Methyl Guanine Methyl Transferase Methylation Status and Epidermal Growth Factor Receptor expression in a cohort of Egyptian glioblastoma patients

Abstract

Introduction 

Glioblastoma multiforme is the most frequently occurring primary brain tumour with a dismal prognosis. Chemotherapy with an alkylating agent such as Temozolomide (TMZ) confers a significant survival benefit. Genomic data elucidating pathogenetic mechanisms underlying gliomagenesis include epidermal growth factor receptor (EGFR) amplification/overexpression and methyl guanine methyl transferase promoter hypermethylation (MPH). Study of molecular changes paves the way to optimal personalized treatment.

Aim 

In this study we aimed to assess EGFR expression and MPH status in relation to the patients’ response to radio/TMZ-based chemotherapy.

Patients and materials 

Overall, 34 cases of glioblastoma multiforme were studied for immunohistochemical assessment of EGFR expression and for methylation-specific PCR assessment of MPH status. Statistical correlations assessed the relation to radiologic tumor response.

Results 

The mean±SD of the patients’ ages was 56.56±9.8 years. Of 34 cases, 20 were males and 18 showed EGFR overexpression in less than 50% of tumor cells. MPH was detected in 52.9% of cases and was significantly related to younger age (t=2.3, P=0.03) but not to EGFR overexpression (χ²=0.13, P=0.72). MPH was significantly related to tumor response (χ²=5.44, P=0.02).

Conclusion 

EGFR was largely expressed but was not related to response to TMZ-based treatment. MPH was expressed in 52.9% of cases with a significant correlation to treatment response. EGFR expression was not associated with MPH.

Introduction

Glioblastoma multiforme (GBM) is the most common and aggressive primary brain tumor, constituting 55% of all malignant brain tumors (^{Adamek et al., 2011; Karsy et al., 2012}) with an incidence of 2–3 cases in 100 000 people per year (^{Karsy et al., 2012}). The prognosis for patients with GBM is utterly dismal, with a median survival rate of 10–15 months (^{Huse and Holland, 2010; Adamek et al., 2011}) and a mortality rate approaching three-quarters of the cases within the first 18 months of tumor discovery. GBM is classified into primary and secondary subgroups according to clinical presentation (^{Ohgaki and Kleihues, 2007}). The primary group constitutes the majority of cases and develops rapidly ‘de novo’ in older patients following a short clinical history, with no evidence of a lower-grade astrocytoma as a precursor (^{Ohgaki and Kleihues, 2007}). Secondary GBM progresses from a lower-grade astrocytoma in younger patients (^{Ohgaki and Kleihues, 2007}). Both groups are histologically indistinguishable. However, they demonstrate exclusive genomic profiles implying different pathogenetic pathways (^{Crespo et al., 2015}), and hence may differ in their response to radiotherapy and chemotherapy (^{Crespo et al., 2015}).

Primary GBMs classically show genomic amplification of epidermal growth factor receptor (EGFR), phosphatase and tensin homolog (PTEN) mutations, and loss of chromosome 10, whereas secondary GBMs show TP53 and isocitrate dehydrogenase 1 (IDH1) mutations, in addition to loss of heterozygosity on 10q (^{Miller and Perry, 2007; Ohgaki and Kleihues, 2007}).

New in-depth genomic data have recently identified ‘molecular subtypes’ of GBM: classical, mesenchymal, proneural, and neural (^{Ohgaki and Kleihues, 2007}). Such classification shows potential repercussions on prognosis and therapeutic response exemplified in the vast majority of ‘classical/proliferative’ (^{Karsy et al., 2012}) GBMs demonstrating amplified EGFR, and ‘proneural’ tumors showing frequently mutated IDH1, especially in secondary GBMs (^{Ohgaki and Kleihues, 2007}). Furthermore, proneural GBMs have been shown to demonstrate improved survival over the proliferative or mesenchymal groups (^{Karsy et al., 2012}).

Such pattern of transcriptional grouping indicates that regardless of their genomic heterogeneity, GBMs of the same molecular subtype are basically driven by aberrations in the same signaling networks and therefore are potentially responsive to similar categories of targeted/personalized therapeutic agents (^{Huse and Holland, 2010; Jones and Holland, 2011}).

EGFR is the most commonly amplified and overexpressed gene in GBM (up to 100-fold in 40% of primary GBMs (^{Weller et al., 2009}) and its amplification is a prognostic marker (^{Huse and Holland, 2010}). The EGFR gene (at 7p12) encodes a 170 kDa protein that is a transmembrane receptor with intrinsic tyrosine kinase activity. In addition, GBMs with EGFR amplification have been reported to show EGFR mutations (∼40%) displaying several EGFR variants, the most common of which is the constitutively active variant III (EGFRvIII) (^{Ohgaki and Kleihues, 2007; Suri et al., 2009}). Introducing this receptor into glioma cells in vivo has been found to augment their tumorigenicity via increasing cell proliferation and suppressing apoptosis (^{Crespo et al., 2015}).

Apart from the well-known genomic alterations described in GBM, a constellation of epigenetic aberrations that enforce abnormalities in normal gene expression without changing the DNA sequence are now well known – for example, histone modifications, abnormal DNA methylation, chromatin remodeling, and altered noncoding RNA expression (e.g. miRNAs). So far, the best studied of these changes were DNA methylation abnormalities, including hypermethylation of CpG islands and gene-specific as well as genomewide hypomethylation (^{Crespo et al., 2015}). In GBM, the methyl guanine methyl transferase (MGMT) gene (chr 10q26) is frequently silenced by promoter hypermethylation (^{Crespo et al., 2015}).

Alkylating agents such as temozolomide (TMZ) constitute an important class of chemotherapeutic agents used in GBM treatment. Multiple known DNA alkylation sites constitute targets for cytotoxic agents. In this context, the O6-position of guanine is the most common site. Launching TMZ therapy binds an alkyl group to the O6-position of guanine, resulting in DNA mismatch and double-strand breaks culminating in tumor cell apoptosis (^{Crespo et al., 2015}). The normal MGMT protein abrogates the known lethal effect of TMZ by repairing DNA damage. In any given tumor, hypermethylating the MGMT promoter blocks gene transcription and protein expression, thereby enhancing the cytotoxic effects of TMZ or any alkylating agent (^{Crespo et al., 2015}).

Currently, MGMT promoter hypermethylation represents a potentially powerful prognosticator in GBM and offers an appropriate target for intervention to enhance the therapeutic efficacy of TMZ (^{Ohka et al., 2012}).

Inspite of a plethora of research articles, the therapeutic management of GBM is far from satisfactory and novel routes are continually sought (^{Adamek et al., 2011}). One suggested way to improve the treatment of GBM may be to administer alkylating agents while simultaneously targeting EGFR. Candidates for the suggested protocol should have hypermethylated MGMT promoter in conjunction with EGFR overexpression (^{Adamek et al., 2011}).

In the present work, immunohistochemical assessment of EGFR expression profile and MGMT promoter methylation status verification (by MS-PCR) were attempted in relevance to patients’ response to TMZ-based therapy.

Patients and materials

Thirty-four patients were included in the present retrospective study. They were operated upon for gross total resection of nonrecurrent GBM at the Neurosurgery Department, Alexandria Faculty of Medicine, from January to October 2014. All patients were reported to receive radiotherapy at 60 Gy in 30 fractions over 6 weeks. All patients received concomitant TMZ at 75 mg/m²/day for 42 days to be followed by an adjuvant course of TMZ. The latter was initiated in cycles of 5 days every 28 days. Dosing for the first adjuvant cycle was 150 mg/m² for 5 days with subsequent cycles of 2–6 days each at 200 mg/m²/day. Archival paraffin-embedded biopsy material was used for assessment of EGFR expression and MGMT promoter methylation status. Patients’ records in the Oncology Department, Alexandria Faculty of Medicine, were used to obtain follow-up data concerning response to treatment.

Methods

Immunostaining for Epidermal Growth Factor Receptor

Four microns thick sections were cut from archival GBM paraffin blocks. After deparafinization in xylene and rehydration in descending grades of alcohol, the sections were subjected to antigen retrieval by incubation with 0.1% (w/v) trypsin in 40 mmol/l CaCl₂/Tris-buffered saline (pH7.8) for 20 min at 37°C. Hydrogen peroxide 3% was then applied to block endogenous peroxidase activity. Next the primary antibody (monoclonal mouse antihuman EGFR (clone H11; Dako North America Inc., Carpinteria, California, USA)) at a dilution of 1 : 150 was applied overnight at 4°C. EnVision Detection Systems, Peroxidase/DAB, Rabbit/Mouse (Dako, Glostrup, Denmark, USA), was used for antigen visualization. The immunohistochemical reactions were developed with diaminobenzidine and sections were counterstained with hematoxylin. Immunostaining was manually processed, with appropriate positive controls (normal skin) and negative controls (antibody omission) included in each run (^{Lee et al., 2013}).

Cytoplasmic membranous staining in tumor cells was scored as positive/overexpressed. The immunohistochemical reaction for EGFR was graded as follows: 0, no cells stained; 1+, less than 50% tumor cells stained; 2+, 50% or more cells stained (^{Lee et al., 2013}).

Assessment of MGMT promoter methylation status

DNA extraction and bisulfite treatment: Genomic DNA was extracted from two 10-µm-thick sections of paraffin blocks (surface area up to 250 mm²) and bisulfate-converted using the EpiTect Fast FFPE Bisulfite Conversion Kit (Qiagen, Hilden, Germany).

Quantitative methylation-specific PCR (qMSP): MSP analyzed positions 118–137 and 174–195 with specific primers designed to distinguish methylated (Met-MGMT) from unmethylated DNA (Unmet-MGMT) (Bioneer Inc., Daejon, Korea). Regarding Unmet-MGMT, the following primer pair was used: F: TTTGTGTTTTGATGTTTGTAGGTTTTTGT; and R: AACTCCACACTCTTCCAAAAACAAAACA. As for Met-MGMT, the following primer pair was used: F: TTTCGACGTTCGTAGGTTTTCGC-3; and R: GCACTCTTCCGAAAACGAAACG (^{Esteller et al., 1999}). β-actin gene primers were used as an internal control.

The MSP reaction was performed using QuantiTect SYBR Green PCR Reagent (Qiagen) with ≈100 ng of bisulfite-treated DNA. Each sample was assayed in duplicate, one using the methylated primer pair and the other using the unmethylated primer pair. PCR was carried out using the One Step real-time PCR system (Applied Biosystems, California, USA) with the following amplification program: 15 min at 95°C, followed by 45 cycles of 94°C for 15 s, 60°C for 30 s, and 72°C for 30 s (^{Uno et al., 2011}).

To show the specificity of PCR and the efficacy of bisulfite conversion, universal unmethylated and universal polymethylated DNA (EpiTect Control DNASet; Qiagen) were included as controls in each set of reactions in addition to a negative control sample without DNA. Methylated and unmethylated MGMT promoter sequences were analyzed by comparing the melting curves of control DNAs.

MGMT gene methylation was calculated as ratio (M/U) for each specimen by comparing the C_T (threshold cycle) of methylated (M) MGMT with the C_T of unmethylated (U) MGMT. The receiver operator curve was used to determine the cutoff point of the M/U ratio with the greatest sensitivity and specificity in predicting responders and nonresponders to TMZ. The cutoff point was used to categorize response to treatment into responders and nonresponders based on the degree of hypermethylation – either low hypermethylation state or high hypermethylation state.

Tumor response to TMZ treatment was defined radiologically, where patients who recorded decreased or stable tumor size during/after conclusion of TMZ treatment were labeled ‘responders’ and those who died or demonstrated progressive increase in size while on/or after TMZ treatment were labeled ‘nonresponders’. Response data were obtained retrospectively from patient's archives by reviewing MRI (with gadolinium contrast) reports.

Results

The patients enrolled in the present study were aged between 27 and 70 years, with a mean of 56.56+9.8 years. Twenty (58.8%) patients were males and 14 (41.2%) were females.

After reviewing patients’ records all of the studied cases were considered clinically ‘primary glioblastomas’ based on rapid development with no antecedent history of previous lower-grade tumor.

All patients enrolled in the present study showed EGFR overexpression: 18 (52.9) cases showed EGFR overexpression in less than 50% of tumor cells (score 1) and 16 (47.1) cases showed EGFR in 50% or more of tumor cells (Figs. 1 and 2). EGFR overexpression showed no statistically significant relation with either age (t=0.31, P=0.76) or sex (t=0.97, P=0.32) of the patient.

Fig. 1: Low level (<50%) EGFR cytoplasmic expression in glioblastoma sections showing different staining intensities (anti-EGFR, a-b: ×400, c-d: ×200).

Fig. 2: High level (≥50%) EGFR cytoplasmic expression in glioblastoma sections showing different staining intensities (anti-EGFR, a-b: ×100, c–d: ×400).

Eighteen (52.9%) cases showed a degree of MGMT promoter methylation above the cutoff value, whereas 16 (47.1%) cases were below the cutoff threshold. Further, higher degree of MGMT promoter methylation was significantly related to younger age (t=2.3, P=0.03), but it was not statistically related to patients’ sex (χ²=2.84, P=0.09).

MGMT promoter methylation status was not statistically related to EGFR overexpression (χ²=0.13, P=0.72) (Fig. 3).

Fig. 3: MGMT promoter methylation status was not related to EGFR overexpression profile.

The receiver operating characteristics in Fig. 4 defines an area under the curve of 0.671 (P=0.02) through which it was possible to define a cutoff point at ratio more than 0.93 m with a sensitivity of 81.8% and specificity of 60.9%.

Fig. 4: Receiver operating characteristics (ROC) depicting the accuracy of MGMT methylation status in predicting response to treatment. Cutoff point at ratio >0.93, sensitivity=81.8, specificity=60.9. Area under the ROC curve=0.671, SE=0.071. 95% confidence interval=0.544– 0.781, P=0.02.

Twenty-three (67.6%) cases responded favorably to treatment, whereas 11 (32.4%) cases failed to respond.

EGFR overexpression showed no statistically significant correlation with patients’ response to treatment (χ²=2.56, P=0.11) (Table 1). Tumor response to treatment was significantly correlated with increasing degree of MGMT promoter methylation (χ²=5.44, P=0.02) Table 2.

Table 1: Relation between EGFR overexpression and patients’ response to temozolomide-based therapy

Table 2: Relation between MGMT promoter methylation status and response to treatment

Discussion

All cases were clinically primary glioblastomas. Although the reported rate of EGFR gene amplification and/or mutation in primary GBMs is 36–60%, it is reported that all primary glioblastomas with EGFR amplification show EGFR overexpression and that conversely up to 90% of cases with EGFR overexpression have EGFR amplification (^{Crespo et al., 2015}). Working on the protein expression level, we were able to detect EGFR cytoplasmic expression in 100% of our cases.

In the work conducted by ^{Lee et al. (2013)}, EGFR immunolabeling scores were 0, 1+ (when<5% tumor cells stained), 2+ (when 5–50% cells stained), and 3+ (>50% cells stained). For statistical analysis, they considered scores 0 and 1 negative and both scores 2 and 3 as positive (^{Lee et al., 2013}). On the other hand, ^{Montgomery et al. (2015)} categorized their immune reactions into four groups: 1 (0–25%), 2 (26–50%), 3 (51–75%), and 4 (76–100%). Only one of their cases scored ‘1’, which merited lumping groups 1 and 2 together. Thus, to better stratify EGFR overexpression levels, we considered the 50% cutoff point to be a more practical option.

In the present work, there was no statistically significant correlation between EGFR expression and response to treatment. This notion was previously confirmed by others (^{Heimberger et al., 2005; Ohgaki and Kleihues, 2007; Hwang et al., 2009; Ruano et al., 2009}) and by work on gene amplification as well (^{Weller et al., 2009}), although others detected an association with shorter survival (^{Saito et al., 2006; Kapoor et al., 2007}) or even a better survival outcome (^{Weller et al., 2009}).

In fact, as is well known, EGFR – the most commonly overexpressed gene in GBM – has seven variants the most important of which is EGFRvIII. EGFRvIII shows genomic deletion of exons 2–7. This variant is constitutively active and contributes to tumor progression. The mutant EGFRvIII mutation is detected in 20–30% of GBM patients and is usually associated with EGFR amplification (^{Huse and Holland, 2010}). Even EGFRvIII mutation was not found to affect survival in TMZ-treated patients (^{Ohgaki and Kleihues, 2007; Huse and Holland, 2010}). However, in patients surviving 1 year or longer after diagnosis, the expression of EGFRvIII was considered an independent negative prognostic indicator (^{Heimberger et al., 2005}).

A spectrum of promising treatment modalities targeting EGFR or its mutant variant (EGFRvIII) are currently under development or have found their way to clinical trials, including tyrosine kinase inhibitors, monoclonal antibodies, vaccines, and small interfering RNA (^{Taylor et al., 2012}).

There was no statistically significant correlation between patients’ age and EGFR expression, which was reported previously (^{Shinojima et al., 2003}), although one group reported an age-dependent prognostic value of EGFR overexpression with a tendency for higher risk with advancing age (^{Srividya et al., 2010}).

O6-methylguanine methyl transferase is a DNA repair protein. Its function is to remove the alkyl group from the O6-guanine position to prevent DNA failure and cell death. MGMT promoter hypermethylation stops MGMT transcription. Theoretically, it renders DNA of tumor cells more sensitive to damage by alkylating agents (^{Adamek et al., 2011}).

MGMT-mediated resistance to alkylating agents is acknowledged as the pivotal factor underlying failure of postoperative adjuvant chemotherapy of GBM patients. Hence, the assessment of MGMT methylation status becomes of crucial clinical value in tailoring personalized treatment plans and predicting a patient’s prognosis (^{Wang et al., 2015}).

To date, there is no agreement over the best technique for assessment of MGMT promoter methylation status (^{Thon et al., 2013}). The currently practiced MSP emerges as the most appropriate (^{Thon et al., 2013}). However, immunohistochemical detection of MGMT methylation still lacks standardization, reproducibility, and correlation with outcome (^{Thon et al., 2013}).

In the current work, MGMT promoter methylation was detected in 52.9%, which is close to the figures recorded by other studies (55 and 47.5%, respectively) (^{Costa et al., 2010; Kim et al., 2012}). The relation between MGMT promoter hypermethylation and sex was statistically insignificant, as reported previously (^{Dunn et al., 2009}). However, we were able to establish a statistically significant relation between MGMT promoter hypermethylation and younger age. The latter finding comes in concert with the work by ^{Skiriute et al. (2012)}.

In the current study, the relation between MGMT promoter methylation status and patients’ response to TMZ-based therapy was statistically significant (P=0.02). This finding is in agreement with the results of most of the published work in this area (^{Ohka et al., 2012; Crespo et al., 2015}). Glioblastoma patients with hypermethylated MGMT promoter treated with TMZ and radiotherapy demonstrate a longer median survival of 15–21 months (^{Huse and Holland, 2010}) or in other words a median survival at 2 and 5 years of 49 and 14%, respectively, instead of with radiotherapy alone (median survival at 2 and 5 years of 24 and 5%, respectively) (^{Crespo et al., 2015}).

Inspite of being a truly promising prognostic marker, to date, MGMT testing has not become a part of the daily laboratory routine in most centers. The latter notion can be ascribed to the lack of standardization, sample heterogeneity, and lack of accurate recognition of particular MGMT promoter regions that can predict patients’ response to treatment (^{Crespo et al., 2015}).

In our series, no correlation was established between MGMT promoter methylation status and EGFR overexpression, which was reported previously (^{Michaelsen et al., 2013}). Relevant to this finding, ^{Montano et al. (2010)}reported that patients with simultaneous hypermethylated MGMT promoter and expression of EGFRvIII tended to demonstrate a trend toward better survival. However, no statistical significance was reached (P=0.0763).

In our study four (11.8%) cases demonstrated both MGMT promotor hypermethylation and high-level EGFR overexpression simultaneously. Such a cohort of patients can potentially benefit from combined therapy of TMZ with a member of the long list of agents targeting EGFR (^{Adamek et al., 2011}). Such a figure is comparable to the 19% obtained by ^{Adamek et al. (2011)}.

Tumor morphology and tumor cell responsiveness to variable therapeutic strategies are believed to be associated with specific molecular characters. To adjust the therapeutic plan to the individual molecular tumour phenotype is indeed the essence of personalized therapy in oncology.

Conclusion

EGFR is largely expressed in glioblastoma multiforme. However, it is not statistically related to response to TMZ-based treatment. On the other hand, MGMT promoter hypermethylation is expressed in nearly half of the studied GBM cases with a significant correlation to treatment response, thereby confirming its role as a promising biomarker for prediction of response to TMZ in GBM patients.

Conflicts of interest

There are no conflicts of interest.