Secondary Logo

Journal Logo

Epidemiology And Social Science

Intersubtype BF Recombinants of HIV-1 in a Population of Injecting Drug Users in Argentina

Espinosa, Alex MS*; Vignoles, Moira MS; Carrillo, Manuel Gómez PhD; Sheppard, Haynes PhD*; Donovan, Richard PhD*; Peralta, Liliana Martínez PhD; Rossi, Diana; Radulich, Graciela§; Salomón, Horacio PhD; Weissenbacher, Mercedes PhD

Author Information
JAIDS Journal of Acquired Immune Deficiency Syndromes: May 1st, 2004 - Volume 36 - Issue 1 - p 630-636

Abstract

The molecular epidemiology of HIV-1 has become increasingly important as viral subtypes are becoming more dispersed worldwide. There are currently at least 9 circulating genetic subtypes of HIV-1 (A–K) within group M, 1 with subtype B being predominant in Europe, the Americas, and Australia. 2 Although the dominant subtype in South America is B, there is evidence of other subtypes circulating through different regions of the continent, making the epidemic much more complex. 3–6 Recombinants between the B and F subtypes of HIV-1 were described in Brazil 7 and Argentina. 8,9 More recently, Carr et al 10 showed that BF recombinants were temporally and geographically widespread in South America and established a new circulating recombinant form (CRF12_BF) and other recombinants in a heterosexual population from Argentina, Uruguay, and Bolivia.

The HIV-1 subtype distribution pattern related to sexual behavior in Argentina was described by partial viral characterization in men who have sex with men (MSM) and heterosexual populations. 5,11 A high percentage of subtype B sequences was found in MSM in contrast to a high percentage of subtype F found in the heterosexual population. These results suggest a close relation between different risk factors and subtype distribution in the Argentinean epidemic during the same period of time.

Spreading of HIV-1 recombinant forms in injection drug user (IDU) populations was described in other regions of the world. In some of these epidemics, an explosive dissemination of these genetic variants among the IDU population was seen. In Vietnam and China, genetic diversity of AE recombinants among IDUs was lower than that of persons infected by the sexual route, providing evidence of the recent introduction of these variants in the IDU population. 12–14

In our study, we examined the subtypes and recombination patterns of 3 genomic regions of HIV-1 in a group of IDUs from Argentina and determined their relation to the CRF12_BF previously described in a heterosexual population.

METHODS

Study Design

Study subjects were 75 HIV-1–positive IDUs (61 male and 14 female) from the Buenos Aires city surroundings. The samples were collected from June 2000 to March 2001; however, we used only those plasma specimens for which we were able to obtain polymerase chain reaction (PCR) products for all 3 regions of interest (ie, gag, pol, vpu). This resulted in only 21 of the 75 specimens being used in the phylogenetic analysis. Written informed consent was obtained from all the study participants. Along with each specimen, a questionnaire was filled out by the patients regarding sociodemographic parameters, including (among others) gender, age, drug injection frequency, and needle sharing. These parameters were associated with the viral characterization done in this study.

Viral Load

Plasma HIV-1 viral load was determined by RNA quantification by means of the reverse transcriptase (RT) PCR assay using the Roche Amplicor HIV-1 Monitor test, version 1.5 (Roche Molecular Systems, Branchburg, NJ) with a limit of detection of 400 copies/mL.

Detection of Early HIV-1 Infection

To determine early HIV-1 infection in the IDU plasma samples, a sensitive/less sensitive enzyme immunoassay (EIA) testing strategy (detuned assay) was used as described by Janssen et al 15 with the Vironostika HIV-1 MicroElisa System (Organon Teknika, Durham, NC). This assay aimed to correlate the time of infection with the subtype characterization so as to estimate the subtypes currently being transmitted in this population.

RNA Extraction and Reverse Transcription

HIV RNA isolation from plasma was done using the QIAamp Viral RNA Miniprep Kit (Qiagen, Valencia, CA). The reverse transcription of gag and vpu was done using the ThermoScript RT-PCR System (Life Technologies, Rockville, MD) with primer MKenvN (5′ CTGCCAATCAGGGAAG-TAGCCTTGTGT 3′) for vpu and primer G01 (5′AGGGGTC-GTTGCCAAAGA 3′) for gag. The cycling conditions were as follows: 60°C for 60 minutes and 85°C for 5 minutes. RNA isolation from plasma and reverse transcription of pol were done using the ViroSeq system (Applied Biosystems, Foster City, CA) according to the directions of the manufacturer.

Polymerase Chain Reaction

The RT-PCR of gag and vpu was followed by a nested PCR. A first-round PCR was run using primer sets MKenvN and MKenvA (5′ GGCTTAGGCATCTCCTATGGCAG-GAAGAA 3′) for vpu or G00 (5′ GACTAGCGGAGGCTA-GAAG 3′) and G01 for gag amplification. The lengths of the first-round PCR products of vpu and gag were 3190 base pairs (bp) and 1467 bp, respectively. A second-round PCR was performed using primer sets ACC7 (5′ CTATGGCAGGAA-GAAGCGGAGA 3′) and ZM140E (5′ GGGGTCAACTTTA-CACATGGCTTT3 ′) for vpu or G05 (5′ TGTTGGCTCTG-GTCTGCTCT 3′) and G20 (5′ GTATGGGCAAGCAGG-GAGCTAGAA 3′) for gag amplification. The lengths of the second-round PCR products of vpu and gag were 602 bp and 1214 bp, respectively. The cycling conditions for the first- and second-round PCRs for gag were as follows: 94°C for 10 minutes, followed by 35 cycles of 94°C for 1 minute, and 55°C for 1 minute and 72°C for 6 minutes, followed by a final extension at 72°C for 15 minutes. The cycling conditions for the first-and second-round PCRs for vpu were as follows: 94°C for 10 minutes, followed by 35 cycles of 94°C for 1 minute, and 55°C for 1 minute and 72°C for 1 minute, followed by a final extension at 72°C for 15 minutes.

DNA Sequencing

Subtype characterization of the studied population was performed by sequencing a region of the gag, pol, and vpu genes. The PCR products were purified with a Centricon-1 column (Amicon, Danvers, MA) and then used as a template for direct sequencing on an automated ABI Prism 377 DNA sequencer using the ABI Prism Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems). In addition to the primers used in the second-round PCR amplification, 7 others—ZIF (5′ TGGGTCACAGTCTATTATGGG-GTACCT 3′), ES32 (5′ CTGCTTTGGTATAGGATCTTG-3′), ES34 (5′ GCCTGAGCATCTGATGCAC 3′), JL99 (5′ TTTAGCATCTGATGCACAAAATAG 3′), JL100 (5′ GGGGTCTGTGGGTACACAGGCATGTGT 3′), ZER (5′ GGGCTGGGATCTGTGGGCACACAGGCA 3′), and E18 (5′ TTGTGGGTCACAGTCTATTATGG 3′)—were used to determine the vpu sequence, and 3 others—G25 (5′ ATTGCTTCAGCCAAAACTCTTGC 3′), G55 (5′ ATTT-CTCCCACTGGGATAGGTGG 3′), and G60 (5′ CAGC-CAAAATTACCCTATAGTGCAG 3′)—were used for gag sequencing. The cycling conditions for vpu and gag sequencing were as follows: 25 cycles of 96°C for 10 seconds, 50°C for 5 seconds, and 60°C for 4 minutes. Sequencing products were purified with the DyeEx Spin Kit (Qiagen) before loading the gel. Pol sequences were obtained using the ViroSeq system (Applied Biosystems).

Phylogenetic Analysis

Nucleotide sequences* obtained from all primers of gag, pol, or vpu were aligned with the reference strain HXB2; subsequently, consensus sequences were constructed for each patient sample using the Sequencher version 4.1.2 (Gene Codes Corporation, Ann Arbor, MI). Each consensus sequence was then screened by the BLAST 2.0 HIV-1 subtyping program (National Center for Biotechnology Information, Bethesda, MD) to search for sequence similarities to previously reported reference strains in the database and characterized by subtyping each of the patient samples. Boot scanning analysis by means of SimPlot version 2.5 (Stuart Ray, http://www.med.jhu.edu/deptmed/sray/download) and visual inspection of alignments were used to identify breakpoints. After identification of the breakpoints, subregions of the alignment were analyzed by neighbor-joining with bootstrapping to confirm the subtype assignment.

Nucleotide sequences from vpu, gag, and pol regions were assembled and aligned with reference sequences belonging to subtype A (SE7253 and SE7535), subtype B (MN, WR27, and RL42), subtype C (BW15B03 and BW1626), subtype F (VI850, BR020, and FIN9363) as well as with 4 CRF12_BF (ARMA159, ARMA185, URTR23, and URTR35) and 2 B/F recombinant non-CRF12_BF (ARMA070 and ARMA062) using ClustalX (Thompson, JD et al, 1997) and visually corrected with BioEdit, version 5.0.9 (T. A. Hall, 1999). Phylogenetic trees were constructed by neighbor-joining using the Kimura 2-parameter model with the MEGA version 2.1 program (Kumar, S et al, 2001). Bootstrap analysis was done to assess the stability of the nodes.

RESULTS

The median plasma HIV RNA load in the study population was 167,000 copies/mL. Serologic analysis using the detuned assay demonstrated that none of the patients in this study had evidence of recent seroconversion.

The neighbor-joining tree of all 21 gag, pol, and vpu assembled sequences with reference strains showed that all the samples were BF recombinants with a dissimilar distribution (Fig. 1). In spite of the low bootstrapping values, different clusters could be seen in the B/F group. One cluster that included 12 samples more related to the CRF12_BF was identified. The analysis of the detailed subtype structure of the samples was performed by visual inspection of the alignments, and the subtype assignment was confirmed by phylogenetic trees. With this analysis, we were able to observe that those sequences that grouped with the CRF12_BF showed a different mosaic pattern compared with those that grouped with the non-CRF12_BF sequences (data not shown). Structure analysis of non-CRF12–related samples is shown in Figure 2. Each subtype segment had a bootstrap value ranging between 70% and 100%. Most of the different mosaic patterns were found in the gag gene, in which 7 samples (AR13, AR38, AR50, AR57, AR59, AR60, and AR65) had a diverse BF mosaic pattern in comparison with the CRF12_BF prototype, which is subtype F in this analyzed region (see Fig. 2a). The subtype structure in the pol region revealed that 4 samples (AR27, AR38, AR40, and AR57) had a different mosaic pattern compared with the CRF12_BF prototype (see Fig. 2b), whereas only 2 samples (AR65 and AR60) had differences in the vpu gene structure (see Fig. 2c).

FIGURE 1.
FIGURE 1.:
Phylogenetic analysis of 21 injection drug user samples from Argentina. a, Neighbor-joining tree with bootstrapping of gag, pol, and vpu assembled sequences. Branches of a cluster containing samples related to the CRF12_BF are drawn in bold. Significant bootstrap values are placed next to the nodes. The genetic distance corresponding to the length of the branches is shown in the bottom line. b, Genetic map of HIV-1. Shaded areas indicate each assembled segment used in the phylogenetic analysis (♦, CRF12_BF; ⋄, BF recombinant non-CRFs).
FIGURE 2.
FIGURE 2.:
Subtype structure of non-CRF12_BF sequences in three HIV-1 genome regions:gag (a), pol (b) and vpu (c). Subtype F (white) and subtype B (gray).Subtype structure was determined by visual inspection of aligments and confirmed by phylogenetic analysis. Bootstrap value to confirm the subtype assignment of each segment is based on phylogenetic trees (not shown) and placed in the diagram. Subtype structure of the CRF12_BF prototype (ARMA159) is placed at the top of each gene diagram and the relative position of segments to HXB2 reference strain are established by a ruler.

Based on these results, we further analyzed the sequences in each gene region. For this, a phylogenetic analysis was done as described previously. Only segments with the same subtype structure as the CRF12_BF were included in each tree. The phylogenetic analysis of each sequenced region revealed the presence of sequences related to the CRF12_BF in gag, pol, and vpu genes (Fig. 3). Bootstrap values for each “CRF cluster” were 95% in gag (see Fig. 3a), 70% in pol (see Fig. 3b), and 77% in vpu (see Fig. 3c). A total of 12 samples (AR01, AR03, AR19, AR26, AR28, AR36, AR45, AR48, AR53, AR66, AR74, and AR75), representing 57% of the analyzed samples had similar and related sequences to the CRF12_BF in the 3 sequenced genes.

FIGURE 3.
FIGURE 3.:
Phylogenetic analysis of three regions of the HIV-1 genomes from Argentina. Neighbor-joining phylogenetic trees were built for each region:gag (a), pol (b) and vpu (c), and significant bootstrap values are placed next to the nodes. The genetic distance corresponding to the length of the branches is shown in the bottom line. Bold lines indicate the clusters defining the CRF12_BF. ♦ CRF12_BF ⋄ BF Recombinants non CRFs

In the IDU population, the HIV-1 seroprevalence was 46%. 16 The average age was 31.4 years. The subjects, 17 men and 4 women, reported that 99% had used injected cocaine, 80.0% had 1 or more injections per week, 80.0% had shared needles, 35% had group sex, and 20% had exchanged sex for drugs. Of the 21 IDUs in the study population, 11 answered the question related to therapy. Of these 11 IDUs, 3 were undergoing antiretroviral therapy (27.3%). No significant differences were found when analyzing the association between HIV viral characterization (being or not being closely related to the CRF12_BF) and these sociodemographic parameters (data not shown).

DISCUSSION

In Argentina, a total of 25,811 AIDS cases were reported as of 2001, 17 with 40% of them related to injecting drug use in both genders (14% for women and 26% for men). The common use of injected cocaine in the Southern Cone of South America was described by others. 18,19 Since 1990, the main HIV transmission route in Argentina has been the use of illegal drug injection, reaching a peak of almost 50% of the new cases reported in 1996. This tendency was reversed during 2001 by the increasing rate of heterosexual transmission, which reached 33%.

Previous molecular epidemiologic studies with samples from Argentina showed that HIV-1 diversity in this country is complex. Considering the multiple HIV-1 recombinant forms described in the literature and the evidence of the different distribution of HIV-1 among vulnerable populations, early dissemination of these genetic forms in the Argentinean epidemic is apparent. A previous study in the pediatric population revealed that transmission of BF recombinants in Argentina has predominated since the 1980s 20 and provided evidence that similar BF recombinants (but not identical to the CRF12_ BF) have been spread for at least 15 years in the heterosexual population in this country.

In our study, a total of 21 plasma samples belonging to HIV-1–positive IDUs were included with the aim of isolating viral RNA and characterizing genomic segments of gag, pol, and vpu genes by automated sequencing.

We found that 100% of the 21 studied subjects carried BF intersubtype recombinant virus. On the basis of this finding, BF recombinants appear to predominate in this population. Sequencing results from the vpu, pol, and gag regions, however, showed that these recombinants were not all identical but that 12 samples (57%) had the same recombination pattern as the CRF12_BF. Our results correlate with the findings of Carr et al 10 and Thomson et al, 9,21 which showed high frequencies of BF recombinants in South America. In the heterosexually infected population studied by Carr et al, 10 the CRF12_BF did not represent the predominant genetic form. Our findings show a high prevalence of the CRF12_BF-related sequences in the IDU population, but full-length genome analysis must be performed to be conclusive. Together with the previous studies, our results support the possibility of a common recombinant ancestor, with subsequent recombination giving rise to the suite of BF recombinants now seen in the population. In this complex scenario, the IDU population could be associated as a spreading source of BF recombinants among the heterosexual population in the region, but the origin of the CRF12_BF is not yet clear. This study suggests the possible association between viral variants and the transmission route.

HIV diversity might have an influence on the efficiency of laboratory techniques used for the monitoring of patients 22–24 as well as on vaccine development. This study analyzes the molecular pattern of HIV-1 in an IDU population from Argentina and places additional emphasis on the importance of knowledge of subtypes in the epidemiologic evaluation of the spread of HIV-1 in this country.

REFERENCES

1. Robertson DL, Anderson JP, Bradac JA, et al. HIV-1 nomenclature proposal. Science. 2000;288:55–56.
2. Kuiken C, Thakallapalli R, Esklid A, et al. Genetic analysis reveals epidemiologic patterns in the spread of human immunodeficiency virus. Am J Epidemiol. 2000;152:814–822.
3. Russell KL, Carcamo C, Watts DM, et al. Emerging genetic diversity of HIV-1 in South America. AIDS. 2000;14:1785–1791.
4. Marquina S, Leitner T, Rabinovich RD, et al. Coexistence of subtypes B, F, and as B/F env recombinant of HIV type 1 in Buenos Aires Argentina. AIDS Res Hum Retroviruses. 1996;12:1651–1654.
5. Masciotra S, Livellara B, Belloso W, et al. Evidence of a high frequency of HIV-1 subtype F infections in a heterosexual population in Buenos Aires, Argentina. AIDS Res Hum Retroviruses. 2000;16:1007–1014.
6. Velarde-Dunois KG, Guimaraes ML, La Fuente C, et al. Molecular characterization of human immunodeficiency virus type 1-infected individuals from Bolivia reveals the presence of two distinct genetic subtypes B and F. AIDS Res Hum Retroviruses. 2000;16:1921–1926.
7. Ramos A, Tanuri A, Schechter M, et al. Dual and recombinant infections: an integral part of the HIV-1 epidemic in Brazil. Emerg Infect Dis. 1999;5:65–74.
8. Fernandez-Medina D, Jansson M, Rabinovich RD, et al. Identification of human immunodeficiency virus type 1 subtypes B and F B/F recombinant and dual infection with these subtypes in Argentina. Scand J Infect Dis. 1999;31:235–242.
9. Thomson MM, Villahermosa ML, Vazquez-de-Parga E, et al. Widespread circulation of a B/F intersubtype recombinant form among HIV-1-infected individuals in Buenos Aires, Argentina. AIDS. 2000;14:897–899.
10. Carr JK, Avila M, Gomez Carrillo M. et al. Diverse BF recombinants have spread widely since the introduction of HIV-1 into South America. AIDS. 2001;15(Suppl):F41–F47.
11. Avila MM, Pando MA, Carrion G, et al. Two HIV-1 epidemics in Argentina: different genetic subtypes associated with different risk groups. J Acquir Immune Defic Syndr. 2002;29:422–426.
12. Liitsola K, Tashkinova I, Laukkanen T, et al. HIV-1 genetic subtype A/B recombinant strain causing an explosive epidemic in injecting drug users in Kaliningrad. AIDS. 1998;12:1907–1919.
13. Piyasirisilp S, McCutchan FE, Carr JK, et al. A recent outbreak of human immunodeficiency virus type 1 infection in southern China was initiated by two highly homogeneous, geographically separated strains, circulating recombinant form AE and a novel BC recombinant. J Virol. 2000;74:11286–11295.
14. Kato K, Kusagawa S, Motomura K, et al. Closely related HIV-1 CRF01_AE variant among injecting drug users in northern Vietnam: evidence of HIV spread across the Vietnam-China border. AIDS Res Hum Retroviruses. 2001;17:113–123.
15. Janssen RS, Satten GA, Stramer SL, et al. New testing strategy to detect early HIV-1 infection for use in incidence estimates and for clinical and prevention purposes. JAMA. 1998;280:42–48.
16. Weissenbacher M, Martíinez Peralta L, Rossi D, et al. Coinfections with HIV, HBV, HCV, HTLV-I, HTLV-II in injection drug users from Buenos Aires, Argentina [session 45, poster 362]. Presented at the First IAS Conference on HIV Pathogenesis and Treatment, Buenos Aires, July 2001.
17. National Ministry of Health, Buenos Aires, Argentina. Boletíin sobre el SIDA en la Argentina. Buenos Aires: National Ministry of Health; 2002.
18. Libonatti O, Lima E, Peruga A, et al. Role of drug injection in the spread of HIV in Argentina and Brazil. Int J STD AIDS. 1993;4:135–141.
19. The status and trends of the HIV/AIDS epidemics in the world. Barcelona Map Symposium Report. Presented at the XIV International AIDS Conference, Barcelona, July 2002.
20. Gomez Carrillo M, Avila M, Hierholzer J, et al. Mother-to-child HIV type 1 transmission in Argentina: BF recombinants have predominated in infected children since the mid-1980s. AIDS Res Hum Retroviruses. 2002;18:477–483.
21. Thomson MM, Delgado E, Herrero I, et al. Diversity of mosaic structures and common ancestry of human immunodeficiency virus type 1 BF intersubtype recombinant viruses from Argentina revealed by analysis of near full-length genome sequences. J Gen Virol. 2002;83:107–119.
22. Kijak GH, Rubio AE, Quarleri JF, et al. HIV type 1 genetic diversity is a major obstacle for antiretroviral drug resistance hybridization-based assays. AIDS Res Hum Retroviruses. 2001;17:1415–1421.
23. Kijak GH, Carobene MG, Salomon H. A highly prevalent polymorphism at codon 72 of HIV-1 reverse transcriptase in Argentina prevents hybridization reaction at codon 74 in the LiPA genotyping test. J Virol Methods. 2001;94:87–95.
24. Mercado JM, Di Dio R, Pradal M. Genetic diversity of HIV-1 subtype F from Brazil: failure of HIV-1 viral load testing based on molecular biology amplification methods. AIDS. 1999;13:2183–2185.

*The nucleotide sequences reported in this study have been submitted to the GenBank sequence database under the following accession numbers: AY140107, AY140108, AY140109, AY140110, AY140111, AY140112, AY140113, AY140114, AY140115, AY140116, AY140117, AY140118, AY140119, AY140120, AY140121, AY140122, AY140123, AY140124, AY140125, AY140126, AY140127, AY140128, AY140129, AY140130, AY140131, AY140132, AY140133, AY140134, AY140135, AY140136, AY140137, AY140138, AY140139, AY140140, AY140141, AY140142, AY140143, AY140144, AY140145, AY140146, AY140147, AY140148, AY140149, AY140150, AY140151, AY140152, AY140153, AY140154, AY140155, AY140156, AY140157, AY140158, AY140159, AY140160, AY140161, AY140162, AY140163, AY140164, AY140165, AY140166, AY140167, AY140168, and AY140169.
Cited Here

Keywords:

Argentinean injecting drug user; intersubtype recombinant; circulating recombinant form

© 2004 Lippincott Williams & Wilkins, Inc.