Secondary Logo

Journal Logo

Original Research

Synadenium umbellatum and the Ehrlich's solid tumor treatment

Assessment of inflammatory regulators (transforming growth factor protein-β1 and tumor necrosis factor-α) gene expression, hepatotoxicity and myelotoxicity

da Silva, Emerson B.a; Chagas, Camila S.b; Fonseca, Alexandre L. A.a; Alves, Beatriz da C. A. PhDa; Bagatin, Izilda PhDb; Perazzo, Fábio F. PhDb; Rosa, Paulo PhDc; Feder, David MD, PhDa; Fonseca, Fernando Luiz A. PhDa,b,∗

Author Information
European Journal of Oncology Pharmacy: January-March 2019 - Volume 2 - Issue 1 - p e9
doi: 10.1097/OP9.0000000000000009
  • Open

Abstract

1 Introduction

In Brazil, due to a late diagnosis, neoplasms have high mortality rates.[1] In this country, from 2009 to 2013, about 65,695 deaths caused by breast cancer were recorded.[2] With the alarming increase of cases worldwide, including Brazil, extensive research has contributed to the improvement of oncologic treatment.[3] As Brazil has the biggest biodiversity in the world, some of these surveys are about food and plants with anticancer potential. Known in Brazil as Cola-Note plant, Synadenium umbellatum is a botanical species belonging to Geraniales order and Euphorbiaceae family, whose name is an allusion to the glands of concrescent cyathium. Synadenium species are known in some continents for its use as antiinflammatory, antitumor, and analgesic.[4] A milky latex with pH ±5.0 is obtained from the leaves or stalk from S umbellatum that in the Midwest is used empirically in fighting various diseases, including some cancers and the pain caused by this disease.

Studies report the antiinflammatory and antitumoral activity of several species of Euphorbiaceae family.[5] Phytochemical studies reveal the presence of diterpene and phorbol esters, immunoregulatory substances with pharmacological actions, and antitumoral activity.[6,7]

Currently, the central focus of surveys on S umbellatum is its action on Ehrlich tumor. This tumor, originally described by Ehrlich and Apollant in 1905 as a breast adenocarcinoma, has a spontaneous origin in mice. Moreover, this tumor has a high grade of aggressiveness and is easy to be transplated.[8] This tumor when inoculated with an intraperitoneal form develops in ascitic form; in other words, neoplastic cells grow in the peritoneal fluid, and when they are inoculated into the subcutaneous part, it develops as a solid tumor.[5,9]

The histological aspect of Ehrlich solid tumor is characterized by a tumor hidden by a pseudocapsule and composed of pleomorphic cells with abundant cytoplasm that may have vacuoles.[10] In addition, large multinucleated cells and mitosis appear with some frequency in this tumor, presenting extensive necrotic area arising from the death of neoplasmic cells.[11]

This study aimed to evaluate the effects of macerated S umbellatum in the concentration of 10 mg/kg in Bagg albino strain c (BALB/c) mice inoculated with solid tumor Ehrlich and to compared expression of inflammatory markers (TGF-β1 and TNF-α) and to verify if the macerated had myelotoxic, hepatotoxic, and antitumor activities.

2 Methods

2.1 Botanical materials and the preparation of macerated

S umbellatum samples for this study were collected from a household farming belonging to the city of São Bernardo do Campo, in São Paulo, Brazil. The leaves of S umbellatum were desiccated in an air circulation stove for 48 h at 40 °C. Then, the leaves were crushed in a slicer to obtain fine powder, which was suspended in physiological solution of 9% at a concentration of 10 mg/kg.

2.2 Animals

In this study, 8 male mice of the albino BALB/c mice were used. Animals showed an average weight of 30 ± 5 g and were kept in the vivarium of the Faculdade de Medicina do ABC (FMABC) at room temperature and photoperiodic cycle of 12 h light/dark; they were fed with natural water and Nuvilab CR-1 ration (Nuvital) ad libitum. All procedures were performed in accordance with the Care Guide and Use of Laboratory Animals and approved by the Ethics Committee on Animal Experiments of the FMABC in 2013 (Protocol no. 04/2013).

2.3 Experimental design

To obtain the solid tumor, ascitic Ehrlich tumor cells taken from BALB/c mice were diluted in 0.9% NaCl (2 × 106 cells/mL) solution and aliquoted. Cell viability was verified by Trypan blue exclusion test.

Cell suspensions were inoculated into the dorsal-lateral area of the animals. On the 7th day after inoculation, the animals were divided randomly into 2 groups: control group, to which physiological solution of 0.9% was administered by gavage, and the treatment group, to which the macerated S umbellatum at a concentration of 10 mg/kg by gavage was administered. At the 28th day of drug administration, the animals were anesthetized with ketamine (100 mg/kg/ip) and xylazine (10 mg/kg/ip).[12] A laparotomy was performed to puncture the abdominal aorta to remove blood tissue; after dissection performed through a longitudinal incision in the dorsolateral region of the animal, tumor was kept in liquid nitrogen. At the end of the procedure, the animals were euthanized in a carbon dioxide chamber.

2.4 Molecular analysis

The expression of transforming growth factor gene (TGF-β1) and tumor necrosis factor (TNF-α) was determined by real-time quantitative polymerase chain reaction quantitative in duplicate using Sybr Green Master Mix (Invitrogen). Glyceraldehyde-3-phosphate dehydrogenase gene was used as internal control. The reaction was performed with 20 ng of cDNA in a 20-μL reaction containing 1× Sybr Green (Invitrogen), 0.25 μM of each primer (TGF-β1: forward – CCCCACTGATACGCCTGAGT and reverse – AGCCCTGTATTCCGTCTCCTT; TNF-α: forward – ATGAGCACAGAAAGCATGATC and reverse – TACAGGCTTGTCACTCGAATT; glyceraldehyde-3-phosphate dehydrogenase gene: forward – GACCACAGTCCATGCCATCA and reverse – CAGCTCAGGGATGACCTTGC). The amplification reaction was performed in an Applied Biosystems 7500 real-time polymerase chain reaction systems thermocycler, with an initial incubation 95 °C for 2 min, followed by 40 cycles for 15 s at 95 °C, 60 s at 60 °C, and 15 s at 72 °C. The relative gene expression was determined by ΔΔCt method. The results were submitted to 1-way analysis of variance (ANOVA) using GraphPad PRISM software and P < 0.05 was the significance value.

2.5 Biochemical and hematological analysis

Liver enzymes were analyzed by the enzymatic colorimetric method, the Flexor EL200 using the Wiener Lab kits for the determination of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in serum, following the best practices in clinical analysis. The hematological evaluation was performed by flow cytometry (ABX Pentra DF120), following the best practices in clinical analysis. Results were submitted to 1-way ANOVA using GraphPad PRISM software and P < 0.05 was the significance value.

3 Results

3.1 Analysis of hepatotoxicity and myotoxicity

The assessment of AST and ALT showed no statistical significant difference between treatment and control groups.

Blood white and red series evaluation showed a significant difference (P = 0.0387) in erythrocyte count (millions/mm3), in hemoglobin determination (g/dL), and in platelets counts (103/mm3), which were lower in treatment group than in control group. These results suggest that S umbellatum should cause a slight hemolysis.

The total and differential white cell count showed a significant difference between the groups: the treatment 1 showed myotoxicity observed by the reduction in the number of total leukocytes, neutrophils, monocytes, and lymphocytes when compared with the control group, as shown in Figure 1 and Table 1.

Figure 1
Figure 1:
Total count of leukocytes, neutrophils, monocytes, and lymphocytes of treatment and control groups (P < 0.05).
Table 1
Table 1:
Hematological parameters of control and the treated group Cola-nota (10 mg/kg).

3.2 Body mass and animals’ survival

A significant variance was observed in the assessment between initial and final body weights of mice (P = 0.0736). This result suggests that S umbellatum assists in body weight gain of the animal, reducing cachexia caused by cancer. It was also observed that animals belonging to treatment group were more willing and with normal pelage when compared with the treatment group that showed a less active behavior and bristling pelage. Considering survival of animals, the experiment showed no variance in the animal life between the groups.

3.3 Tumor size and weight

An absence of a significant difference between tumor size from the 2 groups (P = 0.0521) indicates that the macerated showed no antitumor action; this lack of antitumor action can also be observed in the evaluation of initial and final sizes of the tumors (P = 0.0431) measured with a caliper on the animal's skin.

3.4 Gene expression analysis

The mice belonging to the treatment group showed a significant decrease (P < 0.05) in the expression of TNF-α protein. This expression decrease could explain the increase in animal weight, as this mediator is responsible for initiating and perpetuating the neoplastic cachexia. There was a significant increase in the expression of TGF-β1 as shown in Figure 2; result that can be related to the decreased lymphocytes rates, which can be considered an explanation to the lack of S umbellatum antitumor action.

Figure 2
Figure 2:
Evaluation of the expression of TNF-β1 and TNF-α by ΔΔCt method (n = 8, P < 0.05).

4 Discussion

The results suggest that treatment with Cola-Note macerate causes a decrease in expression of TNF-α. This gene expression reduction should certainly be related to body mass gain in the treatment group animals. On the other hand, the control group animals showed a loss of muscle mass and adipose tissue because of neoplastic cachexia, as well as changes in the animal's behavior, which became hypoactive throughout the experiment. These results indicate that treated animals – which showed a decreased TGF-β1 expression – were less subject to neoplastic cachexia, which is perpetuated and initiated by cytokines via TNF-α. These cytokines are produced in neoplastic tissue, inducing individuals to anorexia by reducing lipoprotein lipase.[13] In fact, several experimental studies have shown that TNF-α administration led laboratory animals to anorexia and depletion of fat and muscle tissues.[14]

Results also showed an increased expression of TGF-β1, pointing to a probable connection with the advanced stage of carcinogenesis and the absence of survival variation of the 2 groups.[15,16] Studies have linked the increased TGF-β1 expression with malfunctioning of inhibitory[17] response to cellular proliferation and may represent an escape mechanism to the tumor cells favoring the evolution of the neoplastic process.[14]

This effect would be opposite if there was no decrease in lymphocytes because of the myelotoxicity of the macerated in mice, as studies show that transforming growth factor has an inhibitory cytokine role in regulating the immune response of complex shape, exerting an suppressive role on tumor cells by forkhead box P3 expression, a transcription factor gene with specific regulatory function, suppressing or enhancing the transcription of specific genes through the regulatory T cells,[18] which act in malignant neoplasms harming the autoimmune activity of tumor cells by a deficient stimulation in T cell, thus changing the cytotoxicity of natural killer cells against tumor antigens.[19,20] As there was a lymphopenia in mice, this activity was stopped by inhibiting the antitumor action of TGF-β1.

The here-verified absence of hepatotoxicity of the analyzed macerate concentrations leads us to test further doses to achieve the therapeutic one. Glimpsing to perform a better reproduction of administration route commonly used by the population that makes use of the macerated, we choose the method of gavage. Positive results are considered to be those that increase survival, reduce tumor growth, and decrease the number of leukocytes in the blood.[21–23] However, the results of this study show that the macerated has not been able to reduce the Ehrlich tumor nor alter animals’ survival, as previously discussed.

Other data verified in this study were that the tumor when inoculated on the side of the back extends the life of animals. In a pilot study, we observed that when the tumor was inoculated in the central part of the back of the mice, an increase of tumor mass was noticed; moreover, it rapidly invades the spine in a few days causing animals’ paralysis of the lower limbs, leading to death.

Therefore, our results suggest that macerated S umbellatum caused no liver toxicity but presented a myelotoxic potential. The study also showed a treatment relation to the reduction of neoplastic cachexia; however, an antitumor activity was not observed, opening up prospects for further research with a larger number of animals per group and further doses and macerated concentrations.

5 Authors contribution

EBS: conception and design, acquisition and analysis of data, drafting the work and approval of final version to be published; CSC: interpretation of data for the work and approval of final version to be published; ALAF: revised the work and approved its final version; BCAA: conception and design and approval of final version; IB: acquisition, analysis and interpretation of data and approval of final version; FFP: drafting the work and revising it critically for important intellectual content and approval of final version; PR: drafting the work and revising it critically for important intellectual content and approval of final version; DF: conception and design and approval of final version; FLAF: conception and design, drafting the work or revising it critically for important intellectual content and approval of its final version. All authors gave agreement to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Acknowledgements

There are no conflicts of interest.

References

1. Barros MA, Giordana AM. Ayoub AC, Fontes AL, Silva MA, et al. Radioterapia. Planejando o cuidar na enfermagem oncológica São Paulo: Lemar; 2000; 187–199. [Portuguese].
2. Ferreira RC, Oliveira CS, Anjos CJ. Neoplasias malignas da mama no Brasil e suas variações espaço-temporal no período de 2009 à 2013. Anais do I Congresso Norte e Nordeste da Sociedade Brasileira de Cirurgia Oncológica. 2014; Blucher, São Paulo: [Portuguese].
3. Lapa AJ, Souccar C, Lima-Landman MT, et al. Métodos de avaliação da atividade farmacológica de plantas medicinais (Lagoa, Ed.), Porto Alegre, 118 p., 2003.
4. Ortêncio WB. Medicina popular do Centro-Oeste. Second ed.1997; Thesaurus, Brasília: 33–40. [Portuguese].
5. Silva AE, Santos FG, Cassali GD. Cell proliferation markers for evaluating the growth of solid and ascitic forms of Ehrlich tumor. Arq Bras Med Vet Zootec 2004; 58:658–661.
6. Valadares MC, Castro NC, Cunha LC. Synadenium umbellatum: citotoxicidade e danos ao DNA de células da medula óssea de camundongos. Rev Bras Cienc Farm 2007; 43:631–638. [Portuguese].
7. Melo-Reis PR, Andrade LS, Silva CB, et al. Angiogenic activity of Synadenium umbellatum Pax latex. Braz J Biol 2010; 7:189–194.
8. Mota MF, Benfica PL, Batista AC, et al. Investigation of Ehrlich ascites tumor cell death mechanisms induced by Synadenium umbellatum Pax. Ethnopharmacology 2012; 139:319–329.
9. Freitas ES, Leite ED, Silva AE, et al. Effect of thyroxine and propylthiouracil in Ehrlich ascitic tumor cells. Int J Morphol 2006; 24:665–671.
10. Abdel-Rahman MN, Kabel AM. Comparative study between the effect of methotrexate and valproic acid on solid Ehrlich tumour. Egypt Natl Canc Inst 2012; 24:161–167.
11. Oloris SS, Dagli ML, Guerra JL. Effect of b-caroteno on development of the solid Ehrlich tumor in mice. Life Sci 2002; 71:717–724.
12. Garber CJ, Bielitzki JT, Denovan JC. Guide for the care and use of laboratory animals of care laboratory animal anesthesia. 1996; Academic Press, New York: 79-87.
13. Tisdale MJ. Biology of cachexi. J Nat Cancer Inst 1997; 23:3–89.
14. Oliff A, Defeojones D, Boyer M, et al. Tumors secreting human TNF/cachectin induce cachexia in mice. Cell 1987; 50:555–563.
15. Gold LI, Saxena B, Zagzag D, et al. Increased expression of TGF-β isoforms by malignant gliomas. Cell Biol 1992; 16B:122.
16. Hsu S, Huang F, Hafez M, et al. Colon carcinoma cells which their response to transforming growth factor-β1 with tumor progression. Cell Growth Differ 1994; 5:267–275.
17. Jennings MT, Maciunas RJ, Carver R. TGF-β1 and TGF-β2 are potential growth regulators for low-grade and malignant gliomas in vitro: evidence in support of an autocrine hypothesis. Int J Cancer 1991; 49:129–139.
18. Sojka DK, Huang YH, Fowell DJ. Mechanisms of regulatory T cell suppression – a diverse arsenal for a moving target. Immunology 2008; 124:13–22.
19. Abbas AK, Lichtman AH. Cytokines. Cellular and molecular immunology. Seventh ed.2005; Saunders, Philadelphia, PA: 225–243.
20. Taams LS, Palmer DB, Akbar AN, et al. Regulatory T cells in human disease and their potential for therapeutic manipulation. Immunology 2006; 118:1–9.
21. Rajesh R, Nataraju A, Gowda CD, et al. Purification and characterization of 34-kDa, heat stable glycoprotein from Synadenium grantii latex: action on human fibrinogen and fibrina clot. Biochimie 2006; 88:1313–1322.
22. Gupta M, Mazumder UK, Kumar RS, et al. Antitumor activity and antioxidant status of Caesalpnia bonducella against Ehrlich ascistes carcinoma in Swiss albino mice. J Pharmacol Sci 1994; 4:177–184.
23. Valadares MC, Carrucha SG, Accorsi W, et al. Euphorbia tirucalli L. modulates myelopoiesis and enhances the resistance of tumor-bearing mice. Int Immunopharmacol 2006; 6:294–299.
Keywords:

antineoplastic; cell regulatory factors; hepatotoxicity; myotoxicity; phytotherapy; Synadenium umbellatum

Copyright © 2019 the Author(s). Published by Wolters Kluwer Health, Inc.