Secondary Logo

Journal Logo

Epidemiology

PARP1 rs1136410 (A/G) polymorphism is associated with early age of onset of gallbladder cancer

Anjali, Kumaria; Singh, Deepikab; Kumar, Puneetc; Kumar, Tarund; Narayan, Gopeshwarb; Singh, Sunitaa

Author Information
European Journal of Cancer Prevention: July 2022 - Volume 31 - Issue 4 - p 311-317
doi: 10.1097/CEJ.0000000000000708
  • Free

Abstract

Introduction

Gallbladder cancer (GBC) is the sixth most common cancer in gastrointestinal malignancy and is associated with poor overall 5 years survival rate (Wernberg and Lucarelli, 2014; Nemunaitis et al., 2018). The incidence of GBC is more common in India, Chile, Japan, Central Europe, Poland, Israel and Southern Pakistan and relatively uncommon in the western world (Aloia et al., 2015). India contributes to about 10% of the global GBC burden. GBC has been termed as an ‘Indian’ disease and its prevalence rate is high in the Northern and North-Eastern states (Dutta et al., 2019). Gallbladder cancer develops progressively from chronic inflammation, gallbladder wall thickening, metaplasia, dysplasia, in situ carcinoma and invasive cancer (Garcia et al., 2009; Misra et al., 2003). The common symptom of GBC is obstructive jaundice and is most common among women in northern India (Varma et al., 2009; Hawkins et al., 2004). Risk factors of GBC may vary depending on geographical and environmental variations (Zhou et al., 2016). Several risk factors such as chronic inflammation, exposure to chemicals and nutrients can cause increased production of reactive oxygen species resulting in oxidative damage to gallbladder cells (Srivastava et al., 2009; Singh et al., 2019). DNA repair mechanisms maintain genomic stability and integrity. Base excision repair (BER) is a highly conserved mechanism. It is responsible for repair of the damaged DNA bases mainly arising from endogenously produced oxidative and hydrolytic damage (Ide and Kotera 2004; Wood et al., 2001). Poly ADP ribose polymerases 1 (PARP1) is a molecule of the BER pathway. It is also known as ADP ribosyl transferase. PARP1 is activated by a single or double-strand DNA break (Feng and Koh, 2013). It is involved in several cellular mechanisms, such as DNA damage repair, mitotic apparatus function, cell death and DNA damage recognition (Tong et al., 2007; Cheng et al., 2019). Previous studies have reported that PARP1 is associated with several cancer risks and plays an important role in carcinogenesis (Gonzalez-Flores et al., 2014). Many SNPs of PARP1 play a critical role in the DNA repair mechanism in cancers (Hua et al., 2014; Dantas et al., 2020). The structure of PARP1 protein consists of three main domains: an amino-terminal DNA-binding domain that consists of zinc-finger motifs, a BRCT domain-containing central auto modification domain and a highly conserved carboxy-terminal catalytic domain (Azarm and Smith, 2020). PARP1 rs1136410 polymorphism is located in the 6th helix of the catalytic domain and 5th helix of the regulatory domain. PARP1 A/G results in change from Val to Ala at codon 762 (Alanazi et al., 2013; Wang et al., 2015; Cheng et al., 2019). The transition from valine to alanine substitution increases the Km that causes decrease in the enzyme activity of the PARP1 (Lockett et al., 2004; Alanazi et al., 2013). PARP1 rs1136410 (Val 762 Ala) polymorphism has been reported to alter the function of PARP1 protein and is associated with risks in several cancers (Alanazi et al., 2013; Bashir et al., 2018); however, its association with gallbladder cancer has not been studied. Since PARP1 rs1136140 polymorphism alters the activity of PARP1 protein, we hypothesized that PARP1 rs1136410 may be involved in the development of gallbladder cancer. We have investigated the association of PARP1 rs1136410 polymorphism with gallbladder cancer in the Indian population of eastern Uttar Pradesh and western Bihar. We have also evaluated the correlation of rs1136410 with clinical parameters and overall survival.

Materials and methods

Study population

Peripheral blood and tissue biopsies from the study cohort in this study were collected after informed written consent according to the approved protocol by the Institutional Ethical Committee of Faculty of Science, Banaras Hindu University. Peripheral blood samples were collected from a total of 400 newly diagnosed gallbladder cancer patients (fine-needle aspirated cell cytology [FNAC] and histopathological proven) from the Departments of General Surgery and Surgical Oncology of Sir Sunderlal Hospital, Banaras Hindu University Varanasi, India. The staging of gallbladder cancer was documented according to the American Joint Committee on Cancer. The clinical profile of GBC patients was based on hospital investigation. Peripheral blood from a total of 354 healthy controls were also collected from the general population ethnicity matched to the patients. The inclusion criteria for the control group include the absence of any history of malignancy, diabetes mellitus and gallstone proven by ultrasonography. Patients were followed after 2 months from the date of diagnosis to their death or last follow-up (up to 31 January 2020). Prognostic data, such as chemotherapy and overall survival, were collected by either hospital visits or telephonic interviews.

DNA extraction

Blood samples (3–4 ml) of all patients and controls were collected in 0.5 M EDTA (Sigma, USA) vials. Genomic DNA was extracted from peripheral blood leukocytes using the standard salting-out method. Extracted DNA was quantified using a Nanodrop Analyzer (Thermo Scientific, USA).

Genotyping of the PARP1 gene polymorphism

The SNP rs1136410 of PARP1 was selected based on its functional role, reported prevalence of at least 5% for the variant allele and published evidence of its association with cancer. PARP1 rs1136410 was genotyped by PCR-RFLP (PCR-restriction fragment length polymorphism). The sequence of the primer set is as follows: forward 5′ TTGACATCGATGGGATCCTT -3′ and reverse 5′- CCCAAATGTCAGCATGTACG -3′. Amplicons of 393 base pairs were analyzed on 2% agarose gel and visualized using UV-transilluminator in gel documentation system (Alpha Innotech, USA). The PCR reaction mixture was digested with StyI (Thermo Scientific) at 37°C for 16 h and resolved on 2% agarose gel, visualized and photographed. While the valine allele gives 251 and 142 base pair fragments following StyI digestion of the PCR product, alanine allele remains an undigested fragment of 393 base pairs.

Statistical analysis

The power of the study is >80% which was calculated using Epi-Info program (http://wwwn.cdc.gov/epiinfo/). Odds ratios (OR), 95% confidence interval (CI) and P value for the assessment of associated risk due to genotypes and variant alleles of studied polymorphism were also calculated by the same program. A P value <0.05 is considered as statistically significant. A binary logistic regression test was used for PARP1 rs1136410 polymorphism with clinical parameters. Overall survival time was calculated from the follow-up data. We employed the Kaplan–Meier method to draw the overall survival curves of the SNP and used the log-rank test to compare the differences between groups. We performed multivariate analysis using Cox-regression model to examine the association of PARP1 rs1136410 with overall survival, adjusting for potential confounders including age, sex, jaundice, TNM staging, lymph node involvement and chemotherapy. All statistical analyses were performed using SPSS 20.0 (SPSS Inc., USA).

Results

Clinical characteristics

The demographic and clinical characteristics of GBC patients and controls are summarized in Table 1. There is a significant difference in sex and age between GBC patients and controls. Interestingly, there is a significant difference between early and late age of onset of the disease in GBC patients (P = 0.0055). Gallstones were present in 57% of GBC patients, and gallbladder wall thickness was present in 71% of GBC patients. About 86% of the GBC patients were in advanced stages of cancer (stage III and stage IV). Tumor infiltration was observed in 65% and lymph node involvement was observed in 67% of the GBC patients.

Table 1 - Clinical characteristics of patients with gallbladder cancer and control subjects
Variables GBC (%) (N = 400) Controls (%) (N = 354) Chi-square test P value
Age of onset
 Early (<50 years) 146 (36.5) 291 (82)
 Late (≥50 Years) 254 (63.5) 63 (18) 161 6.8867E-37
Sex
 Women 290 (72.5) 122 (34.5)
 Men 110 (27.5) 232 (65.5) 109.6 1.18279E-25
Gallstone status N/A
 Present 229 (57)
 Absent 159 (40)
 Missing 12 (03)
Gallbladder wall N/A
 Thick 283 (71)
 Normal 107 (27)
 Missing 10 (2)
Jaundice N/A
 Yes 164 (41)
 No 224 (56)
 Missing 12 (3)
TNM stage N/A
 I 16 (4)
 II 31 (8)
 III 174 (43)
 IV 171 (43)
 Missing 8 (2)
Tumor status N/A
 T1 22 (5.5)
 T2 59 (15)
 T3 261 (65)
 T4 50 (12.5)
 Tx 8 (2)
Lymph node involvement status N/A
 N0 124 (31)
 N1 + N2 268 (67)
 Nx 8 (2)
Metastasis status N/A
 M0 256 (64)
 M1 136 (34)
 Mx 8 (2)
Ascites N/A
 Yes 72 (18)
 No 261 (65)
 Missing 67 (17)
Retroperitoneal/inguinal lymphadenopathy status N/A
 Yes 62 (16)
 No 269 (67)
 Missing 69 (17)
P value <0.05 is considered statistically significant. N = total number of samples.
GBC, gallbladder cancer.

Association of PARP1 rs1136410 (A/G) polymorphism with GBC risks

The genotype and allele frequencies of the analyzed SNP with the resulting odds ratio and the significance level are shown in Table 2. The distribution of the genotype of polymorphism in control follows the Hardy–Weinberg equilibrium (P < 0.05). On comparing the genotype frequency distribution in GBC patients with that of controls, the frequency of the genotype GG (OR = 3.6; 95% CI, 1.78–7.25; P = 0.0003) is significantly higher in GBC patients than that of controls which indicates association with the increased risk for the disease. Allele G has also been found to be significantly associated with increased risk for GBC (OR = 1.44; 95% CI, 1.15–1.81; P = 0.002). Association of PARP1 rs1136410 follows both dominant and recessive genetic models in the present study.

Table 2 - Genotype and allele frequency distribution of PARP1 rs1136410 (A/G) and risk associated with gallbladder cancer
PARP1 GBC (N = 400) [n (%)] Controls (N = 354) [n (%)] P value a OR (95% CI)
AA 173 (43) 185 (52) 1 (Ref.)
AG 190 (48) 158 (45) 0.11 1.29 (0.96–1.73)
GG 37 (9) 11 (3) 0.0003 3.6 (1.78–7.25)
Allele A 536 (67) 528 (75) 1 (Ref.)
Allele G 264 (33) 180 (25) 0.00155 1.44 (1.15–1.81)
Dominant
 AA 173 (43) 185 (52)
 AG+GG 227 (57) 169 (48) 0.016 1.44 (1.08–1.915)
Recessive
 AA + AG 363 (91) 343 (97)
 GG 37 (9) 11 (3) 0.001 3.2 (1.6–6.33)
P values <0.05 are statistically significant and are in bold.
CI, confidence interval; N, total number of samples; OR, odds ratio.
aChi-square test.

Association of PARP1 rs1136410 (A/G) polymorphism with age of onset of GBC and sex

To evaluate the association of PARP1 rs1136410 with age at cancer diagnosis and sex we classified patients and controls based on the age of onset and sex. Controls and GBC patients below 50 years of age were grouped as earlyonset (<50 years) and more than or equal to 50 years were grouped as late-onset (≥50 years). We performed the correlation analysis between PARP1 rs1136410 polymorphism and clinical parameters such as sex and age of onset with gallbladder cancer by logistic regression model (Table 3). Patients with early age of onset having GG genotype have a significantly increased risk of GBC (OR = 3.8; 95% CI, 1.47–9.7; P = 0.006). Similarly, women patients having genotype GG and AG demonstrate significantly increased risk of GBC (OR = 5.1; 95% CI, 1.49–17.44; P = 0.0085 and OR = 1.6; 95% CI, 1.03–2.48; P = 0.035, respectively) and also men patients having GG genotype demonstrate significantly increased risk of GBC (OR = 2.8; 95% CI, 1.03–7.39; P = 0.043). However, the genotypes and allele frequencies of PARP1 rs1136410 did not show a significant association with risk of GBC in late age of onset.

Table 3 - Frequency distribution of PARP1 Val762Ala (rs1136410) genotype in gallbladder cancer patients and controls based on age of onset and sex
Variables Patients, N (%) Controls, N (%) OR (95%CI) P value a
Age of onset
 Early (<50 years) 146 291
  AA 60 (41) 151 (52) 1 (Ref.)
  AG 74 (51) 132 (45) 1.4 (0.93–2.13) 0.10
  GG 12 (8) 8 (3) 3.8 (1.47–9.7) 0.006 a
 Late (≥50 Years) 254 63
  AA 113 (44) 34 (54) 1 (Ref.)
  AG 116 (46) 26(41) 1.34 (0.76–2.38) 0.31
  GG 25 (10) 3 (5) 2.5 (0.71–8.82) 0.15
Sex
 Women 290 122
  AA 120 (41.4) 68 (56) 1 (Ref.)
  AG 143 (49.3) 51 (42) 1.6 (1.03–2.48) 0.035
  GG 27 (9.3) 3 (2) 5.1 (1.49–17.44) 0.009 a
 Men 110 232
  AA 53 (48) 117 (50.4) 1 (Ref.)
  AG 47 (43) 107 (46.1) 0.95 (0.605–1.55) 0.99
  GG 10 (9) 8 (3.5) 2.8 (1.03–7.39) 0.043
CI, confidence interval; OR, odds ratio.
aP values <0.05 are statistically significant and are in bold.

Correlation of clinical parameters on the association of PARP1 rs1136410 (A/G) polymorphism with GBC risk

We analyzed the correlation of PARP1 rs1136410 polymorphism with clinical parameters such as gallstone, gallbladder wall thickening, jaundice, tumor status, lymph node status, distant metastasis, tumor stage and chemotherapy status (Table 4). Interestingly, our results demonstrate that the carrier of at-risk allele of PARP1 rs1136410 (A/G) polymorphism (genotypes AG+GG) are significantly more frequent in the thick gallbladder wall (P = 0.012), with jaundice (P = 0.038) and with the presence of lymph node (P = 0.014) than in patients with normal gallbladder wall thickness, without jaundice and absence of lymph node involvement. We did not find a significant difference between the presence or absence of gallstone, tumor status, tumor stages, distant metastasis and chemotherapy among genotypes of PARP1 rs1136410 polymorphism.

Table 4 - Correlation of PARP1 rs1136410 (A/G) genotypes with different clinical parameters
Variables PatientsN (%) Genotypes P value a
AA (nonrisk group) AG + GG (risk group)
Gallstone
 Yes 229 (59) 102 (45) 127 (55)
 No 159 (41) 66 (41.5) 93 (58.5) 0.60
Gallbladder wall
 Thick 283 (73) 111 (39) 172 (61)
 Normal 107 (27) 57 (53) 50 (47) 0.012 a
Jaundice status
 Yes 164 (42) 61 (37) 103 (63)
 No 224 (58) 107 (48) 117 (52) 0.038 a
Tumor status
 T1 + T2 81 (21) 38 (47) 43 (53)
 T3 + T4 311 (79) 132 (42) 179 (58) 0.47
Lymph-node status
 N0 124 (32) 65 (52) 59 (48)
 N1 + N2 268 (68) 105 (39) 163 (61) 0.014 a
Distant metastasis
 M0 256 (65) 112 (44) 144 (56)
 M1 136 (35) 58 (43) 78 (57) 0.83
Tumor stages
 I + II 47 (12) 25 (53) 22 (47)
 III + IV 345 (88) 145 (42) 200 (58) 0.15
Chemotherapy
 Yes 221 (60) 93 (42) 128 (58)
 No 146 (40) 67 (46) 79 (54) 0.47
aP value <0.05 are statistically significant and are in bold.

Survival analysis

Kaplan–Meier survival curves of the follow-up data of available 375 patients to assess the association between the PARP1 rs1136410 SNPs and overall survival time (in months) of GBC patients did not show a significant difference. We performed additional survival analyses in subgroups of patients stratified by sex, age, TNM stage, jaundice and chemotherapy. Clinical parameters of GBC and PARP1 rs1136410 polymorphism were analyzed by Cox-regression model (Table 5). We found that risk genotypes AG+GG of PARP1 rs1136410 (A/G) are associated with decreased overall survival in patients with jaundice compared to nonrisk AA genotype (HR: 1.44; 95% CI, 1.01–2.063; P = 0.043) (Fig. 1).

Table 5 - Multivariate Cox-regression analysis of PARP1 polymorphism and clinical parameters of the gallbladder cancer patients with overall survival
Factors B SE Wald P value HR (95% CI)
Jaundice 0.368 0.182 4.1 0.043 1.44 (1.011–2.063)
TNM Stages
Early 0.16 0.264 0.377 0.539 1.2 (0.701–1.97)
Late 0.005 0.126 0.001 0.970 1.0 (0.078–1.29)
Lymph node involvement 0.117 0.139 0.716 0.39 1.125 (0.857–1.48)
Chemotherapy 0.003 0.157 0.000 0.987 1.0 (0.738–1.36)
P values >0.05 are statistically significant.
B, partial regression coefficient; CI, confidence interval; HR: hazard ratio.

F1
Fig. 1:
Kaplan–Meier plot of overall survival curves according to PARP1 rs1136410 A>G genotype with jaundice in gallbladder cancer patients.

Discussion

PARP1 rs1136410 significantly contributes to lowering the PARP1 catalytic activity by 30–40% which reduces BER ability to repair DNA damage increasing the cancer risk (Wang et al., 2007). The frequency of PARP1 rs1136410 SNPs varies among different populations (Anil et al., 2016). Many previous studies suggest that PARP1 may be involved in cancer development and progression. To the best of our knowledge, we first investigated the association of PARP1 rs1136410 polymorphism with susceptibility and prognosis of gallbladder cancer in the Indian population. We also evaluated the association of PARP1 rs1136410 with different clinical parameters. Our results demonstrate that the PARP1 rs1136410 (A>G) genotype polymorphism significantly contributes to the GBC susceptibility. Our data demonstrate that the PARP1 rs1136410 has a higher frequency of heterozygous and homozygous mutants in GBC patients than controls. Our results are concordant to the study by Santonocito et al., (2012), showing a higher frequency of heterozygous (AG) and homozygous (GG) mutants in melanoma patients than controls. We demonstrated that genotype GG and risk allele G are significantly associated with increased risk of GBC. Many genetic studies have found association between PARP1 rs1136410 and increased risk of several cancers including breast (Figueroa et al., 2007; Alanazi et al., 2013), thyroid (Bashir et al., 2018), lung (Zhang et al., 2005), cervical (Ye et al., 2012; Roszak et al., 2013), gastric (Zhang et al., 2009; He et al., 2012), esophagus (Hao et al., 2004), urinary bladder (Figueroa et al., 2007), oral squamous cell carcinoma (Anil et al., 2016) and prostate (Lockett et al., 2004) cancers. Conversely, studies have also demonstrated the variant G allele of PARP1 rs1136410 to be a protective allele and significantly associated with reduced risk of many types of cancers including breast cancer (Smith et al., 2008), squamous cell carcinoma of the head and neck (Li et al., 2007), glioblastoma (McKean-Cowdin et al., 2009), bladder cancer (Huang et al., 2007), acoustic neuroma (Rajaraman et al., 2010) and glioma (Hua et al., 2014). A meta-analysis has reported that the variant G allele of PARP1 rs1136410 is significantly associated with increased risk of cancers in Asia and decreased risk of cancer especially glioma in the Caucasian population. Our study demonstrates that PARP1 rs1136410 follows both dominant and recessive models, while Yu et al. (2012) reported that PARP1 rs1136410 follows only dominant models in the Asian population.

Age and sex both are risk factors for GBC but sex is more predominant because women have a higher risk of GBC than males in the north Indian population (Gupta et al., 2012). Interestingly, we observed that early age of onset and women patients having genotype GG have increased risk of gallbladder cancer. However, studies in breast cancer (Alanazi et al., 2013) and bladder cancer (Figueroa et al., 2007) have reported that the GG genotype of PARP1 rs1136410 is significantly associated with older age groups. Kim et al. (2011) reported that there is a significant association between PARP1 rs1136410 and lymph node involvement in gastric cancer. Similarly, in the present study, our results demonstrate a significant association between PARP1 rs1136410 and lymph node involvement in gallbladder cancer patients. However, a significant association was not found between genotypes of PARP1 rs1136410 and lymph node involvement in cervical cancer patients (Roszak et al., 2013; Nogueira et al., 2017).

The PARP1 rs1136410 GG genotype has been shown to be associated with longer overall survival in glioma (Deng et al., 2019). While PARP1 rs1136410 G carrier genotypes are associated with shorter overall survival in cervical cancer (Nogueira et al., 2017), we did not find a significant association with overall survival. Our study demonstrates that G carrier genotypes significantly decrease the overall survival in patients with jaundice. GBC patients with jaundice have shorter survival rates than patients not presenting jaundice (Yang et al., 2014). Several studies have reported that the presence of jaundice in GBC patients is significantly associated with advanced disease and shorter overall survival (Tran et al., 2017,Dasari et al., 2018). Recent GWAS studies and large-scale meta-analyses have identified association of several critical genes (Joshi et al. 2016; Mhatre et al., 2017; Bustos et al., 2019; Ferkingstad et al., 2018; Gellert-Kristensen et al., 2019) in gallbladder cancer and gallstone in different populations. However, none of these studies have shown association of PARP1 polymorphism in their studies.

Our results suggest that the minor allele G and GG genotype of PARP1 rs1136410 increase the risk of gallbladder cancer. We hypothesize that minor allele G allele of PARP1 rs1136410 may attenuate the DNA repair capacity of single or double-strand breaks following DNA damage and thus increased genomic instability may contribute to cancer susceptibility. Prognostic factors such as jaundice affect the prognosis of GBC patients.

Acknowledgements

DST-PURSE, Banaras Hindu University and UGC-UPE Banaras Hindu University for financial assistance to G.N., S.S.; Council for Scientific & Industrial Research, Government of India for Junior Research Fellowship to K.A.

Conflicts of interest

There are no conflicts of interest.

References

Alanazi M, Pathan AA, Abduljaleel Z, Arifeen Z, Shaik JP, Alabdulkarim HA, et al. (2013). Association between PARP-1 V762A polymorphism and breast cancer susceptibility in Saudi population. PLoS One 8:e85541.
Aloia TA, Járufe N, Javle M, Maithel SK, Roa JC, Adsay V, et al. (2015). Gallbladder cancer: expert consensus statement. HPB (Oxford) 17:681–690.
Anil S, Gopikrishnan PB, Basheer AB, Vidyullatha BG, Alogaibi YA, Chalisserry EP, et al. (2016). Association of poly (ADP-ribose) polymerase 1 variants with oral squamous cell carcinoma susceptibility in a South Indian population. Asian Pac J Cancer Prev 17:4107–4111.
Azarm K, Smith S (2020). Nuclear PARPs and genome integrity. Genes Dev 34:285–301.
Bashir K, Sarwar R, Saeed S, Mahjabeen I, Kayani MA (2018). Interaction among susceptibility genotypes of PARP1 SNPs in thyroid carcinoma. PLoS One 13:e0199007.
Bustos BI, Pérez-Palma E, Buch S, Azócar L, Riveras E, Ugarte GD, et al. (2019). Variants in ABCG8 and TRAF3 genes confer risk for gallstone disease in admixed Latinos with Mapuche Native American ancestry. Sci Rep 9:772.
Cheng J, Zhuo Z, Zhao P, Zhu J, Xin Y, Zhang J, et al. (2019). PARP1 gene polymorphisms and neuroblastoma susceptibility in Chinese children. J Cancer 10:4159–4164.
Dantas RN, Souza AM, Herrero S. S. T., Kassab P, Malheiros CA, Lima EM (2020). Association between PSCA, TNF-α, PARP1 and TP53 gene polymorphisms and gastric cancer susceptibility in the Brazilian population. Asian Pac J Cancer Prev 21:43–48.
Dasari B. V. M., Ionescu MI, Pawlik TM, Hodson J, Sutcliffe RP, Roberts KJ, et al. (2018). Outcomes of surgical resection of gallbladder cancer in patients presenting with jaundice: a systematic review and meta-analysis. J Surg Oncol 118:477–485.
Deng Y, Zhou L, Li N, Wang M, Yao L, Dong S, et al. (2019). Impact of four lncRNA polymorphisms (rs2151280, rs7763881, rs1136410, and rs3787016) on glioma risk and prognosis: a case-control study. Mol Carcinog 58:2218–2229.
Dutta U, Bush N, Kalsi D, Popli P, Kapoor VK (2019). Epidemiology of gallbladder cancer in India. Chin Clin Oncol 8:33.
Feng X, Koh DW (2013). Roles of poly(ADP-ribose) glycohydrolase in DNA damage and apoptosis. Int Rev Cell Mol Biol 304:227–281.
Ferkingstad E, Oddsson A, Gretarsdottir S, Benonisdottir S, Thorleifsson G, Deaton AM, et al. (2018). Genome-wide association meta-analysis yields 20 loci associated with gallstone disease. Nat Commun 9:5101.
Figueroa JD, Malats N, Real FX, Silverman D, Kogevinas M, Chanock S, et al. (2007). Genetic variation in the base excision repair pathway and bladder cancer risk. Hum Genet 121:233–242.
García P, Manterola C, Araya JC, Villaseca M, Guzmán P, Sanhueza A, et al. (2009). Promoter methylation profile in preneoplastic and neoplastic gallbladder lesions. Mol Carcinog 48:79–89.
Gellert-Kristensen H, Dalila N, Fallgaard Nielsen S, Grønne Nordestgaard B, Tybjaerg-Hansen A, Stender S (2019). Identification and replication of six loci associated with gallstone disease. Hepatology 70:597–609.
Gonzalez-Flores A, Aguilar-Quesada R, Siles E, Pozo S, Rodríguez-Lara MI, López-Jiménez L, et al. (2014). Interaction between PARP-1 and HIF-2α in the hypoxic response. Oncogene 33:891–898.
Gupta P, Agarwal A, Gupta V, Singh PK, Pantola C, Amit S (2012). Expression and clinicopathological significance of estrogen and progesterone receptors in gallbladder cancer. Gastrointest Cancer Res 5:41–47.
Hao B, Wang H, Zhou K, Li Y, Chen X, Zhou G, et al. (2004). Identification of genetic variants in base excision repair pathway and their associations with risk of esophageal squamous cell carcinoma. Cancer Res 64:4378–4384.
Hawkins WG, DeMatteo RP, Jarnagin WR, Ben-Porat L, Blumgart LH, Fong Y (2004). Jaundice predicts advanced disease and early mortality in patients with gallbladder cancer. Ann Surg Oncol 11:310–315.
He W, Liu T, Shan Y, Zhu K, Li Y (2012). PARP1 polymorphisms increase the risk of gastric cancer in a Chinese population. Mol Diagn Ther 16:35–42.
Hua RX, Li HP, Liang YB, Zhu JH, Zhang B, Ye S, et al. (2014). Association between the PARP1 Val762Ala polymorphism and cancer risk: evidence from 43 studies. PLoS One 9:e87057.
Huang M, Dinney CP, Lin X, Lin J, Grossman HB, Wu X (2007). High-order interactions among genetic variants in DNA base excision repair pathway genes and smoking in bladder cancer susceptibility. Cancer Epidemiol Biomarkers Prev 16:84–91.
Ide H, Kotera M (2004). Human DNA glycosylases involved in the repair of oxidatively damaged DNA. Biol Pharm Bull 27:480–485.
Joshi AD, Andersson C, Buch S, Stender S, Noordam R, Weng LC, et al. (2016). Four susceptibility loci for gallstone disease identified in a meta-analysis of genome-wide association studies. Gastroenterology 151:351–363.e28.
Kim J, Pyun JA, Cho SW, Lee K, Kwack K (2011). Lymph node metastasis of gastric cancer is associated with the interaction between poly (ADP-ribose) polymerase 1 and matrix metallopeptidase 2. DNA Cell Biol 30:1011–1017.
Li C, Hu Z, Lu J, Liu Z, Wang LE, El-Naggar AK, et al. (2007). Genetic polymorphisms in DNA base-excision repair genes ADPRT, XRCC1, and APE1 and the risk of squamous cell carcinoma of the head and neck. Cancer 110:867–875.
Lockett KL, Hall MC, Xu J, Zheng SL, Berwick M, Chuang SC, et al. (2004). The ADPRT V762A genetic variant contributes to prostate cancer susceptibility and deficient enzyme function. Cancer Res 64:6344–6348.
McKean-Cowdin R, Barnholtz-Sloan J, Inskip PD, Ruder AM, Butler M, Rajaraman P, et al. (2009). Associations between polymorphisms in DNA repair genes and glioblastoma. Cancer Epidemiol Biomarkers Prev 18:1118–1126.
Mhatre S, Wang Z, Nagrani R, Badwe R, Chiplunkar S, Mittal B, et al. (2017). Common genetic variation and risk of gallbladder cancer in India: a case-control genome-wide association study. Lancet Oncol 18:535–544.
Misra S, Chaturvedi A, Misra NC, Sharma ID (2003). Carcinoma of the gallbladder. Lancet Oncol 4:167–176.
Nemunaitis JM, Brown-Glabeman U, Soares H, Belmonte J, Liem B, Nir I, et al. (2018). Gallbladder cancer: review of a rare orphan gastrointestinal cancer with a focus on populations of New Mexico. BMC Cancer 18:665.
Nogueira A, Assis J, Faustino I, Pereira D, Catarino R, Medeiros R (2017). Base excision repair pathway: PARP1 genotypes as modulators of therapy response in cervical cancer patients. Biomarkers 22:70–76.
Rajaraman P, Hutchinson A, Wichner S, Black PM, Fine HA, Loeffler JS, et al. (2010). DNA repair gene polymorphisms and risk of adult meningioma, glioma, and acoustic neuroma. Neuro Oncol 12:37–48.
Roszak A, Lianeri M, Sowińska A, Jagodziński PP (2013). Involvement of PARP-1 Val762Ala polymorphism in the onset of cervical cancer in Caucasian women. Mol Diagn Ther 17:239–245.
Singh N, Kazim SN, Sultana R, Tiwari D, Borkotoky R, Kakati S, et al. (2019). Oxidative stress and deregulations in base excision repair pathway as contributors to gallbladder anomalies and carcinoma - a study involving North-East Indian population. Free Radic Res 53:473–485.
Smith TR, Levine EA, Freimanis RI, Akman SA, Allen GO, Hoang KN, et al. (2008). Polygenic model of DNA repair genetic polymorphisms in human breast cancer risk. Carcinogenesis 29:2132–2138.
Srivastava A, Srivastava K, Pandey SN, Choudhuri G, Mittal B (2009). Single-nucleotide polymorphisms of DNA repair genes OGG1 and XRCC1: association with gallbladder cancer in North Indian population. Ann Surg Oncol 16:1695–1703.
Santonocito C, Scapaticci M, Penitente R, Paradisi A, Capizzi R, Lanza-Silveri S, et al. (2012). Polymorphisms in base excision DNA repair genes and association with melanoma risk in a pilot study on Central-South Italian population. Clin Chim Acta 413:1519–1524.
Tong WM, Yang YG, Cao WH, Galendo D, Frappart L, Shen Y, Wang ZQ (2007). Poly(ADP-ribose) polymerase-1 plays a role in suppressing mammary tumourigenesis in mice. Oncogene 26:3857–3867.
Tran TB, Norton JA, Ethun CG, Pawlik TM, Buettner S, Schmidt C, et al. (2017). Gallbladder cancer presenting with jaundice: uniformly fatal or still potentially curable? J Gastrointest Surg 21:1245–1253.
Varma V, Gupta S, Soin AS, Nundy S (2009). Does the presence of jaundice and/or a lump in a patient with gall bladder cancer mean that the lesion is not resectable? Dig Surg 26:306–311.
Wang XG, Wang ZQ, Tong WM, Shen Y (2007). PARP1 Val762Ala polymorphism reduces enzymatic activity. Biochem Biophys Res Commun 354:122–126.
Wang X, Ma KW, Zhao YG, Wang GJ, Li W (2015). XRCC1 rs25487 polymorphism is associated with lung cancer risk in epidemiologically susceptible Chinese people. Genet Mol Res 14:15530–15538.
Wernberg JA, Lucarelli DD (2014). Gallbladder cancer. Surg Clin North Am 94:343–360.
Wood RD, Mitchell M, Sgouros J, Lindahl T (2001). Human DNA repair genes. Science 291:1284–1289.
Yang XW, Yuan JM, Chen JY, Yang J, Gao QG, Yan XZ, et al. (2014). The prognostic importance of jaundice in surgical resection with curative intent for gallbladder cancer. BMC Cancer 14:652.
Ye F, Cheng Q, Hu Y, Zhang J, Chen H (2012). PARP-1 Val762Ala polymorphism is associated with risk of cervical carcinoma. PLoS One 7:e37446.
Yu H, Ma H, Yin M, Wei Q (2012). Association between PARP-1 V762A polymorphism and cancer susceptibility: a meta-analysis. Genet Epidemiol 36:56–65.
Zhang Q, Li Y, Li X, Zhou W, Shi B, Chen H, Yuan W (2009). PARP-1 Val762Ala polymorphism, CagA+ H. pylori infection and risk for gastric cancer in Han Chinese population. Mol Biol Rep 36:1461–1467.
Zhang X, Miao X, Liang G, Hao B, Wang Y, Tan W, et al. (2005). Polymorphisms in DNA base excision repair genes ADPRT and XRCC1 and risk of lung cancer. Cancer Res 65:722–726.
Zhou D, Wang JD, Yang Y, Yu WL, Zhang YJ, Quan ZW (2016). Individualized nomogram improves diagnostic accuracy of stage I-II gallbladder cancer in chronic cholecystitis patients with gallbladder wall thickening. Hepatobiliary Pancreat Dis Int 15:180–188.
Keywords:

DNA repair gene; gallbladder cancer; jaundice; overall survival; PARP1 rs1136410; prognosis

Copyright © 2021 Wolters Kluwer Health, Inc. All rights reserved.