Meesmann corneal dystrophy (MECD) is a rare disorder involving the corneal epithelium, characterized by the presence of numerous small, round intraepithelial microcysts diffusely distributed in the interpalpebral zone and extending to the limbus.1 2 KRT3 (MECD2, OMIM #618767) and KRT12 (MECD1, OMIM #122100), respectively] and is inherited as an autosomal dominant trait with variable expression.2–4 KRT3 encodes for the type II intermediate filament, and its alteration is expected to negatively affect the K3/K12 heterodimer complex, causing an abnormal fragility of epithelial cells. To date, a total of 4 different disease-causing mutations have been identified in KRT3 , all of them associated with MECD.5
On the other hand, lattice corneal dystrophy (LCD) is an inherited form of linear stromal amyloidosis, characterized by thin branching refractile lines and/or subepithelial, whitish, ovoid dots that usually appear by the end of the first decade.1 TGFBI ) and gelsolin (GSN ) genes.1,5
Herein, we present the clinical and molecular study of a Spanish patient carrying a novel KRT3 mutation with coexistent familial MECD and a pseudo-unilateral LCD, as the first reported case with this combined corneal phenotype.
MATERIAL AND METHODS
The patient was identified on consultation at the Institut de Microcirurgia Ocular (IMO) (Barcelona, Spain). Clinical diagnosis was established based on standard ophthalmic evaluations, including best-corrected visual acuity and corneal examination performed with a BX 900 slit-lamp (Haag-Streit, Köniz, Switzerland). Total serum protein, serum protein profile, and immunoelectrophoresis were also performed by an accredited external laboratory (Laboratorio Echevarne, Spain). Molecular analysis was performed by whole-exome sequencing on the patient's DNA, obtained from a peripheral blood sample. Libraries were designed and constructed using the SureSelect V6 technology (Agilent), and generated amplicons were genotyped with the HiSeq 4000 (Illumina). The obtained FASTQ raw data files were analyzed using the GeneSystems online platform (Sistemas Genómicos, Paterna, Spain), aligning sequences against the reference genome GRCh38/hg38. A total of 4 different genes (GSN , KRT3 , KRT12 , and TGFBI ), previously related to the MECD or LCD phenotypes (PubMed databases), were considered for the genetic analysis. The detected variants were filtered based on the deleterious potential and the minor allele frequency (≤0.0001) from the following open databases: 1000 Genomes, ExAC, GO ESP, TOPMed, and EVS. The pathogenicity of the substitutions was evaluated using several in silico predictors (SIFT, PolyPhen2, LRT, Mutation Taster, Mutation Assessor, FATHMM, MetaSVM, LoFtool, Fathmm-MKL, PROVEAN, M-CAP, Condel, PhastCons, and PhyloP). All the obtained variants were further confirmed by Sanger sequencing. For the cosegregation analysis, Sanger sequencing was also performed on the DNA from the patient's father, collected from a saliva sample, using primers located in the KRT3 exon 7 (NM_057088.2) (GAGGAATGTTCCCTGACTTTAAG and TGGGCACTGGTTGCATACGTGC). All procedures were in accordance with the Declaration of Helsinki. Ethics approval was received from the IMO Ethics Committee. Informed consent for publication was obtained.
RESULTS
A 57-year-old woman of Spanish origin attended to IMO with painful irritation and gradual loss of visual acuity in both eyes (OU). The patient's ocular history was significant for photophobia since childhood and recurrent corneal erosions over 17 years. The best-corrected visual acuity was 20/400 in the right eye (OD) and 20/30 in the left eye (OS). Slit-lamp examination revealed multiple central tiny cysts in the epithelium of both eyes and lattice lesions only in the right cornea, consisting on linear fine branching opacities in the anterior corneal stroma. The OD also presented subepithelial and anterior stromal fibrosis located in the inferior part of the cornea. A corneal posterior crocodile shagreen degeneration in the OU could also be observed. These findings were compatible with a MECD and a unilateral LCD (Fig. 1A ). Total serum protein, serum protein profile, and immunoelectrophoresis were performed to discard clinically silent paraproteinemia or other hematologic dyscrasias.6 https://links.lww.com/ICO/B140 Fig. 1B ).
FIGURE 1.: A, Slit-lamp retroillumination images obtained from the right and the left eye (OD and OS, respectively) of the patient show multiple tiny epithelial microcysts, which extend to the limbus and are most numerous in the interpalpebral area with the clear surrounding epithelium. Moreover, central subepithelial scarring and multiple lattice lines in a spider-like branching pattern confined to the anterior-midstroma are also observed in the OD (left panel). B, The pedigree of the patient (individual II:1) shows the cosegregation analysis of the variant c.1492G>A in the KRT3 gene with the MECD phenotype.
To identify the molecular cause of the diseases, whole-exome sequencing was performed on the patient's DNA. Four different genes (GSN , KRT3 , KRT12 , and TGFBI ) were analyzed, considering autosomal dominant as the most probable inheritance pattern according to the family history and the reported cases. Only the heterozygous nucleotide variant c.1492G>A (amino acid change p.Glu498Lys) in the KRT3 gene was identified as a putative candidate mutation, which was further confirmed by Sanger sequencing. All the in silico pathogenicity predictors indicated that this variant presents a deleterious effect, while the PhastCons and PhyloP programs determined that the change affects highly conserved nucleotide and amino acid positions. The mutation was not found in an in-house cohort of 137 control individuals and neither in the human polymorphism (dbSNP) and mutational databases (HGMD and Uniprot). In addition, Sanger sequencing performed on the DNA from the patient's father, also affected by MECD, identified the same heterozygous mutation, further confirming the cosegregation of the c.1492G>A variant in KRT3 with the familial MECD phenotype (Fig. 1B ).
DISCUSSION
The present work reports, for the first time, a case of pseudo-unilateral LCD in a patient with coexistent familial MECD. The molecular screening of all genes previously associated with these 2 phenotypes revealed a novel missense pathogenic variant in KRT3 (c.1492G>A, p.Glu498Lys), correlating with the morphological and clinical MECD findings. In this regard, a similar missense mutation altering the same amino acid residue (c.1493A>T, p.Glu498Val) had already been reported in a family with MECD.3 KRT3 variant c.1492G>A as the molecular cause of the MECD in our family, which is also inherited in an autosomal dominant pattern.
Concerning the unique pseudo-unilateral LCD in the patient, it is worth mentioning that corneal dystrophies—including LCD—are generally bilateral and symmetric disorders, although some unilateral or markedly asymmetric cases have also been reported.7,8 9,10 6 GSN and TGFBI did not reveal any pathogenic mutation in our patient. Therefore, the observed corneal phenotype is a pseudo-unilateral LCD because of the lack of supporting genetic evidences, although several authors had also reported the absence of molecular cause in patients clinically diagnosed with LCD.11,12 KRT3 mutation c.1492G>A does not appear to be correlated with this unique LCD phenotype because the father also harbors the same mutation but yet does not exhibit the disease. Thus, the current clinical data cannot clarify whether the present combined corneal phenotype is a manifestation of common pathogenic mechanisms or adjacent genetic defects, or only a coincidental association between 2 rare diseases, as previously reported in other similar occurrences,13
ACKNOWLEDGMENTS
The authors acknowledge the private donators for their financial support, as well as the patient and her family.
REFERENCES
1. Weiss JS, Møller HU, Aldave AJ, et al. IC3D classification of corneal dystrophies-edition 2. Cornea. 2015;34:117–159.
2. Irvine AD, Corden LD, Swensson O, et al. Mutations in cornea-specific keratin K3 or K12 genes cause Meesmann's corneal dystrophy. Nat Genet. 1997;16:184–187.
3. Szaflik JP, Ołdak M, Maksym RB, et al. Genetics of Meesmann corneal dystrophy: a novel mutation in the keratin 3 gene in an asymptomatic family suggests genotype-phenotype correlation. Mol Vis. 2008;14:1713–1718.
4. Chen JL, Lin BR, Gee KM, et al. Identification of presumed pathogenic KRT3 and KRT12 gene mutations associated with Meesmann corneal dystrophy. Mol Vis. 2015;21:1378–1386.
5. Stenson PD, Ball EV, Mort M, et al. Human gene mutation database (HGMD®): 2003 update. Hum Mutat. 2003;21:577–581.
6. Lisch W, Wasielica-Poslednik J, Kivelä T, et al. The hematologic definition of monoclonal gammopathy of undetermined significance in relation to paraproteinemic keratopathy (an American Ophthalmological Society thesis). Trans Am Ophthalmol Soc. 2016;114:T7.
7. Aldave AJ, Rayner SA, Kim BT, et al. Unilateral lattice corneal dystrophy associated with the novel His572del mutation in the TGFBI gene. Mol Vis. 2006;12:142–146.
8. Kojima Y, Inoue T, Hori Y, et al. Unilateral variant of late-onset lattice corneal dystrophy with the Pro501Thr mutation in the TGFBI gene without deposits in the unaffected cornea using confocal microscopy. Cornea. 2013;32:1396–1398.
9. Aldave AJ, Lin DY, Principe AH, et al. Anterior basement membrane corneal dystrophy and pseudo-unilateral lattice corneal dystrophy in a patient with recurrent corneal erosions. Am J Ophthalmol. 2004;137:1124–1127.
10. Lin PY, Kao SC, Hsueh KF, et al. Localized amyloidosis of the cornea secondary to trichiasis: clinical course and pathogenesis. Cornea. 2003;22:491–494.
11. Yellore VS, Sonmez B, Rayner SA, et al. A late-onset unilateral variant of lattice corneal dystrophy not associated with a TGFBI mutation. Br J Ophthalmol. 2008;92:426–427.
12. Fujiki K, Nakayasu K, Kanai A. Corneal dystrophies in Japan. J Hum Genet. 2001;46:431–435.
13. Dudakova L, Skalicka P, Davidson AE, et al. Coincidental occurrence of Schnyder corneal dystrophy and posterior polymorphous corneal dystrophy type 3. Cornea. 2019;38:758–760.
