Secondary Logo

Journal Logo

Original Articles

Oxyresveratrol-induced Activation of Nrf2/HO-1 Signaling Pathway Enhances Ability of Resveratrol to Inhibit UVB-induced Melanin

Jin, Jia-Hui1,#; Jiang, Yu-Yan2,#; Wang, Yan3,∗; Meng, Zhao-Wei2,∗; Li, Di-Hua4; Zhang, Lei5; Wang, Hao6; Zhang, Yan-Jun6

Author Information
International Journal of Dermatology and Venereology: September 2021 - Volume 4 - Issue 3 - p 152-162
doi: 10.1097/JD9.0000000000000135
  • Open

Abstract

Introduction

UVB irradiation induces melanogenesis through different mechanisms or factors. The skin is in a “self-protection” state when it absorbs physical light waves, and it protects itself from UV radiation damage by enhancing the activity of tyrosinase (TYR) and producing melanin from hydroxylation.1-2

Previous studies have suggested that the antioxidant defense system of the body aids greatly in reducing oxidative stress.3 Nrf2, expressed in melanocytes, is an important transcription factor in the cellular antioxidant system. Nrf2 can activate cytoprotective genes and regulate antioxidant response elements (ARE) by inducing the expression of antioxidants and phase II detoxifying enzymes.4-5 Jian et al.6 found that HO-1 is an antioxidant gene that can be induced via the Nrf2/ARE pathway and reduce hydrogen peroxide-induced oxidative damage in human melanocytes. In order to further explore the relationship between the body's antioxidation defense system and melanin production and confirm that the Nrf2/HO-1 signaling pathway and melanin generation can aid in effectively eliminating UVB-induced ROS, we using PIG1 cells conducted this study.

Morus alba L. is the primary species among mulberries. It has been commonly used in cosmetic products, functional foods and folk medicines. Morus alba contains phenolic compounds such as oxyresveratrol (OXYR) and resveratrol (RES).7 These two kind of naturally occurring phenolic compounds with various bioactivities, including extending the life of caenorhabditis elegans,8 antioxidant and antityrosinase activity,9-10 inhibitting cellular melanogenesis.11 In our previous studies,12 it was found that both OXYR and RES have antioxidant and TYR inhibitory effects. However, their ability to resist oxidation and inhibit TYR varies greatly. When L-tyrosine is used as a substrate, OXYR has a stronger ability to inhibit tyrosinase than RES; when L-dopa is used as a substrate, RES has a stronger ability to inhibit tyrosinase than OXYR. Based on the existing research, we further study OXYR and RES inhibit TYR activity and melanin production whether have a synergistic effect in this study.

To the best of our knowledge, this study is the first to confirm the internal connection between the Nrf2/HO-1 signaling pathway and UVB-induced stress responses of melanocytes. At the same time, it was confirmed that OXYR and RES can synergistically inhibit TYR activity and melanin production. We anticipated that the results would facilitate the development of a novel synergistic strategy for treatment of skin injury using antioxidants and TYR inhibitors. We also aim to provide novel insight for future studies on TYR inhibitors.

Materials and methods

Chemicals and reagents

The immortalized human epidermal melanocyte cell line PIG1 (CRL-2208™) was purchased from Guandao Engineering (Shanghai, China). Fetal bovine serum was purchased from Gibco (Grand Island, NY, USA). Human melanocyte growth supplement-2 and Medium-254-500 were purchased from Thermo Fisher Scientific (Waltham, MA, USA). The following antibodies were applied: β-actin (K101527P; Solarbio, Beijing, China); Nrf2 (#12721), TYR (#11873), and HO-1 (#5853) (Cell Signaling Technology, Danvers, MA, USA); melanocyte-inducing transcription factor (MITF) (ab20663), TYR-related protein 1 (TRP1) (ab249974), and TYR-related protein 2 (TRP2) (ab103463) (Abcam, Cambridge, UK); and goat anti-rabbit IgG (BA1054; Boster, Wuhan, China). pCMV6-XL5 and pCMV6-XL5-Nrf2 (10 μg) were obtained from OriGene Technologies (Rockwell, MD, USA). The protein extraction kit (P0033) was purchased from Beyotime Institute of Biotechnology (Shanghai, China). OXYR (≥98%, AZ71G001) and RES (≥98%, 100401) were acquired from Sabinsa Corporation (Piscataway, NJ, USA). All other purchased chemicals were of high purity and reagent grade.

UVB irradiation and sample treatment

PIG1 cells were cultured in complete medium 254 (M254), including 44.5% (v/v) M254, 5% (v/v) fetal bovine serum, and 0.5% (v/v) human melanocyte growth supplement-2. All cells were maintained at 37 °C in a 5% carbon dioxide incubator. After a 24-hours period of culture, the number of cells accounted for approximately 70%. We removed the supernatant and superadded phosphate-buffered saline (PBS). The cells were then exposed to UVB at a dose of 100, 200, 300, 400, 500, and 600 mJ/cm2 with a UVB source (peak of 311 nm) (SH4B; Shanghai Sigma High Technology Co., Ltd., Shanghai, China). A UVB radiometer with a UVB 304 sensor (UV-B; Shenzhen XRC Electronics Co., Ltd., Shenzhen, China) was used to measure the exposed energy. Immediately after UVB exposure, the PBS was replaced by complete M254 and incubated with 5% carbon dioxide at 37 °C. The control group was unirradiated, whereas the other setup was treated with the same dose as the UVB group. For western blot and real-time quantitative PCR (qPCR), the cells were harvested 24 hours after UVB irradiation.

MTT assay

Cell proliferation was detected based on the methods described by Liu et al.13 In brief, the cells were incubated for 4 h in culture medium with 10 μL of MTT (5 mg/mL). After removing the supernatant, 100 μL of dimethyl sulfoxide (DMSO) was added to the complete M254. Finally, an infinite 200®PRO multifunctional microplate detector (Kendi Trade Co., Ltd., Shanghai, China) was used to measure its absorbance at 490 nm.

Cell apoptosis assay

PIG1 cells (6 × 105 cells/well) were seeded in 60-mm plates and incubated for 24 hours in carbon dioxide for 70% to 80% confluency. The complete M254 was later replaced by 1 mL of PBS. The cells were exposed to UVB irradiation at a dose ranging from 0 to 600 mJ/cm2. The PBS was then immediately replaced by complete M254, and the cells were incubated for 24 hours to assay the apoptosis rates. Apoptotic and necrotic cells were identified using the Annexin V-FITC Apoptosis Detection Kit (abs50001; Absin Bioscience, Shanghai, China) in accordance with the manufacturer's instructions.13 Cell apoptosis was detected by Annexin V/propidium iodide staining as described by Liu et al.13

Nrf2 transient transfection

PIG1 cells (1 × 105 cells/well for 6-well plates and 1 × 104 cells/well for 96-well plates) were plated into each well and cultured for 24 hours. For Nrf2 overexpression, the cells were transfected with pCMV6-XL5 and pCMV6-XL5-Nrf2 (3 μg/well for 6-well plates and 0.15 μg/well for 96-well plates) at 60% to 75% confluency using Lipofectamine 2000 (L-7003; Invitrogen, Carlsbad, CA, USA). After 24 hours of incubation, the cells were recovered in normal media after removal of the transfection reagents and then incubated for an additional 48 hours after transfection to assess the changes in mRNA and protein. Control cells (no transfection), pCMV6-XL5 transfection (no Nrf2), and pCMV6-XL5-Nrf2 transfection were included in each experiment.

Melanin content

The melanin content assay from the study by Zeng et al.14 was adopted. Cells were exposed to UVB irradiation at a dose of 300 mJ/cm2, then immediately replaced by either complete M254 or 90 μmol/L OXYR, 10 μmol/L RES, and 90 μmol/L OXYR + 10 μmol/L RES and incubated for 48 hours. Next, the cells were dissolved in 1 mol/L NaOH/10% DMSO solution and incubated at 90 °C to solubilize the melanin. The control group was treated similarly to the UVB group but did not receive UVB stimulation. The total melanin in each cell suspension was determined by measuring the absorbance at 405 nm.

Eumelanin level determination by enzyme-linked immunosorbent assay

Eumelanin was assayed using a commercially available human enzyme-linked immunosorbent assay kit (JL45240-96T; Jianglai Biological Technology Co., Ltd., Shanghai, China) in accordance with the manufacturer's instructions. The absorbance (A450) was measured using a plate reader (Tecan, Zürich, Switzerland) with a detection sensitivity of ≥1.0 pg/mL. The eumelanin content was calculated by interpolating the results onto a standard curve that was generated using the absorbance measurements of synthetic eumelanin with a correction for the total protein amounts present in the cell lysate supernatants.

Detection of intracellular ROS

At 24 hours or 30 minutes after UVB irradiation, the cells were incubated in a serum-free medium with 10 mmol/L DCFH-DA for 30 minutes. The cells were washed two times with M254, and the green fluorescence corresponding to the intracellular ROS levels was detected under a fluorescence microscope.

TYR inhibition assay

Mushroom TYR inhibition assay

The mushroom TYR inhibition assay was conducted using the methods described below. OXYR and RES were dissolved in suitable DMSO and diluted in 0.1 mmol/L PBS (pH of 6.8). Experiments were performed in triplicate in 96-well plates. The reaction mixture was mixed with 80 μL of 0.1 mmol/L PBS, 40 μL of 5 mmol/L levodopa (L-DOPA) (L8220; Solarbio), and 40 μL of OXYR, RES, and OXYR + RES at different concentrations. The reaction mixture was incubated at 37 °C for 15 minutes. Next, 40 μL of 100 units/mL mushroom TYR (33K34411; TCI, Shanghai, China) was added to the reaction mixtures and incubated at 37 °C for 20 minutes. Dopachrome formation was monitored at 475 nm with an infinite 200®PRO multifunctional microplate detector. The rate of TYR activity inhibition (I%) was determined according to the following formula:

I%=A2A1B2B1A2A1×100%

where A1 and A2 are the absorbance values of the blank at 475 nm at 0 and 20 minutes, respectively, and B1 and B2 are the absorbance levels of the test sample at 475 nm at 0 and 20 minutes, respectively.

Intracellular TYR inhibition assay

Intracellular TYR activity in PIG1 cells was estimated by measuring the L-DOPA oxidation capacity as described by Rong et al.,15 with slight modifications. PIG1 cells (1 × 104 cells/well) were seeded into 96-well plates and incubated overnight. The complete M254 was then replaced by 100 μL of PBS, and the cells were exposed to 300 mJ/cm2 UVB irradiation. The PBS was immediately replaced by complete M254 and OXYR, RES, or OXYR + RES for 24 hours. The PIG1 cells were washed with PBS and lysed in 50 μL of 1% Triton X-100. The cells’ lysates were stored at −80 °C for 30 minutes and then allowed to thaw for 10 minutes at room temperature. Next, 10 μL of freshly prepared L-DOPA (0.25%) was added and incubated for 2 hours at 37 °C. Absorbance was measured at 475 nm using an infinite 200®PRO multifunctional microplate detector.

RNA extraction and real-time qPCR

Total RNA was extracted using the Eastep® Super Total RNA Extraction Kit (LS1040; Promega, Shanghai, China) according to the manufacturer's instructions. After purification and quality checking, the extracted total RNA was reverse-transcribed to cDNA using the total mRNA as a template according to the M-MLV operation instructions (R123-01; Vazyme, Nanjing, China). cDNA was stored at −80 °C for later use. qPCR was performed to detect the expression of MITF, TYR, TRP1, TRP2, Nrf2, and HO-1 according to the SYBR method. Three wells were set for each sample and indexed using GAPDH as the internal reference. The relative expression content of the target RNA was calculated using the 2−△△Ct method. The primer sequences used are listed in Table 1.

Table 1 - Primers used for qPCR.
Gene name Forward primer (5′-3′) Reverse primer (5′-3′)
Nrf2 AGCCCAGCACATCCAGTCAG TGCATGCAGTCATCAAAGTACAAAC
TYR TGCACAGAGAGACGACTCTTG GAGCTGATGGTATGCTTTGCTAA
TRP1 TCATCAACGAACAGTGGGTGGTA ATGATCTTGGCTGCATTGATGAAC
TRP2 CATTTGCAGACTTGGCTTCCAGTA TGGGTTCCGACTGACTGTGTTC
MITF CTCACAGCGTGTATTTTTCCCA ACTTTCGGATATAGTCCACGGAT
HO-1 CGGGCCAGCAACAAAGTG CAATGTCAGCGGAAGTGGAAAC
GAPDH TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG
TYR: tyrosinase; TRP: TYR-related protein; MITF: melanocyte-inducing transcription factor.

Western blot

The protein extracted from PIG1 cells was obtained using a protein extraction kit in accordance with the manufacturer's protocols. Protein samples were subjected to electrophoresis and then transferred to polyvinylidene difluoride membranes. The blot was incubated with the following primary antibodies at 4 °C overnight: primary antibodies to β-actin (1:1,500), MITF (1:900), TYR (1:1,000), TRP1 (1:1,000), TRP2 (1:1,000), Nrf2 (1:1,000), and HO-1 (1:1,000). The membrane was then incubated with goat anti-rabbit IgG (1:4,000). The relative density of each band was analyzed using an imaging densitometer. The densitometry values were normalized using β-actin.

Statistical analysis

Statistical analysis was performed using SPSS Statistics for Windows, Version 17.0 (SPSS Inc., Chicago, IL, USA). Data are presented as mean ± standard deviation. One-way analysis of variance was performed to compare the differences between groups. A two-independent-samples test was performed to assess differences between two groups. A P value of <0.05 was considered statistically significant. Isobologram analysis was used to analyze the interaction between OXYR and RES in the mushroom TYR inhibition experiment.

Results

UVB phototoxicity on PIG1 cells

Apoptosis was assessed in PIG1 cells. Compared with the control cells, the number of apoptotic and necrotic cells increased in a dose-dependent manner after UVB irradiation over 24 hours (Fig. 1A). MTT assays showed an insignificant inhibitory effect on PIG1 cells regardless of the UVB dose (100, 200, or 300 mJ/cm2). However, UVB doses of ≥400 mJ/cm2 resulted in a high number of dead cells. The cell proliferative activity in the 300-mJ/cm2 group was 95% of that in the control group, but the difference was not statistically significant (Fig. 1B).

Figure 1
Figure 1:
Effects of different UVB doses on cell proliferation. (A) UVB irradiation caused apoptosis in PIGI cells, which were stained with Annexin V-FITC and propidium iodide for 15 minutes and analyzed by flow cytometry. Representative flow cytometry graphs are shown. (B) Effects of different UVB irradiation doses on the proliferative activity of PIG1 cells. ∗∗∗ P < 0.001 vs. control group; n = 5. UVB: ultraviolet B.

Nrf2/HO-1 pathway activated by UVB irradiation in PIG1 cells

The changes in Nrf2 and HO-1 mRNA and protein expression in the susceptibility of melanocytes to UVB irradiation were investigated. After irradiation with 300 mJ/cm2 of UVB for 24 hours, the mRNA expression levels of Nrf2 and HO-1 were higher than those in the control group (Fig. 2A). After UVB irradiation of PIG1 cells, the protein expression levels of Nrf2 and HO-1 were higher than those in the control group (Fig. 2B).

Figure 2
Figure 2:
Effects of UVB irradiation on antioxidant genes and melanogenic genes in PIG1 cells. (A) Irradiation with 300 mJ/cm2 of UVB increased the mRNA expression levels of Nrf2 and HO-1 compared with the control group. (B) Western blot analysis demonstrated that after UVB irradiation, the protein expression of Nrf2 and HO-1 was higher than that in the control group. (C) The mRNA levels of MITF, TYR, TRP1, and TRP2 were higher than those in the control group. (D) The protein expression levels of MITF, TYR, TRP1, and TRP2 were determined through western blot analysis. ∗∗ P < 0.01, P < 0.05 vs. control group; n = 3. UVB: ultraviolet B; TYR: tyrosinase; TRP: TYR-related protein; MITF: melanocyte-inducing transcription factor.

Activation of MITF, TYR, and other melanogenesis-related enzymes by UVB irradiation in PIG1 cells

After UVB irradiation with 300 mJ/cm2 of UVB for 24 hours, the MITF, TYR, TRP1, and TRP2 mRNA levels were higher than those in the control group (Fig. 2C). The protein expression of MITF, TYR, TRP1, and TRP2 was higher than that in the control group (Fig. 2D).

Reduction of melanin/eumelanin formation by Nrf2 upregulation

To investigate the relationships among ROS induced by UVB irradiation, melanogenesis, and the Nrf2 pathway, we used pCMV6-XL5-Nrf2 to upregulate Nrf2 expression. Increased Nrf2 protein levels were observed 48 hours after transfection, indicating the success of Nrf2 upregulation. β-actin was used as the internal control. The protein expression levels of Nrf2 were significantly increased. PIG1 cells transfected with pCMV6-XL5-Nrf2 for 48 hours had the same mRNA level as that of Nrf2, while these changes were absent in the mock-treated cells (Fig. 3A–3B).

Figure 3
Figure 3:
Analysis of related indicators after transfection with pCMV6-XL5-Nrf2 in PIG1 cells. Nrf2 protein level (A) and Nrf2 mRNA (B) were measured by Western blot analysis and RT-PCR, respectively, after transfection with pCMV6-XL5-Nrf2. β-actin was used as an internal control. The melanin (C), eumelanin (D), and ROS (E) contents of the PIG1 cells were tested. ∗∗∗ P < 0.001, ∗∗ P < 0.01, P < 0.05 vs. control group; ### P < 0.001, ## P < 0.01 vs. UVB group; n = 3. UVB: ultraviolet B; ROS: reactive oxygen species.

The melanin content of PIG1 cells was significantly increased after irradiation with 300 mJ/cm2 of UVB. This increase was also seen in PIG1 cells pretreated with pCMV6-XL5-Nrf2-UV (i.e., the cells were transfected with pCMV6-XL5-Nrf2 and then irradiated with UVB), but at a significantly lower degree than in the UV group (Fig. 3C). The same trend was observed in the eumelanin content of the cells (Fig. 3D).

The ROS content of the PIG1 cells was measured by flow cytometry. The ROS content of the PIG1 cells was significantly increased 30 minutes and 24 hours after irradiation with 300 mJ/cm2 of UVB, indicating that UVB irradiation can significantly increase ROS generation. The ROS content of the PIG1 cells pretreated with pCMV6-XL5-Nrf2-UV was also significantly increased. However, the increase in the latter was significantly lower than that in the former (Fig. 3E). These results suggest that Nrf2 upregulation can eliminate the ROS produced by UVB and reduce the melanin and eumelanin production.

The ROS content was lower after irradiation for 24 hours than after irradiation for 30 minutes, indicating that the large amount of ROS generated by the UVB irradiation activated the intracellular self-protection system to gradually remove ROS from the body and approach the normal level (Fig. 3E).

Effects of Nrf2 upregulation on TYR, Nrf2, and HO-1

To investigate the existence of a trade-off between the Nrf2/HO-1 antioxidant system and melanogenesis (melanin/eumelanin), we analyzed the protein expression levels of Nrf2, HO-1, and TYR together with their mRNA expression levels in the PIG1 cells pretreated with pCMV6-XL5-Nrf2-UV or UVB irradiation. The protein expression levels of Nrf2 and HO-1 in the PIG1 cells pretreated with pCMV6-XL5-Nrf2-UV were significantly increased. In contrast, the protein levels of TYR in the same PIG1 cells were significantly decreased (Fig. 4A and 4B). The same trend was observed in the mRNA levels (Fig. 4C).

Figure 4
Figure 4:
Analysis of Nrf2, HO-1, and TYR protein and mRNA expression levels after transfection with Nrf2 and irradiation with 300 mJ/cm2 of UVB in PIG1 cells. Nrf2, HO-1, and TYR proteins (A) and mRNA (B) levels were measured by Western blot analysis and RT-PCR, respectively, after transfection with pCMV6-XL5-Nrf2. ### P < 0.001, ## P < 0.01, # P < 0.05 vs. UV group; n = 3. UVB: ultraviolet B; TYR: tyrosinase.

Effects of OXYR, RES, and OXYR + RES on TYR activity

The half maximal inhibitory concentration (IC50) is the concentration at which 50% of a compound's activity is lost. Two compounds were measured at different concentrations. The IC50 of mushroom TYR inhibited by OXYR and RES solutions was 16 μmol/L and 15 μmol/L, respectively.

The effect points (IC50 values) of the various compounding ratios of OXYR and RES fell below the addition line and the 95% confidence limit, indicating that the compounding ratios within the study range had synergistic effects (Fig. 5A). OXYR and RES were most effective when the ratio was 9:1 and the combination index was 0.2077 (Table 2).

Figure 5
Figure 5:
TYR inhibitory effects of drugs were tested according to the L-DOPA oxidation method. (A) Isobologram plots of various compound ratios of OXYR and RES. -□- represents the theoretical IC50 value (IC50add) after compounding, and -▴- represents the actual IC50 value after compounding (IC50mix). (B) Inhibitory effect of OXYR and RES at a ratio of 9:1 on intracellular TYR. The OXYR:RES (μmol/L) ratios of 54:6, 72:8, 90:10, 108:12, and 126:14 are shown in order 1, 2, 3, 4, and 5. TYR: tyrosine; OXYR: oxyresveratrol; RES: resveratrol, IC50: half maximal inhibitory concentration.
Table 2 - Inhibitory effect of OXYR and RES on mushroom tyrosinase (n = 3).
Concentration (μmol/L)

RES:OXYR (μmol/L) RES OXYR Inhibition rate (%) IC50 (μmol/L) IC50add (μmol/L) γ
1:9 0.1 0.9 33.58 ± 0.009 3.3 15.89 0.2077
1.0 9.0 63.18 ± 0.003
10.0 90.0 91.84 ± 0.001
2:8 0.2 0.8 33.09 ± 0.003 3.6 15.79 0.2280
2.0 8.0 61.13 ± 0.005
20.0 80.0 91.98 ± 0.003
3:7 0.3 0.7 33.50 ± 0.009 3.4 15.69 0.2167
3.0 7.0 61.65 ± 0.007
30.0 70.0 93.35 ± 0.001
4:6 0.4 0.6 35.25 ± 0.006 3.3 15.58 0.2118
4.0 6.0 60.56 ± 0.001
40.0 60.0 93.37 ± 0.001
5:5 0.5 0.5 27.66 ± 0.003 4.1 15.48 0.2649
5.0 5.0 62.10 ± 0.004
50.0 50.0 93.57 ± 0.003
6:4 0.6 0.4 26.11 ± 0.007 4.2 15.38 0.2731
6.0 4.0 63.39 ± 0.004
60.0 40.0 92.93 ± 0.001
7:3 0.7 0.3 27.11 ± 0.006 3.7 15.29 0.2420
7.0 3.0 67.81 ± 0.004
70.0 30.0 93.21 ± 0.001
8:2 0.8 0.2 16.78 ± 0.006 5.6 15.19 0.3687
8.0 2.0 65.43 ± 0.006
80.0 20.0 92.38 ± 0.002
9:1 0.9 0.1 12.33 ± 0.004 10.1 15.09 0.6693
9.0 1.0 50.67 ± 0.004
90.0 10.0 86.61 ± 0.004
IC50: half maximal inhibitory concentration; OXYR: oxyresveratrol; RES: resveratrol.

Experiments were carried out with a fixed ratio of cells. When the concentration of OXYR and RES was 90 μmol/L and 10 μmol/L, respectively, the inhibition rate at this dose was 1.68 times higher than the sum of the inhibition rates of OXYR and RES alone. The effect of synergistic inhibition of TYR was strongest under these circumstances; therefore, this concentration was selected for subsequent experiments (Fig. 5B).

Effects of OXYR, RES, and OXYR + RES on MITF, TYR, and other melanogenesis-related enzymes after UVB irradiation of melanocytes

UVB radiation of PIG1 cells can influence melanogenesis-related enzymes and the Nrf2/HO-1 pathway. To evaluate the effect of OXYR, RES, and OXYR + RES in PIG1 cells, we measured the protein levels of MITF, TYR, TRP1, TRP2, Nrf2, and HO-1 with western blotting. Based on previous results, we already knew that exposure of PIG1 cells to UVB significantly increases the MITF, TYR, TRP1, TRP2, Nrf2, and HO-1 levels compared with control cells (Fig. 2A and 3A). However, the group treated with OXYR, RES, and OXYR + RES showed decreases in UVB-induced MITF, TYR, TRP1, TRP2, Nrf2, and HO-1 (Fig. 6A–6D). The degree of reduction of the protein expression levels in ascending order was OXYR, RES, and OXYR + RES.

Figure 6
Figure 6:
Effect of OXYR, RES, and OXYR + RES on MITF, TYR, TRP1, TRP2 and melanogenesis after UVB irradiation of melanocytes. (A, B) The protein expression of MITF, TYR, TRP1, TRP2, Nrf2, and HO-1 was higher than that in the control group. Protein optical density relative to β-actin. (C) Effect of OXYR, RES, and OXYR + RES on melanogenesis. ∗∗∗ P < 0.001, ∗∗ P < 0.01, P < 0.05 vs. UV group; ### P < 0.001, ## P < 0.01, # P < 0.05 vs. OXYR group; n = 3. OXYR: oxyresveratrol; RES: resveratrol; MITF: Microphthalmia-associated transcription factor; TYR: tyrosine; TRP: TYR-related protein; UVB: ultraviolet B.

Effects of OXYR, RES, and OXYR + RES on melanogenesis

The melanin content of PIG1 cells was significantly lower after incubation with 90 μmol/L OXYR, 10 μmol/L RES, or 90 μmol/L OXYR + 10 μmol/L RES in complete medium after 300 mJ/cm2 of UVB than that in the UV group irradiated with 300 mJ/cm2 of UVB (Fig. 6E). Furthermore, the melanin content in the OXYR + RES group was lower than that in the OXYR group and RES group.

Discussion

UV irradiation stimulates melanin synthesis as a form of protection against damage. UVB light is mostly absorbed by the epidermis because of its low penetration into the dermis. However, an excessive stress response and damage induced by ROS generation from UVB can lead to further cell damage and harmful reactions such as pigmentation, erythema, immunosuppression, loss of hair, and premature aging.16-17 In this study, we found that UVB irradiation can significantly inhibit PIG1 cell growth regardless of the UVB dose. However, when the UVB dose was ≥400 mJ/cm2, cell viability significantly decreased. Based on these results, the UVB dose of 300 mJ/cm2 was applied in subsequent experiments.

Upon exposure to UV irradiation, epidermal melanocytes produce melanin that is transferred to neighboring keratinocytes, thereby allowing UV radiation absorption to protect the cells from UV irradiation-induced damage and displaying photo-protective and thermoregulatory roles.18 Melanin can be classified into two types, eumelanin and pheomelanin,19 that have different chemical and biological reactions upon exposure to light because of their different structures and physical properties. For example, eumelanin acts as an effective sunscreen that protects skin cells against damage from UV radiation. In contrast, pheomelanin is more sensitive to radiation than eumelanin, generates ROS after UV exposure, and has harmful effects.20-21 The color of skin is mainly determined by the ratio of eumelanin and pheomelanin. The physiological function of eumelanin is superior to that of pheomelanin. Therefore, we measured the content of melanin and eumelanin.

Melanogenesis is stimulated by α-melanocyte-stimulating hormone, which binds to the melanocortin 1 receptor and transduces a signal to increase the expression of MITF by activating cyclic adenosine monophosphate.22-23 MITF controls the expression of melanogenesis-related enzymes such as TYR, TRP1, and TRP2.24 ROS are also associated with melanogenesis.25-26 Previous studies have shown that MITF is phosphorylated and then degraded under ROS stimulation.27 In the present study, when UVB irradiation was performed for 30 minutes, the ROS content, melanin and eumelanin production, and melanogenesis-associated proteins MITF, TYR, TPR1, and TPR2 were increased. These results indicate that after UVB irradiation, a large amount of ROS was produced in PIG1 cells, which stimulated the ROS-MITF signaling pathway in vivo. This in turn activated proteins related to melanogenesis and triggered melanin and eumelanin production in order to scavenge ROS and protect melanocytes from ROS. After 24 hours, the ROS in the body that have been exacerbated by UVB exposure were cleared by the spontaneous clearance mechanism of melanocytes and tended toward normal levels.

ROS generated from UVB irradiation can also stimulate antioxidant and/or phase II detoxifying enzymes as a protective measure. Antioxidant activity is essential in the prevention and reparation of UV-induced skin damage and photoaging. Nrf2 is a key transcription factor expressed in melanocytes and is enhanced during cellular defenses.28-29 UV radiation, particularly UVB radiation, significantly increases the expression levels of the transcription factor Nrf230 and subsequently its main target antioxidant gene, HO-1.6 Our discovery is consistent with previous studies, showing that Nrf2 and its corresponding biphasic protein HO-1 were activated when cells were exposed to UVB irradiation.

To prove the hypothesis of involvement of the Nrf2/HO-1 pathway in cell protection against UVB light, we upregulated Nrf2 in subsequent experiments followed by UVB irradiation. As a result, the protein and mRNA levels related to the antioxidant system (Nrf2/HO-1) were significantly increased. However, the protein and mRNA levels related to melanogenesis (TYR) were significantly decreased. Combined with the findings from previous studies, we concluded that both the Nrf2/HO-1 pathway and melanogenesis are self-protection methods that protect PIG1 cells against UVB radiation damage.

Our findings from this study revealed a microbalance between melanogenesis and the direct presence of Nrf2/HO-1, whereby melanogenesis and TYR are reduced but ROS scavenging effects are increased by high expression of Nrf2. TYR inhibition is currently the main focus in the treatment of pigmentation disorders. Because TYR only exists in melanocytes in the basal layer of the epidermis, there are challenges in administration and limitations in the therapeutic effects of such treatments.

The effects of OXYR and RES on TYR activity in vitro and cellular melanin synthesis are different.11 This may be due to the fact that many signal pathways affect melanogenesis, such as MITF,31 and RES has a certain inhibitory effect on these various pathways. Therefore, the inhibition of melanogenesis should be determined by the comprehensive effect of compounds on multiple signal pathways.

RES reportedly has mushroom TYR inhibitor activity.32 In addition to direct inhibition, RES is also known to inhibit melanocyte-stimulating hormone signaling in melanoma cells and to reduce the tyrosinases TRP1, TRP2, and MITF.33-35 According to the results reported by Park et al.,11 the inhibitory effects of RES and OXYR on the key proteins related to above melanin production are different. Our study clearly showed that OXYR and RES have a synergistic effect on melanogenesis in PIG1 cells through downregulating MITF, TRP1, and HO-1.

Our previous research suggested that an effective antioxidant can improve the activities of TYR inhibitors. In combination with these findings, Nrf2 is believed to be a promising target for future treatments of pigmentation disorders because TYR inhibition and antioxidant defense simultaneously occur. To the best of our knowledge, this study is the first to clarify the relationship between the Nrf2/HO-1 antioxidant system and melanogenesis (melanin/eumelanin), thereby providing a new target for such basic treatments, facilitating comprehensive improvement in the basic therapeutic effects, and providing a new research idea for the cosmetics industry.

Although this manuscript has clarified the microbalance between the antioxidant system and melanogenesis, the skin does not only contain melanocytes. We used only PIG1 cells for this study; therefore, there may be slight differences between the experimental results and the actual clinical situation.

Source of funding

The study was supported by the National Natural Science Foundation of China (No.81602773).

References

[1]. Simon JD, Peles D, Wakamatsu K, et al. Current challenges in understanding melanogenesis: bridging chemistry, biological control, morphology, and function. Pigment Cell Melanoma Res 2009;22 (5):563–579. doi: 10.1111/j.1755-148X.2009.00610.x.
[2]. Koga S, Nakano M, Tero-Kubota S. Generation of superoxide during the enzymatic action of tyrosinase. Arch Biochem Biophys 1992;292 (2):570–575. doi: 10.1016/0003-9861(92)90032-r.
[3]. Birch-Machin MA, Bowman A. Oxidative stress and ageing. Br J Dermatol 2016;175 (Suppl 2):26–29. doi: 10.1111/bjd.14906.
[4]. Chaiprasongsuk A, Onkoksoong T, Pluemsamran T, et al. Photoprotection by dietary phenolics against melanogenesis induced by UVA through Nrf2-dependent antioxidant responses. Redox Biol 2016;8:79–90. doi: 10.1016/j.redox.2015.12.006.
[5]. Schäfer M, Werner S. Nrf2--A regulator of keratinocyte redox signaling. Free Radic Biol Med 2015;88 (Pt B):243–252. doi: 10.1016/j.freeradbiomed.2015.04.018.
[6]. Jian Z, Li K, Liu L, et al. Heme oxygenase-1 protects human melanocytes from H2O2-induced oxidative stress via the Nrf2-ARE pathway. J Invest Dermatol 2011;131 (7):1420–1427. doi: 10.1038/jid.2011.56.
[7]. Piao SJ, Chen LX, Kang N, et al. Simultaneous determination of five characteristic stilbene glycosides in root bark of Morus albus L. (Cortex Mori) using high-performance liquid chromatography. Phytochem Anal 2011;22(3):230–235. doi: 10.1002/pca.1270.
[8]. Lee J, Kwon G, Park J, et al. Brief Communication: SIR-2.1-dependent lifespan extension of Caenorhabditis elegans by oxyresveratrol and resveratrol. Exp Biol Med (Maywood) 2016;241 (16):1757–1763. doi: 10.1177/1535370216650054.
[9]. Koyu H, Kazan A, Demir S, et al. Optimization of microwave assisted extraction of Morus nigra L. fruits maximizing tyrosinase inhibitory activity with isolation of bioactive constituents. Food Chem 2018;248:183–191. doi: 10.1016/j.foodchem.2017.12.049.
[10]. Chang LW, Juang LJ, Wang BS, et al. Antioxidant and antityrosinase activity of mulberry (Morus alba L.) twigs and root bark. Food Chem Toxicol 2011;49 (4):785–790. doi: 10.1016/j.fct.2010.11.045.
[11]. Park J, Park JH, Suh HJ, et al. Effects of resveratrol, oxyresveratrol, and their acetylated derivatives on cellular melanogenesis. Arch Dermatol Res 2014;306 (5):475–487. doi: 10.1007/s00403-014-1440-3.
[12]. Wang Y, Hao MM, Sun Y, et al. Synergistic promotion on tyrosinase inhibition by antioxidants. Molecules 2018;23 (1). doi: 10.3390/molecules23010106.
[13]. Liu R, Xie H, Luo C, et al. Identification of FLOT2 as a novel target for microRNA-34a in melanoma. J Cancer Res Clin Oncol 2015;141 (6):993–1006. doi: 10.1007/s00432-014-1874-1.
[14]. Zeng Q, Wang Q, Chen X, et al. Analysis of lncRNAs expression in UVB-induced stress responses of melanocytes. J Dermatol Sci 2016;81 (1):53–60. doi: 10.1016/j.jdermsci.2015.10.019.
[15]. Rong J, Shan C, Liu S, et al. Skin resistance to UVB-induced oxidative stress and hyperpigmentation by the topical use of Lactobacillus helveticus NS8-fermented milk supernatant. J Appl Microbiol 2017;123 (2):511–523. doi: 10.1111/jam.13506.
[16]. Kunisada M, Hosaka C, Takemori C, et al. CXCL1 Inhibition Regulates UVB-Induced Skin Inflammation and Tumorigenesis in Xpa-Deficient Mice. J Invest Dermatol 2017;137 (9):1975–1983. doi: 10.1016/j.jid.2017.04.034.
[17]. Kim KM, Im AR, Lee S, et al. Dual protective effects of flavonoids from petasites japonicus against UVB-induced apoptosis mediated via HSF-1 activated heat shock proteins and Nrf2-activated heme oxygenase-1 pathways. Biol Pharm Bull 2017;40 (6):765–773. doi: 10.18/bpb.b16-00691.
[18]. Lin JY, Fisher DE. Melanocyte biology and skin pigmentation. Nature 2007;445 (7130):843–850. doi: 10.1038/nature05660.
[19]. Rzepka Z, Buszman E, Beberok A, et al. From tyrosine to melanin: Signaling pathways and factors regulating melanogenesis. Postepy Hig Med Dosw (Online) 2016;70 (0):695–708. doi: 10.5604/17322693.1208033.
[20]. Wolber R, Schlenz K, Wakamatsu K, et al. Pigmentation effects of solar-simulated radiation as compared with UVA and UVB radiation. Pigment Cell Melanoma Res 2008;21 (4):487–491. doi: 10.1111/j.1755-148X.2008.00470.x.
[21]. Wenczl E, Van der Schans GP, Roza L, et al. (Pheo)melanin photosensitizes UVA-induced DNA damage in cultured human melanocytes. J Invest Dermatol 1998;111 (4):678–682. doi: 10.1046/j.1523-1747.1998.00357.x.
[22]. Bertolotto C, Abbe P, Hemesath TJ, et al. Microphthalmia gene product as a signal transducer in cAMP-induced differentiation of melanocytes. J Cell Biol 1998;142 (3):827–835. doi: 10.1083/jcb.142.3.827.
[23]. Suzuki I, Cone RD, Im S, et al. Binding of melanotropic hormones to the melanocortin receptor MC1R on human melanocytes stimulates proliferation and melanogenesis. Endocrinology 1996;137 (5):1627–1633. doi: 10.1210/endo.137.5.8612494.
[24]. Hoek KS, Schlegel NC, Eichhoff OM, et al. Novel MITF targets identified using a two-step DNA microarray strategy. Pigment Cell Melanoma Res 2008;21 (6):665–676. doi: 10.1111/j.1755-148X.2008.00505.x.
[25]. Liu GS, Peshavariya H, Higuchi M, et al. Microphthalmia-associated transcription factor modulates expression of NADPH oxidase type 4: a negative regulator of melanogenesis. Free Radic Biol Med 2012;52 (9):1835–1843. doi: 10.1016/j.freeradbiomed.2012.02.040.
[26]. Cunha ES, Kawahara R, Kadowaki MK, et al. Melanogenesis stimulation in B16-F10 melanoma cells induces cell cycle alterations, increased ROS levels and a differential expression of proteins as revealed by proteomic analysis. Exp Cell Res 2012;318 (15):1913–1925. doi: 10.1016/j.yexcr.2012.05.019.
[27]. Ko GA, Cho SK. Phytol suppresses melanogenesis through proteasomal degradation of MITF via the ROS-ERK signaling pathway. Chem Biol Interact 2018;286:132–140. doi: 10.1016/j.cbi.2018.02.033.
[28]. Jeayeng S, Wongkajornsilp A, Slominski AT, et al. Nrf2 in keratinocytes modulates UVB-induced DNA damage and apoptosis in melanocytes through MAPK signaling. Free Radic Biol Med 2017;108:918–928. doi: 10.1016/j.freeradbiomed.2017.05.009.
[29]. Janjetovic Z, Jarrett SG, Lee EF, et al. Melatonin and its metabolites protect human melanocytes against UVB-induced damage: Involvement of NRF2-mediated pathways. Sci Rep 2017;7 (1):1274. doi: 10.1038/s41598-017-01305-2.
[30]. Gęgotek A, Domingues P, Skrzydlewska E. Proteins involved in the antioxidant and inflammatory response in rutin-treated human skin fibroblasts exposed to UVA or UVB irradiation. J Dermatol Sci 2018;90 (3):241–252. doi: 10.1016/j.jdermsci.2018.02.002.
[31]. Na JI, Shin JW, Choi HR, et al. Resveratrol as a multifunctional topical hypopigmenting agent. Int J Mol Sci 2019;20 (4). doi: 10.3390/ijms20040956.
[32]. Satooka H, Kubo I. Resveratrol as a kcat type inhibitor for tyrosinase: potentiated melanogenesis inhibitor. Bioorg Med Chem 2012;20 (2):1090–1099. doi: 10.1016/j.bmc.2011.11.030.
[33]. Lee TH, Seo JO, Baek SH, et al. Inhibitory effects of resveratrol on melanin synthesis in ultraviolet B-induced pigmentation in Guinea pig skin. Biomol Ther (Seoul) 2014;22 (1):35–40. doi: 10.4062/biomolther.2013.081.
[34]. Chen YJ, Chen YY, Lin YF, et al. Resveratrol inhibits alpha-melanocyte-stimulating hormone signaling, viability, and invasiveness in melanoma cells. Evid Based Complement Alternat Med 2013;2013:632121. doi: 10.1155/2013/632121.
[35]. Lin CB, Babiarz L, Liebel F, et al. Modulation of microphthalmia-associated transcription factor gene expression alters skin pigmentation. J Invest Dermatol 2002;119 (6):1330–1340. doi: 10.1046/j.1523-1747.2002.19615.x.
Keywords:

melanin; Nrf2/HO-1; oxyresveratrol; reactive oxygen species; resveratrol; tyrosinase

Copyright © 2021 Hospital for Skin Diseases (Institute of Dermatology), Chinese Academy of Medical Sciences, and Chinese Medical Association, published by Wolters Kluwer, Inc.