERIALS AND METHODS

Media and Antigens

Cultures were performed in RPMI 1640 (Flow, Irvine, Scotland) (10 mM of L-glutamine, 0.01 mM of 2-mercaptoethanol, and 5% autologous plasma). HIV gp120-HXB2 was provided by the National Institute for Biological Standards and Controls (NIBSC) AIDS Centralized Repository (NIBSC, Potter Bars, UK). Screening of the gp120-specific lines generated from subject 0747 (healthy white man aged 42 years in 1989, HIV-seronegative blood donor, and low-risk behavior for HIV infection) with overlapping peptides (NIBSC AIDS Centralized Repository) showed that peptide PK12 219 through 231 (PAGFAILKCNNK) was immunodominant.21,25 A second subject (PDB) with similar characteristics was used to generate PK12 T-cell lines in 1994 and 2005, as previously reported.26,27 Cytomegalovirus (CMV) lysate was purchased from Microbix (Toronto, Ontario, Canada) and used at a rate of 5 μg/mL. The CMV pp65 peptides pep123 (aa 489-503, AGILARNLVPMVATV) and pep57 (aa 225-239, KVYLESFCEDVPSGK) contained a CTL epitope28 and a Th epitope,29,30 respectively. Monoclonal antibodies (mAbs) specific for CD45RA (HI100), CD45RO (UCHL1), CD62L (Dreg56), and CD27 (MT271) were purchased from Becton-Dickinson (San Jose, CA), and goat-anti-mouse IgG beads (DY11007) were purchased from Dynal (Oslo, Norway). Kits for separation of naive and memory CD4-cells were purchased from Miltenyi Biotec (Bergish Gladbach, Germany). These kits contained anti-CD8, -CD14, -CD16, -CD19, -CD36, -CD45RA, -CD56, -CD123, -TCRg/d, and -glycophA for isolation of untouched memory CD4-cells and anti-CD8, -CD14, -CD16, -CD19, -CD36, -CD45RO, -CD56, -CD123, -TCRg/d, and -glycophA for isolation of untouched naive CD4-cells.

Back to Top | Article Outline

ELISPOT Assay and Intracytoplasmic Staining for Interferon-γ

Peripheral blood mononuclear cells (PBMCs) and fractionated T cells were tested by means of an ELISPOT assay after 24 hours of stimulation with positive control peptides and with PK12 of gp120, according to the manufacturer's instructions (Mabtech, Uppsala, Sweden). Spot-forming units (SFUs) were enumerated under a dissection stereomicroscope. Removal of CD4- and CD8-lymphocytes from PBMC preparations was carried out with Dynabeads (Dynal) according to the manufacturer's instructions. The populations depleted of CD4- and CD8- are referred to as CD8 and CD4 subsets. Phenotypic analysis indicated depletion efficiency greater than 98% in repeated experiments. Antigen-induced intracytoplasmic interferon-γ (IFNγ) was stained with reagents purchased from Becton-Dickinson. Cells were cultured overnight in round-bottom tubes at 5 × 105 cells per tube before the addition of brefeldin and staining according to the manufacturer's procedure.

Back to Top | Article Outline

Generation of Antigen-Specific CD4-Cell Lines

The methodology for generation of CD4-cell lines specific for different antigens of HIV and HTLV-1 has been reported elsewhere.20-22 Briefly, PBMCs were cultured with gp120 (5 μg/mL) or peptide (1 μg/mL) at 2 × 106 cells/mL in 24-well plates. Five days later, recombinant IL-2 (Proleukin; Eurocetus) was added at a final concentration of 30 U/mL. One week later, proliferating cells were split to keep cell concentration below 1 × 106/mL. Cell proliferation declined after an additional 2 weeks. Resting T cells (5 × 105) were restimulated with 106 autologous irradiated (30 Gy) PBMCs in the presence of protein or peptide. IL-2 was added after 2 days. The T-cell lines were split as described previously. Restimulation cycles were performed every 3 weeks. These culture conditions select for CD4-lymphocytes that exceed 95% after 2 or 3 cycles.

Experiments were run to test whether the CD4-cells from which the PK12-specific lines were generated had a memory or naive phenotype at the time of initial stimulation. PBMCs at 10 × 106/mL (0.5 mL) were preincubated with anti-CD45RA or anti-CD45RO mAbs at a final concentration of 10 μg/mL for 1 hour at 4°C. The cells were washed in cold Hanks' solution and resuspended in 0.5 mL of complete RPMI. Goat-anti-mouse IgG Dynabeads were added at a 5:1 bead/cell ratio and rotated at 4°C for 10 minutes. After the addition of 2 mL of cold medium, the bead-bound cells were removed by placing the tube on a magnetic stand. Unbound cells were stimulated by seeding 106 cells per well in the presence of gp120 with the addition of 106 autologous, gp120-pulsed, irradiated PBMCs as antigen-presenting cells (APCs). To test the naive versus memory derivation of gp120-specific CD4-cells further, PBMCs were fractionated using commercial kits for negative separation of untouched naive and memory cells. Briefly, 10 × 106 PBMCs were incubated with the naive-specific or memory-specific biotinylated antibody cocktails, washed, and treated with anti-biotin microbeads. After incubation, the cells were washed and resuspended in 500 μL of separation buffer (phosphate-buffered saline [PBS], 1% bovine serum albumin [BSA], and 2 mM of ethylenediamine tetra-acetic acid [EDTA]) and passed on magnetic columns. The through fractions (naive or memory, respectively) and the detached fractions obtained after flushing of the columns removed from the magnet (naive+ or memory+, respectively) were collected. The cells were stimulated by seeding 106 cells per well in the presence of 106 autologous, gp120-pulsed, irradiated PBMCs. IL-2 expansion and restimulation cycles were carried out as described previously.

Enrichment for specific cells was monitored in a proliferation assay by seeding a 200-μL cell suspension from the master wells in a flat-bottom microtiter plate. Cultures were pulsed on day 2 with 0.5 μCi (0.037 MBq) 3H-thymidine (Amersham, Amersham UK) and harvested 18 hours later. Incorporated radioactivity was measured with a Canberra-Packard (Meriden, CT) Matrix 9600 counter.

Clones were obtained by seeding 0.3 T cells from established lines (after 4 or more restimulation cycles) in 48 round-bottom microtiter wells containing 104 peptide pulsed and irradiated autologous PBMCs in the presence of IL-2. Three weeks later, positive wells were transferred to flat-bottom wells of a microtiter plate and split if necessary. Two weeks later, the clones were restimulated as described previously for T-cell lines. Three clones from each of the 1989 and 2004 T-cell lines were tested. All were positive with the BV22-CDR3 clonotypic primer using the polymerase chain reaction (PCR) assay. One clone from each line was used for TCR-AV analysis and sequencing.

A donor PDB line (healthy white man aged 35 in 1994, HIV-seronegative blood donor, and low-risk behavior for HIV infection) was also used to produce T-cell lines specific for PK12 of gp120, as previously reported.26,27 The PDB lines used in this study were generated in 1994 and 2005.

Back to Top | Article Outline

Clonal Analysis

Antigen-specific CD4-cells were stimulated with antigen and expanded with IL-2 for 2 weeks. The cells were collected, washed with PBS, pelleted, and frozen at −80°C. Total RNA was extracted and reverse-transcribed into complementary DNA (cDNA) with murine Moloney leukemia virus (MMLV) reverse transcriptase (RT) and with oligo (dT) as a primer.31 Analysis of TCR-BV gene family use was performed by amplification with a panel of BV-CB-specific primers. Sequences in the TCR-AC region were coamplified as an internal control.31 The amplified products were run on a 1.8% agarose gel and stained with ethidium bromide. The fluorescent bands were acquired with a Foto Analyst II System (FotoDyne, Hartland, WI) and analyzed with Collage Image Analysis version 3.0 software (FotoDyne). Results are given as the percentage of the individual BV gene family expression versus the total pixel intensity of the reactions after normalization for AC pixel intensity. To define the sequence of the CDR3 region of specific T cells using the BV22 gene, cloning was performed into Bluescript (Stratagene, La Jolla, CA), followed by sequencing using the Sequenase 2.0 method (United States Biochemicals, Cleveland, OH) with the dideoxy-chain termination method. The reaction products were analyzed with a 373A DNA sequencing apparatus (Applied Biosystems). Based on the CDR3 nucleotide sequence, a clone-specific primer was produced (5′ ggagaccccccgagtgggggtgc 3′). The clonotypic PCR reaction was performed as for the analysis of BV gene use.31

T-cell clones from the 1989 and 2004 T-cell lines that were positive for the TCR-BV22 clonotypic primer were further analyzed for TCR-AV gene expression. TCR-AV spectratyping and sequencing were performed using specific primers for all TCR-AV families.32 Direct sequencing of the PCR products previously analyzed by spectratyping was performed using an internal AC primer.

T-cell lines from donor PDB generated in 1994 and 2005 were characterized for fine specificity and clonal composition as described elsewhere.26,27 A clonotypic primer was designed based on the CDR3 sequence of BV5.1 cells of the 1994 T-cell line. To track the presence and frequency of the T-cell clonotype in the 2005 T-cell line, we performed a real-time PCR assay with a 5700 Thermal Cycler (Applied Biosystems), using the 5′ nuclease assay.33,34 For the clonotypic analysis, we used a primer specific for the variable region of the whole TCR BV5.1 (5′ gtgagcaccttggag 3′) and the clonotypic primer (5′ agtgtcccctcctaccaa 3′). All the primers were designed using Primer Express software (Applied Biosystems). To assess the frequency of the T-cell clonotype among the transcripts for the TCR-BV5.1 family in the peripheral blood and T-cell lines, 2 series of quantitative PCR assays were done in parallel, using a primer amplifying the whole TCR-BV5.1 family paired with a primer amplifying the TCR-B constant region (5′ gcttctgatggctcaaacaca 3′) or the clonotypic primer paired with the TCR-B constant primer. The corresponding threshold cycles (CTs) for the clonotype (CTc) and the whole BV (Cta) were measured. Clonotype frequency was determined as the ratio of (clonotype) = Corr × 2 Cta − CTc, where Corr is a correcting factor accounting for the difference in amplification efficiency of different primer pairs.

Back to Top | Article Outline

RESULTS

Generation of gp120-Specific CD4 T-Cell Lines After a 15-Year Interval

A CD4 T-cell line specific for peptide PK12 of gp120 was generated in 1989 from subject 0747 by in vitro stimulation with gp120.21 The line generated from the unfractionated PBMCs of the same donor in 2004 demonstrated enrichment of cells specific for the same immunodominant peptide PK12 by the third round of stimulation (Fig. 1A, empty bars). No proliferative response to PK12 was seen in unfractionated PBMCs (first stimulation). This was attributable to undetectable low frequency rather than to lack of specific cells, which, in fact, proliferated and showed up after 3 stimulation cycles. This delayed appearance of a specific proliferative response is commonly seen with T-cell lines generated from nonimmune donors. The same assay on CD45RA and CD45RO T cells showed that a PK12-specific T-cell line could only be produced using the CD45RO fraction (which contains the naive subset), suggesting that the specific lines were derived from naive precursors (see Fig. 1A, black and gray bars). To confirm the derivation of gp120-specific CD4 T cells from naive precursors, PBMCs were fractionated into naive and naive+ cells and into memory+ and memory cells using the Miltenyi separation kit (see Figs. 1B, C). The fractionated cells were stimulated for repeated cycles as described. No proliferation was observed after 1 cycle. After 3 cycles, only naive+ and memory cells (solid bars) showed a proliferative response. By the fifth cycle, only naive+ and memory cells were available and actively growing, whereas no cells that could be tested (NT) grew from the naive and memory+ fractions (empty bars).

FIGURE 1

FIGURE 1

An IFNγ ELISPOT assay was used to detect specific T cells because its sensitivity for low-frequency precursors is higher than lymphoproliferation. Also, in this case, responses to PK12 above background level were not detected in unfractionated PBMCs or CD4 and CD8 subsets (Fig. 2A). CMV lysate, the CTL peptide of CMV pp65 (pep123) and the Th peptide of CMV pp65 (pep57), were used as positive controls for specific CD8 and CD4 T cells, respectively. Similar results were obtained by intracytoplasmic IFNγ staining, as shown in Figure 2B. Because subject 0747 did not incur in any HIV-specific antigenic stimulation and maintained his seronegative status over the past 15 years, an antigen-driven clonal expansion of CD4-cells specific for PK12 of gp120 was not expected.

FIGURE 2

FIGURE 2

Back to Top | Article Outline

Clonal Composition of HIV-gp120-Specific T Cells

The use of TCR-BV gene families was defined on T-cell lines from donor 0747 at different time intervals (Fig. 3). PBMCs were used as control for a fully diverse repertoire (see Fig. 3A). Figure 3B shows the profile of the T-cell line generated in 1989, with the dominant but not unique expression of BV22+ and BV5+ cells. The clonal profile of the T-cell line generated in 2004 after 4 restimulation cycles (see Fig. 3C) confirmed dominant expression of the BV22 and BV5 gene families. In particular, dominance of the BV22 component was confirmed in gp120-specific T-cell lines generated on different occasions from the same subject.25 We therefore focused on positive cells of the BV22 gene family for further analysis.

FIGURE 3

FIGURE 3

A similar analysis on T-cell lines from donor PDB showed dominant use of the BV5.1 gene family, as previously described.25,26

Back to Top | Article Outline

Clonotypic Analysis of Specific T Cells

Sequencing of the hypervariable region of the TCR-BV22+ T-cell line generated in 1989 from donor 0747 allowed us to design a CDR3 clonotypic primer. The lines were analyzed by RT-PCR for the presence of the relevant BV22 clonotype, as shown in Figure 4A. The clonotype was undetectable in PBMCs and in PHA blasts, suggesting that the frequency of the clonotypic cells lies below the detection threshold of the assay. Titration experiments (not shown) of specific T cells into PCR PBMCs showed that the clonotypic assay could yield positive signals with as few as 10 positive cells in 106 PBMCs. By contrast, a remarkable positivity was detected in the 1989 T-cell line as well as in the 2004 line after 2 or 4 stimulation cycles.

FIGURE 4

FIGURE 4

The 2004 T-cell line revealed no specific proliferative response after 2 rounds of stimulation (see Fig. 1); however, enrichment had already occurred for the clonotype-expressing cells (see Fig. 4, 0747.gp120.PK12.2), suggesting that molecular analysis, whenever feasible, is more sensitive than the proliferation assay to detect low-frequency antigen-specific T cells belonging to a given clonotype.

The persistence of T cells using the same TCR-BV gene strongly supports but does not prove that the same clone was present over time. In fact, the same TCR-β chain may associate with different α chains in different clones. Therefore, to define the BV22+ PK12-specific T cells of 1989 and 2004 further, an analysis of the TCR-AV genes was performed by spectratyping. The analysis showed that AV38, expressed as single peaks of identical size (176 base pairs [bp]) in the 2 lines, was the dominant gene family (see Fig. 4B). Because the unique clonotype of each T cell is determined by the sequence of the rearrangement site (the CDR3 regions of each chain), we also sequenced the AV38 CDR3 regions of clones derived from the 1989 and 2004 T-cell lines. Sequencing of the AV38 CDR3 regions showed identical nucleotide sequences in T cells expressing the same BV22-CDR3 sequence, thereby confirming that the same T-cell clone was expanded in the 2 T-cell lines generated 15 years apart.

The second subject used for this investigation (PDB) was selected for his ability to respond to HIV gp120 and to recognize the same epitope contained in peptide PK12 as subject 0747, using a different restriction allele (DR5 instead of DR6).26,27 The CDR3 BV sequence was determined in the 1994 T-cell line and used to produce the clonotypic primer. The real-time PCR assay demonstrated a frequency of clonotype-positive transcripts of 3.6% in comparison to undetectable levels in PBMCs (<0.1%). This suggests that the second subject responded to peptide PK12 using the same clonotype after a 10-year interval. Even though the AV CDR3 analysis was not performed in this case, the information on the BV CDR3 sequence is well accepted as an adequate marker for clonal identity.35

Back to Top | Article Outline

DISCUSSION

In this report, we monitored over an extended period the persistence of HIV-specific CD4 T-cell clones in non-HIV-infected human subjects. The persistence of these clones cannot be explained by stimulation with nominal antigen, with the donors being persistently HIV-seronegative and at low risk. Proliferation cannot be driven by the nominal antigen, which is not available, but could be attributed to a cross-reactive antigen (eg, derived from another pathogen). T-cell cross-reactivity36,37 has been proposed as a homeostatic mechanism to sustain the naive repertoire in the absence of antigenic stimulation38 and has also been defined in terms of degenerate T-cell recognition in a recent study.39 Nevertheless, a search for the PK12 sequence on the World Wide Web (http://us.expasy.org/tools/#similarity) identified HIV as the only microorganism encoding for this sequence, thereby making the cross-reactivity hypothesis less likely. A theoretic possibility to investigate cross-reactivity would be to challenge T-cell lines with a variety of epitopes. At the present time, we cannot predict how many different lines and how many different epitopes should be screened in a matrix type experiment to test the cross-reactivity hypothesis.

The original gp120-PK12-specific CD4 T-cell precursors belonged to the naive subset (CD45RA+). This was further confirmed using a commercial kit to separate naive and memory cells with a cocktail of different mAbs. By contrast, it has been reported that CD4 T cells specific for HIV gag can be detected in seronegative donors, with a range of specificities for different peptides.40 This is suggestive of cross-reactivity because of broad specificities and because the frequency of specific T cells was high enough to permit detection by proliferation assay in PBMCs. Furthermore, the same report showed that the responding cells were, in fact, of memory phenotype (CD45R0+), at variance with our gp120-specific T-cells that belong to the naive CD45RA+ subset. Another report described the generation of HIV gag-specific CD4 T-cell clones from a naive subject.41 In this case, the generation of the CD4-cell lines was interpreted as resulting from activation of a primary response. In our case, the low frequency of specific cells in PBMCs provides additional indirect evidence that these cells belong to the naive population rather than to the memory population, which is expected to show a higher frequency.

An additional but not alternative mechanism to account for extended lifespan could be exerted by lymphokines, which impart antigen-independent proliferative signals and contribute to lymphocyte homeostasis, as already proposed for CD4- and CD8- cells in mice.42,43 In this case, cell proliferation can balance cell loss. The maintenance of CD4 but not CD8 naive T cells has also been associated with secondary lymphoid structures, suggesting that the 2 subpopulations are regulated independently.44

Regardless of the underlying mechanism(s), the primary immune response was highly coherent over time in these donors; not only was the same immunodominant peptide recognized by CD4 cells but the same clonal progeny was present during the response. The same clone was also recruited in T-cell lines generated against gp120 in 1994, 1996,26 and 2004 to confirm the persistence of the relevant clone in subject 0747.

This conclusion does not imply that the thymus is unable to generate the same clone de novo more than once in a lifespan, but this is a statistically unlikely event. Although the TCR-α and TCR-β chain rearrangements are random,45 there may be selection because of the efficiency of certain α-β pairings as well as positive selection.46

The formal proof of in vivo survival of the same T cell could be obtained by follow-up of cells bearing chromosomal abnormalities that prevent them from dividing, and thus represent a specific marker, as shown by others in patients receiving radiotherapy.15 Obviously, this analysis cannot be proposed in our system. It should also be noted that in the setting of adoptive immunoreconstitution with ex vivo expanded HIV-specific CTLs, persistence of reinfused T cells was similarly monitored based on the expression of a TCR-BV-specific clonotypic marker.47 The persistence of the clonal progeny we have observed in 1 subject for over 15 years and in 1 subject for over 10 years is compatible with the findings of a recent report demonstrating that naive CD4-cells in human beings, irrespective of their antigen specificity, are long-lived, with an approximate intermitotic time of 1 year.48

We do not conclude from this study that the gp120-specific response in our donors is monoclonal but rather that 1 specific clone (BV22, AV38) or 1 specific clonotype (BV5.1) can persist for years as a component of the gp120-specific repertoire.

Even if we advocate the hypothesis of extended lifespan of a given clone, as suggested by a recent report,48 alternative possibilities cannot be ruled out. In particular, the contribution of thymic output must be kept in mind as an alternative or additional possibility, which is obviously hard to test experimentally in the human system. These different possibilities do not impinge, however, on the final conclusion that the HIV-specific naive CD4 repertoire may contain the same clone for years, regardless of whether the biologic mechanism is extended lifespan, homeostatic proliferation, or repetitive thymic output.

The importance of our better understanding of the human CD4 repertoire specific for different HIV antigens is warranted not only because CD4-cells function as helper cells2 but also because of their direct effector function as reported for HIV-specific CD4-lymphocytes.49

Because we have already produced several primary CD4 T-cell lines responsive to retroviral antigens such as HIV envelope and HIV RT24,25 as well as HTLV-1 envelope glycoprotein23 from nonimmune subjects, we have the cellular tools to ascertain whether the present observation is unique to subjects 0747 and PDB or whether it reflects a more general feature of the naive T-cell repertoire specific for retroviral antigens in human beings. Because retroviral antigens have an impact on the naive repertoire in case of primary infection or in case of prophylactic vaccination, this type of information may be relevant to understand better the induction and development of CD4 responses in HIV-naive subjects.

Back to Top | Article Outline

ACKNOWLEDGMENTS

Most of the work described in this report was performed at the Unit of Viral Immunology, Gaslini Institute, c/o the Advanced Biotechnology Center, Genoa, Italy. The provision of HIV-gp120 and peptides by the NIBSC AIDS Centralized Repository, Potter Bars, United Kingdom, is gratefully acknowledged.

Back to Top | Article Outline

REFERENCES

1. Rosenberg ES, Billingsley JM, Caliendo AM, et al. Vigorous HIV-1-specific CD4+ T cell responses associated with control of viremia. Science. 1997;278:1447-1450.
2. Altfeld M, Rosenberg ES. The role of CD4(+) T helper cells in the cytotoxic T lymphocyte response to HIV-1. Curr Opin Immunol. 2000;12:375-380.
3. Freitas AA, Rocha B, Coutinho AA. Lymphocyte population kinetics in the mouse. Immunol Rev. 1986;91:5-37.
4. Tanchot C, Lemonnier FA, Perarnau B, et al. Differential requirements for survival and proliferation of CD8 naive or memory T cells. Science. 1997;276:2057-2062.
5. Miller JF. Effect of thymectomy in adult mice on immunological responsiveness. Nature. 1965;208:1337-1338.
6. Tanchot C, Rocha B. The peripheral T cell repertoire: independent homeostatic regulation of virgin and activated CD8+ T cell pools. Eur J Immunol. 1995;25:2127-2136.
7. Sprent J, Schaefer M, Hurd M, et al. Mature murine B and T cells transferred to SCID mice can survive indefinitely and many maintain a virgin phenotype. J Exp Med. 1991;174:717-728.
8. Bell EB, Sparshott SM, Drayson MT, et al. The stable and permanent expansion of functional T lymphocytes in athymic nude rats after a single injection of mature T cells. J Immunol. 1987;139:1379-1384.
9. Viret C, Wong FS, Janeway CA Jr. Designing and maintaining the mature TCR repertoire: the continuum of self-peptide:self-MHC complex recognition. Immunity. 1999;10:559-568.
10. Freitas AA, Rocha B. Population biology of lymphocytes: the flight for survival. Annu Rev Immunol. 2000;18:83-111.
11. Sprent J, Tough DF. Lymphocyte life-span and memory. Science. 1994;265:1395-1400.
12. Norman A, Sasaki MS, Ottoman RE, et al. Lymphocyte lifetime in women. Science. 1965;147:745.
13. Nowell PC. Unstable chromosome changes in tuberculin-stimulated leukocyte cultures from irradiated patients. Evidence for immunologically committed, long-lived lymphocytes in human blood. Blood. 1965;26:798-804.
14. Buckton KE, Brown WM, Smith PG. Lymphocyte survival in men treated with x-rays for ankylosing spondylitis. Nature. 1967;214:470-473.
15. Michie CA, McLean A, Alcock C, et al. Lifespan of human lymphocyte subsets defined by CD45 isoforms. Nature. 1992;360:264-265.
16. Kaech SM, Wherry EJ, Ahmed R. Effector and memory T-cell differentiation: implications for vaccine development. Nat Rev Immunol. 2002;2:251-262.
17. Kern F, Li Pira G, Gratama JW, et al. Measuring antigen specific immune responses: understanding immunopathogenesis and improving diagnostics in infectious disease, autoimmunity and cancer. Trends Immunol. (In press).
18. Davis MM, Bjorkman PJ. T-cell antigen receptor genes and T-cell recognition. Nature. 1988;334:395-402.
19. Hou S, Hyland L, Ryan KW, et al. Virus-specific CD8+ T-cell memory determined by clonal burst size. Nature. 1994;369:652-654.
20. Whitmire JK, Asano MS, Murali-Krishna K, et al. Long-term CD4 Th1 and Th2 memory following acute lymphocytic choriomeningitis virus infection. J Virol. 1998;72:8281-8288.
21. Manca F, Habeshaw J, Dalgleish A. The naive repertoire of human T helper cells specific for gp120, the envelope glycoprotein of HIV. J Immunol. 1991;146:1964-1971.
22. Manca F. Galactose receptors and presentation of HIV envelope glycoprotein to specific human T cells. J Immunol. 1992;148:2278-2282.
23. Manca F, Li Pira G, Fenoglio D, et al. Recognition of human T-leukemia virus (HTLV-1) envelope by human CD4+ T-cell lines from HTLV-1 seronegative individuals: specificity and clonal heterogeneity. Blood. 1995;85:1547-1554.
24. Manca F, Fenoglio D, Valle MT, et al. Human T helper cells specific for HIV reverse transcriptase: possible role in intrastructural help for HIV envelope-specific antibodies. Eur J Immunol. 1995;25:1217-1223.
25. Manca F, Habeshaw JA, Dalgleish AG, et al. Role of flanking variable sequences in antigenicity of consensus regions of HIV gp120 for recognition by specific human T helper clones. Eur J Immunol. 1993;23:269-274.
26. Manca F, De Berardinis P, Fenoglio D, et al. Antigenicity of HIV-derived T helper determinants in the context of carrier recombinant proteins: effect on T helper cell repertoire selection. Eur J Immunol. 1996;26:2461-2469.
27. Caivano A, D'Apice L, Tiberio C, et al. Design of cassette vectors permitting cloning of all types of human TCR variable alpha and beta regions. J Immunol Methods. 2001;8875:124-134.
28. Wills MR, Carmichael AJ, Mynard K, et al. The human cytotoxic T-lymphocyte (CTL) response to cytomegalovirus is dominated by structural protein pp65: frequency, specificity, and T-cell receptor usage of pp65-specific CTL. J Virol. 1996;70:7569-7579.
29. Li Pira G, Bottone L, Ivaldi F, et al. Identification of new Th peptides from the cytomegalovirus protein pp65 to design a peptide library for generation of CD4 T cell lines for cellular immunoreconstitution. Int Immunol. 2004;16:635-642.
30. Li Pira G, Bottone L, Ivaldi F, et al. Generation of cytomegalovirus specific CD4 T cell lines devoid of alloreactivity using a cocktail of CMV-pp65 peptides for reconstitution of the Th repertoire. J Infect Dis. 2005;191:215-226.
31. Oksenberg JR. The Antigen T Cell Receptor: Selected Protocols and Applications. New York: Chapman and Hall; 1997.
32. De Palma R, Gorski J. Restricted and conserved T-cell repertoires involved in allorecognition of class II major histocompatibility complex. Proc Natl Acad Sci USA. 1995;92:8836-8840.
33. Lim A, Baron V, Ferradini L, et al. Combination of MHC-peptide multimer-based T cell sorting with the immunoscope permits sensitive ex vivo quantitation and follow-up of human CD8+ T cell immune responses. J Immunol Methods. 2002;261:177-194.
34. De Palma R, Marigo I, Del Galdo F, et al. Therapeutic effectiveness of recombinant cancer vaccines is associated with a prevalent T-cell receptor alpha usage by melanoma-specific CD8+ T lymphocytes. Cancer Res. 2004;64:8068-8076.
35. Moss PA, Rosenberg WM, Bell JI. The human T cell receptor in health and disease. Annu Rev Immunol. 1992;10:71-96.
36. Ashwell JD, Chen C, Schwartz RH. High frequency and nonrandom distribution of alloreactivity in T cell clones selected for recognition of foreign antigen in association with self class II molecules. J Immunol. 1986;136:389-395.
37. Selin LK, Nahill SR, Welsh RM. Cross-reactivities in memory cytotoxic T lymphocyte recognition of heterologous viruses. J Exp Med. 1994;179:1933-1943.
38. Di Rosa F, Ramaswamy S, Ridge JP, et al. On the lifespan of virgin T lymphocytes. J Immunol. 1999;163:1253-1257.
39. Hemmer B, Gran B, Zhao Y, et al. Identification of candidate T-cell epitopes and molecular mimics in chronic Lyme disease. Nat Med. 1999;5:1375-1382.
40. Vyakarnam A, Matear PM, Cranenburg C, et al. T cell responses to peptides covering the gag p24 region of HIV-1 occur in HIV-1 seronegative individuals. Int Immunol. 1991;3:939-947.
41. Venturini S, Mosier DE, Burton DR, et al. Characterization of human immunodeficiency virus type 1 (HIV-1) Gag- and Gag peptide-specific CD4(+) T-cell clones from an HIV-1-seronegative donor following in vitro immunization. J Virol. 2002;76:6987-6999.
42. Tan JT, Dudl E, LeRoy E, et al. IL-7 is critical for homeostatic proliferation and survival of naive T cells. Proc Natl Acad Sci USA. 2001;98:8732-8737.
43. Schluns KS, Kieper WC, Jameson SC, et al. Interleukin-7 mediates the homeostasis of naive and memory CD8 T cells in vivo. Nat Immunol. 2000;1:426-432.
44. Dai Z, Lakkis FG. Cutting edge: secondary lymphoid organs are essential for maintaining the CD4, but not CD8, naive T cell pool. J Immunol. 2001;167:6711-6715.
45. Kronenberg M, Siu G, Hood LE, et al. The molecular genetics of the T-cell antigen receptor and T-cell antigen recognition. Annu Rev Immunol. 1986;4:529-591.
46. Davis MM. T cell receptor gene diversity and selection. Annu Rev Biochem. 1990;59:475-496.
47. Brodie SJ, Lewinsohn DA, Patterson BK, et al. In vivo migration and function of transferred HIV-1-specific cytotoxic T cells. Nat Med. 1999;5:34-41.
48. Macallan DC, Wallace D, Zhang Y, et al. Rapid turnover of effector-memory CD4(+) T cells in healthy humans. J Exp Med. 2004;200:255-260.
49. Norris PJ, Moffett HF, Yang OO, et al. Beyond help: direct effector functions of human immunodeficiency virus type 1-specific CD4(+) T cells. J Virol. 2004;78:8844-8851.
Keywords:

T lymphocytes; CD4 cells; HIV gp120; immunodominant epitope; T-cell receptors; T-cell repertoire

© 2005 Lippincott Williams & Wilkins, Inc.