Secondary Logo

Journal Logo

Perspective

SARS coronavirus without reservoir originated from an unnatural evolution, experienced the reverse evolution, and finally disappeared in the world

Dezhong, Xu; Huimin, Sun; Haixia, Su; Lei, Zhang; Jingxia, Zhang; Bo, Wang; Rui, Xu

Author Information
doi: 10.3760/cma.j.issn.0366-6999.20131328
  • Free

Severe acute respiratory syndrome (SARS) first emerged in Guangdong on November 16, 2002, and subsequently spread to Hong Kong, Beijing, Taiwan, and other areas. According to WHO, 8 098 cases were reported in 29 countries.1,2 Although researchers around the world have been carrying out extensive studies for 10 years, the reservoir of SARS coronavirus (CoV) has not been found.1,3-18

At the beginning, a virus sharing 99.8% homology with SARS CoV was found in Himalayan palm civet (Paguma larvata).10 However, it is not the reservoir11-18 and the investigation has focused on bats.19-29 Some researchers believe that Bt-SLCoV (Bat SARS-like coronavirus) Rp3 (DQ71615) of Rhinolophus sinicus is closer to SARS CoV than other strains, but still not the direct ancestor. Rp3 was supposed to emerge first in 1998, 4.08 (1.45-8.84) years earlier than SARS CoV.20,25 It seems that the great grandfather of SARS CoV has been found but not the grandfather and the father. Thus, we define Rp3 as “the parental generation (PG) 3” of SARS CoV, leaving “PG 1 and 2” to be found. To explore the cross-species evolution of SARS CoV, studies have been conducted on its major genes such as ORF1a, ORF1b, S, E, M, N, especially gene S and S-encoded amino acids combined with angiotensin-converting enzyme 2 (ACE2). Although some characteristics have been found, scholars still believe that further studies are needed.1,3,5,6,8-13,18,20,21,22-25,30-39

However, we find that even after a lot of work and achievements, many researchers in a series of academic fields still follow conventional ideas. Therefore, from an innovative macroscopic view, in this article, we restudied and reanalyzed comparatively and comprehensively the findings and evidence of almost all existing researches of SARS and SARS CoV, and other infectious diseases, to reveal whether SARS CoV experiences unnatural evolution.

The very unusual natural history of SARS in epidemiology and debates on the existence of SARS CoV in nature now

As early as on February 20, 2005, Kathryn V. Holmes, an American microbiologist, said at the annual conference of American Association for the Advancement of Science (AAAS) that in the world another outbreak of SARS as in 2003 would not take place and the SARS virus strain could be found only in the experimental specimens.40 But afterwards, she added that perhaps the virus would emerge again due to hazardous incidents or new mutations.31,40 This shows that even an expert like Kathryn V. Holmes in this field harbors reservation. But her words aroused debates and many scholars from China have raised objections (http://scitech.people.com.cn/GB/25893/3196196.html).41

However, it would not be so difficult to answer the question if we reexamine the whole process of SARS epidemic carefully. Based on the most abnormal characteristics in the existing findings on the epidemic, we could now state with certainty that the natural history of SARS is very unusual in epidemiology compared to that of other human infectious diseases, and furthermore, the conclusions should be extraordinary compared with those in the studies on SARS conducted so far.

Unusual natural history of SARS in epidemiology

In China, over 100-150 cases every day, as well as many super spreaders, were reported between mid-April and early May of 2003 but none after June 3.2 And only four mild cases were reported between mid-December 2003 and early January 2004 in the Guangzhou outbreak. It is surprising that nine SARS cases were diagnosed in the laboratory outbreak between March and April 2004 in China (http://www.who.int/csr/don/2004_05_18a/en/index.html), and among them one died and a nurse was super spreader.42 So the manifestation is different from that in Guangzhou outbreak, but similar to that of the 2002-2003 epidemic. The isolated virus in laboratory outbreak presents the same situation. Since then SARS has disappeared. It is exclusively one phenomenon in the natural history of human infectious diseases.

In the history of human beings, only one infectious disease, smallpox, has been eradicated. Its eradication was officially announced by WHO in 1980 after 20 years of effort of medical workers and governments around the world.43 Unlike SARS, acquired immunodeficiency syndrome (AIDS), a variety of viral hepatitis, influenza A (H1N1) that emerged in 2009, and other emerging infectious diseases are still found occurring and spreading extensively and continually around the world. Hendra virus (HV) and Nipah virus (NV), as members of the genus Henipavirus, were found at the end of last century to be of zoonotic origin and can still be found from time to time.44-46 Comparatively, the natural history of SARS is different from the rest in that it is against the general epidemiological pattern of infectious diseases.

Reservoir of SARS CoV still has not been identified

Since April 2003, researchers have endeavored to search for the reservoir which is believed to be a kind of bat. However, in spite of the efforts for almost 10 years, the direct ancestor still remains a mystery till now.21,23,24,26-29 One question may arise: is there a direct ancestor of SARS CoV in nature?

Comparatively, the fruit-eating bats (Pteropus spp. bats or flying foxes) are already identified as the reservoirs of HV and NV.44-46 Despite the identification of HIV as early as in 1983, only recently has it been identified that M among three groups of HIV-1 has 13 subtypes, A1, A2, A3, A4, B, C, D, F1, F2, G, H, J, and K, and probably a new subtype P, and has 53 circulating recombinant forms.47-53 Researchers have revealed that tMRCA (the time of the most recent common ancestor) of SIVcpz is around 1492 and M is around 1921, N 1963, and O 1920.50-53 In spite of such a complicated origin, studies have eventually revealed the origin of HIV-1. The global spreading of H1N1 influenza A (S-OIV) in 2009 bears more similarities with that of SARS. CDC of America isolated the same virus from two epidemiologically unrelated cases. The virus was identified as the pathogen in the epidemic and composed of eight genes from mainly four ancestries and much more closely related with the triple-reassortant swine influenza virus spreading in North America.54,55 Although the origin of the H1N1 virus is so complex, studies revealed it within only 2 months.

By comparing the study history above, one may find that it is not because of inadequate efforts or backward methods, but only the one-way thought that makes the identification of the reservoir of SARS CoV a failure. If there is no reservoir for SARS CoV, how can it survive? In fact, SARS CoV has disappeared in nature, so SARS CoV is just a “passenger virus” named by us through the human history. Why is there no reservoir for SARS CoV in nature? To answer the question, we shall first clarify that SARS CoV experiences the reverse evolution.

Reverse evolution in phylogenesis of SARS CoV

When investigating the phylogenetic development of SARS CoV and its relationship with the SARS epidemic, we found SARS CoV experienced “reverse evolution”, which was defined as “the evolution of regaining the ancestral state”.56 Due to some restrictions, the current literature mainly involves experimental studies on the reverse evolution, especially in microorganism, protozoa, and insects.56,57 However, there are still some long-term and extensive studies on the reverse evolution closely related to human living environment.58,59 Interestingly, we also found the reverse evolution in HIV-1 evolution in the literature. Although the researchers did not use the term “reversion evolution”, they did use “retrieve” and even “evolves toward ancestral states” and “frequent reversion”. Three mechanisms may contribute to this “reversion”, among which the “storage and retrieve” of HIV-1 plays the most important role.60-62

The reverse evolution of SARS CoV greatly differs from that mentioned above. We restudied and reanalyzed a massive amount of research papers by scholars worldwide,1,3-16,18-39 although they have already made conclusions through routine analyses. Under the guidance of the theory, we revealed the rules of the reverse evolution in SARS CoV, which lays a scientific foundation for the exploration of the origin of SARS CoV.

SARS CoV in Guangzhou outbreak shows a closer relationship with that at the early phase of epidemic than at the late phase and the ratio of Ka/Ks decreased gradually in epidemic

The researchers chronologically divided the 2002-2003 epidemic into the early, middle, and late phases.1,18 Song et al18 constructed an unrooted phylogenetic tree of 96 SARS-CoV sequences. It was shown that SARS CoV in Guangzhou outbreak is more closely related with that at the early phase in the 2002-2003 epidemic than at the late phase, suggesting the occurrence of the reverse evolution. In the study, Song aimed to prove that the Guangzhou outbreak was an independent event. Coincidentally, it provides evidence for our study on the reverse evolution. Moreover, the phylogenetic trees constructed by Janies et al25 as well as the trees in other literature11,20,24 show similar tendency.

The change of SARS-CoV positive selection pressure in the patients can also illustrate the reverse evolution. Chinese researchers pointed out that the ratio of Ka/Ks (the rates of nonsynonymous to synonymous) decreased gradually over the three phases of the epidemic and the Ka/Ks ratios at late phases were significantly less than 1.0.1

Reverse evolution in some key amino acids at the receptor banding site of SARS CoV and Bt-SLCoV

The bonding sites of SARS CoV to ACE2, closely related to the transmissibility, are among amino acids 318-510 of spike protein, especially amino acids 487 and 479.1,11,12,18,20,25,30,31-34,36,63 Li et al63 indicate that when the variations occur among the four amino acids including 487 and 479 in the binding interface between SARS-CoV RBD (receptor-binding domain) and human receptor ACE2, the charges increase (N479K) and the key methyl radicals miss (T487S), causing a thousand times decrease in the affinity of SARS CoV just like the viral strains isolated from Guangzhou outbreak. These findings objectively provide us with scientific basis for the reverse evolution.

In the study, we comprehensively reanalyzed the variations of amino acids 487 and 479 from Bt-SLCoV to SARS CoV in the whole SARS epidemic course (Table 1). As shown in Table 1, 479 in Bt-SLCoV (PG 3) is serine (S). In the 2002-2003 epidemic and/or laboratory outbreak, three types coexisted in civet SARS CoV: arginine (R), lysine (K), and asparagine (N), while only N in human. Surprisingly, during Guangzhou outbreak, only R and K existed in civet, while three types coexisted in human just as those in civet during 2002-2003. The evolution process of amino acid 487 is similar during these two periods (Table 1). Obviously, amino acids 487 and 479 went through reverse evolution in a series of strains. Janies et al25 constructed separate phylogenetic trees for 487 and 479, which more clearly support our standpoint.

Table 1
Table 1:
Variation and evolution of amino acids 487 and 479 in S1 and the characteristic 29-nt in ORF8 of SARS CoV and Bt-SLCoV within different hosts at different epidemic phases*

Reverse evolution of characteristic 29-nucleotide

There is an accessory gene unique to the SARS-CoV ORF8, which contains the characteristic 29-nt sequence, CCTACTGGTTACCAACCTGAATGGAATAT (nt27869-27897), which was absent in most SARS cases except in very few patients of the very early epidemic and all civets. Researchers believed the deletion was related to the adaptation from animals to human.1,13,15,18,20,21,25,33,64-67 Surprisingly, scholars also found the characteristic 29-nt, CCAATACATTACTATTCGGACTGGTTTAT (nt27866-27894), in Bt-SLCoV. To clearly distinguish three conditions of the characteristic 29-nt, we propose here that the 29-nt of Bt-SLCoV, the 29-nt of SARS CoV, and the 29-nt deletion are named “original 29-nt (O 29-nt),” “variation 29-nt (V 29-nt),” and “deletion 29-nt (D 29-nt),” respectively. We found that the reverse evolution also occurs to 29-nt, which is very similar to amino acids 487 and 479 in SARS CoV and Bt-SLCoV (Table 1).

The three aspects analyzed above are our main findings of the reverse evolution in SARS CoV, and there should be other aspects as well. The characteristic coding sequence (CDS) in the nsp3 of ORF1a only exists in SARS CoV and Bt-SLCoV, which is named SARS-CoV unique domain (SUD).9,18,68,69 The researchers found that SUD may regulate the viral replication and resist immune response of the host.68,69 Song et al18 indicated that mutation occurred in ORF 1a nt6295 in SARS CoV of Guangzhou outbreak, leading to a stop codon in the nsp3 CDS. The decrease or loss of SUD function shows inadaptation of SARS CoV to the human, and its genes are retrieving.

Based on the unusual characteristics above and the reverse evolution in table 1 of SARS CoV, we believe that SARS CoV has an origin from the unusual (“unnatural”) evolution of Bt-SLCoV Rp3 or similar various strains. Therefore, we should point out the mode of the reverse evolution of SARS CoV may be unprecedented even in the biological evolution history of human infectious diseases.

Cause for the reverse evolution of SARS CoV and diagram on its unnatural origin and disappearance

The reverse evolution is a normal and common phenomenon in the organic evolution, but our knowledge and studies on it are far from enough. The reverse revolution is caused directly by the changes of landscapes and environments in which organisms live. We try to summarize them into three aspects effecting on the degree and rate of the reverse evolution. (1) Colony is likely to maintain the standing genetic variations derived from its ancestors’ living environments when it moves to a new environment for a short time. (2) The frequency of selecting the variations of existing genotypes adaptive to their ancestors’ living environments would increase when organisms reverse to their ancestors’ state. (3) In a new environment, fewer adaptive variants reflect the poor adaptive conditions, which may contribute to the reverse revolution.

Therefore, since SARS CoV has an unnatural origin and transmits itself unusually to new hosts including human and animals, it has always been under the pressure of “reverse evolution.” Based on the above discussion and scientific reasoning, we draw a diagram on the unnatural origin and evolution of SARS CoV (Figure 1). Though Figure 1 needs to be improved, added, and modified in some details, it can in general provide reasonable answers to the questions unanswered.

Figure 1.
Figure 1.:
Hypotheses on the origin and evolution of SARS CoV. The diagram is divided into two levels. The upper level describes the origin and evolution procedure of SARS CoV, and the lower shows details on the contents or characteristics of strains at the upper level. 487 and 479 represent the amino acids at sites 487 and 479 in the region of S1, and the letters in capital before or after the two numbers indicate the category of the amino acid. O 29-nt, V 29-nt, and D 29-nt represent the three states of ORF8 of the characteristic 29-nt: nt27866-27894 of Bt-SLCoV, nt27869-27897 of SARS CoV, and 29-nt deletion of SARS CoV, respectively. SUD and SC SUD represent the characteristic CDS in nsp3 on the ORF1a gene of SARS CoV and Bt-SLCoV, and SUD with stop codon after the variation of nt6295, respectively. SARS-CoV strains: EPGZ02GD01, 2 strains from patients at the early phase; LPTor2, 1 strain from patients at the late phase; P. larvataSZ3, 1 strain from P. larvata in May 2003; 04Y GZ04, strains from patients in Guangzhou outbreak; PC04, strains from P. larvata in Guangzhou outbreak. It is necessary to understand that all the strains in the diagram should be considered as a representative rather than the proper strain. SARS CoV: Jul 03- GZ OB (carrying with reverse evolution), SARS CoV during the period from July 2003 to December 2003 may be carried with reverse evolution by civet or other animal, or human. Laboratory infection (storage): to state the time (M/D/Y), place, and number of cases in three laboratory infections: 03, 25 2004-04, 17 2004 B&A (Beijing & Anhui) 9 (1 died); 09, 09 2003 S (Singapore) 1; 12, 17 2003 T (Taiwan) 1, and now SARS CoV is only stored in laboratories and cannot be found in nature.

Conclusions

With the principles of molecular epidemiology, phylogenetics, and the reverse evolution as the guidance, we have historically and comprehensively restudied and reanalyzed most of the literature about SARS and related diseases. We propose a new explanation about the origin and evolution of SARS CoV. SARS CoV was unnaturally produced and transmitted. It was continuously subjected to the great pressure of inadaptation and returned back gradually to its ancestor’s state through the reverse evolution. According to the research, we put forward the possibility of a global spreading of a zoonosis caused by the pathogen of unnatural origin. The theory of the reverse evolution has played an important role in guiding people to understand the origins of infectious diseases.

Acknowledgments:

We thank professors/lecturers Chen Jingyuan, Yan Yongping, Xia Jielai, Huang Yuan, Fan Jiayong, Zhou Yumei, Su Chunping, Shi Jian, Yu Xiaohan, and Tan Yahui for their encouragement.

REFERENCES

1. Chinese SARS Molecular Epidemiology Consortium. Molecular evolution of the SARS coronavirus during the course of the SARS epidemic in China. Science 2004; 303: 1666-1669.
2. WHO. Summary of probable SARS cases with onset of illness from 1 November 2002 to 31 July (2003) (revised 26 September 2003). (Accessed at http://www.who.int/csr/sars/country/table2003_09_23/en/index.html.)
3. Marra MA, Jones SJM, Astell CR, Holt RA, Brooks-Wilson A, Butterfield YSN, et al. The Genome sequence of the SARS-associated coronavirus. Science 2003; 300: 1399-1404.
4. Ksiazek T, Erdman D, Goldsmith C, Zaki S, Peret T, Emery S, et al. A novel coronavirus associated with Severe Acute Respiratory Syndrome. N Engl J Med 2003; 348: 1953-1966.
5. Rota PA, Oberste MS, Monroe SS, Nix WA, Campagnoli R, Icenogle JP, et al. Characterization of a novel coronavirus associated with severe acute respiratory syndrome. Science 2003; 300: 1394-1399.
6. Ruan YJ, Wei CL, Ee AL, Vega VB, Thoreau H, Su ST, et al. Comparative full-length genome sequence analysis of 14 SARS coronavirus isolates and common mutations associated with putative origins of infection. Lancet 2003; 361: 1779-1785.
7. Peiris JS, Lai ST, Poon LL, Guan Y, Yam LY, Lim W, et al. Coronavirus as a possible cause of severe acute respiratory syndrome. Lancet 2003; 361: 1319-1325.
8. Drosten C, Gunther S, Preiser W, vanderWerf S, Brodt HR, Becker S, et al. Identification of a novel coronavirus in patients with severe acute respiratory syndrome. N Engl J Med 2003; 348: 1967-1976.
9. Snijder EJ, Bredenbeek PJ, Dobbe JC, Thiel V, Ziebuhr J, Poon LLM, et al. Unique and conserved features of genome and proteome of SARS-coronavirus, an early split-off from the coronavirus group 2 lineage. J Mol Biol 2003; 331: 991-1004.
10. Guan YBJ, Zheng YQ, He XL, Liu ZX, Zhuang CL, Cheung SW, et al. Isolation and characterization of viruses related to the SARS coronavirus from animals in southern China. Science 2003; 302: 276-278.
11. Kan B, Wang M, Jing H, Xu X, Jiang X, Yan M, et al. Molecular evolution analysis and geographic investigation of Severe Acute Respiratory Syndrome coronavirus-like virus in palm civets at an animal market and on farms. J Virol 2005; 79: 11892-11900.
12. Wang M, Yan M, Xu H, Liang W, Kan B, Zheng B, et al. SARS-CoV infection in a restaurant from palm civet. Emerg Infect Dis 2005; 11: 1860-1865.
13. Wu D, Tu C, Xin C, Xuan H, Meng Q, Liu Y, et al. Civets are equally susceptible to experimental infection by two different severe acute respiratory syndrome coronavirus isolates. J Virol 2005; 79: 2620-2625.
14. Tu C, Crameri G, Kong X, Chen J, Sun Y, Yu M, et al. Antibodies to SARS coronavirus in civets. Emerg Infect Dis 2004; 10: 2244-2248.
15. Enserink M. Clues to the animal origins of SARS. Science 2003; 300: 1351.
16. Yeh SH, Wang HY, Tsai CY, Kao CL, Yang JY, Liu HW, et al. Characterization of severe acute respiratory syndrome coronavirus genomes in Taiwan: molecular epidemiology and genome evolution. Proc Natl Acad Sci U S A 2004; 101: 2542-2547.
17. Xu RH, He JF, Evans MR, Peng GW, Field HE, Yu DW, et al. Epidemiologic clues to SARS origin in China. Emerg Infect Dis 2004; 10: 1030-1037.
18. Song H, Tu C, Zhang G, Wang S, Zheng K, Lei L, et al. Crosshost evolution of severe acute respiratory syndrome coronavirus in palm civet and human. Proc Natl Acad Sci U S A 2005; 102: 2430-2435.
19. Li W, Shi Z, Yu M, Ren W, Smith C, Epstein JH, et al. Bats are natural reservoirs of SARS-like coronaviruses. Science 2005; 310: 676-679.
20. Yip CW, Hon CC, Shi M, Lam TY, Chow KY, Zeng F, et al. Phylogenetic perspectives on the epidemiology and origins of SARS and SARS-like coronaviruses. Infec Gene Evol 2009; 9: 1185-1196.
21. Lau SK, Woo PC, Li KS, Huang Y, Tsoi HW, Wong BH, et al. Severe acute respiratory syndrome coronavirus-like virus in Chinese horseshoe bats. Proc Natl Acad Sci U S A 2005; 102: 14040-14045.
22. Ren W, Li W, Yu M, Hao P, Zhang Y, Zhou P, et al. Full-length genome sequences of two SARS-like coronaviruses in horseshoe bats and genetic variation analysis. J Gen Virol 2006; 87: 3355-3359.
23. Tang XC, Zhang JX, Zhang SY, Wang P, Fan XH, Li LF, et al. Prevalence and genetic diversity of coronaviruses in bats from China. J Virol 2006; 80: 7481-7490.
24. Hon CC, Lam TY, Shi ZL, Drummond AJ, Yip CW, Zeng F, et al. Evidence of the recombinant origin of a bat severe acute respiratory syndrome (SARS)-like coronavirus and its implications on the direct ancestor of SARS coronavirus. J Virol 2008; 82: 1819-1826.
25. Janies D, Habib F, Alexandrov B, Hill A, Pol D. Evolution of genomes, host shifts and the geographic spread of SARS-CoV and related coronaviruses. Cladistics 2008; 24: 111-130.
26. Lau SK, Li KS, Huang Y, Shek CT, Tse H, Wang M, et al. Ecoepidemiology and complete genome comparison of different strains of severe acute respiratory syndrome-related Rhinolophus bat coronavirus in China reveal bats as a reservoir for acute, self-limiting infection that allows recombination events. J Virol 2010; 84: 2808-2819.
27. Gouilh MA, Puechmaille SJ, Gonzalez JP, Teeling E, Kittayapong P, Manuguerra JC. SARS-Coronavirus ancestor’s foot-prints in South-East Asian bat colonies and the refuge theory. Infect Genet Evol 2011; 11: 1690-1702.
28. Balboni A, Battilani M, Prosperi S. The SARS-like coronaviruses: the role of bats and evolutionary relationships with SARS coronavirus. New Microbiol 2012; 35: 1-16.
29. Wang LF, Shi Z, Zhang S, Field H, Daszak P, Eaton BT. Review of bats and SARS. Emerg Infect Dis 2006; 12: 1834-1840.
30. Li F, Li W, Farzan M, Harrison SC. Structure of SARS coronavirus spike receptor-binding domain complexed with receptor. Science 2005; 309: 1864-1868.
31. Holmes KV. Structural biology. Adaptation of SARS coronavirus to humans. Science 2005; 309: 1822-1823.
32. Qu XX, Hao P, Song XJ, Jiang SM, Liu YX, Wang PG, et al. Identification of two critical amino acid residues of the severe acute respiratory syndrome coronavirus spike protein for its variation in zoonotic tropism transition via a double substitution strategy. J Biol Chem 2005; 280: 29588-29595.
33. Li F. Structural analysis of major species barriers between humans and palm civets for severe acute respiratory syndrome coronavirus infections. J Virol 2008; 82: 6984-6991.
34. Graham RL, Baric RS. Recombination, reservoirs, and the modular spike: mechanisms of coronavirus cross-species transmission. J Virol 2010; 84: 3134-3146.
35. Qin E, He W, Tian Y, Liu W, Li J, Wen J, et al. A genome sequence of novel SARS-CoV isolates: the genotype, GD-Ins29, leads to a hypothesis of viral transmission in South China. Geno Prote Bioinfo 2003; 1: 101-107.
36. Wu K, Peng G, Wilken M, Geraghty RJ, Li F. Mechanisms of host receptor adaptation by severe acute respiratory syndrome coronavirus. J Biol Chem 2012; 287: 8904-8911.
37. Demogines A, Farzan M, Sawyer SL. Evidence for ACE2-utilizing coronaviruses (CoVs) related to severe acute respiratory syndrome CoV in bats. J Virol 2012; 86: 6350-6353.
38. Adedeji AO, Marchand B, te Velthuis AJW, Snijder EJ, Weiss S, Eoff RL, et al. Mechanism of nucleic acid unwinding by SARS-CoV helicase. PLoS One 2012; 7: e36521.
39. Yu MS, Lee J, Lee JM, Kim Y, Chin YW, Jee JG, et al. Identification of myricetin and scutellarein as novel chemical inhibitors of the SARS coronavirus helicase, nsP13. Bioorg. Med Chem Lett 2012; 22: 4049-4054.
40. Threat of new SARS outbreak ‘low’. BBC NEWS, 2005 (Accessed at http://news.bbc.co.uk/go/pr/fr/-/2/hi/health/4280253.stm).
41. Wen T. Has SARS disappeared from nature? (in Chinese). Recent Dev Sci Technol Abroad 2005; 3: 28-31.
42. Zhang CW, Yao YH, Wang GQ. Laboratory Infection of SARS-CoV Calls for Biosafety. Mord Prevent Med 2004; 31: 656-660.
43. Bhattacharya S. The World Health Organization and global smallpox eradication. J Epidemiol Community Health 2008; 62: 909-912.
44. Hasebe F, Thuy NT, Inoue S, Yu F, Kaku Y, Watanabe S, et al. Serologic evidence of nipah virus infection in bats, Vietnam. Emerg Infect Dis 2012; 18: 536-537.
45. Hsu VP, Hossain MJ, Parashar UD, Ali MM, Ksiazek TG, Kuzmin I, et al. Nipah virus encephalitis reemergence, Bangladesh. Emerg Infect Dis 2004; 10: 2082-2087.
46. Lo MK, Lowe L, Hummel KB, Sazzad HM, Gurley ES, Hossain MJ, et al. Characterization of Nipah virus from outbreaks in Bangladesh, 2008-2010. Emerg Infect Dis 2012; 18: 248-255.
47. Taylor BS, Hammer SM. The challenge of HIV-1 subtype diversity. N Engl J Med 2008; 359: 1965-1966.
48. Lythgoe KA, Fraser C. New insights into the evolutionary rate of HIV-1 at the within-host and epidemiological levels. Proc Biol Sci 2012; 279: 3367-3375.
49. Matthews PC, Prendergast A, Leslie A, Crawford H, Payne R, Rousseau C, et al. Central role of reverting mutations in HLA associations with human immunodeficiency virus set point. J Virol 2008; 82: 8548-8559.
50. Hemelaar J, Gouws E, Ghys PD, Osmanov S. WHO-UNAIDS Network for HIV Isolation and Characterisation. Global trends in molecular epidemiology of HIV-1 during 2000-2007. AIDS 2011; 25: 679-689.
51. Keele BF, Van Heuverswyn F, Li Y, Bailes E, Takehisa J, Santiago ML, et al. Chimpanzee reservoirs of pandemic and nonpandemic HIV-1. Science 2006; 313: 523-526.
52. Aldrich C, Hemelaar J. Global HIV-1 diversity surveillance. Trends Mol Med 2012; 18: 691-694.
53. Hemelaar J. The origin and diversity of the HIV-1 pandemic. Trends Mol Med 2012; 18: 182-192.
54. Fraser C, Donnelly CA, Cauchemez S, Hanage WP, Van Kerkhove MD, Hollingsworth TD, et al. WHO Rapid Pandemic Assessment Collaboration Pandemic potential of a strain of influenza A (H1N1): early findings. Science 2009; 324: 1557-1561.
55. Novel Swine-Origin Influenza A (H1N1) Virus Investigation Team. Emergence of a Novel Swine-Origin Influenza A (H1N1) Virus in Humans. N Engl J Med 2009; 360: 2605-2615.
56. Teotónio H, Rose MR. Perspective: reverse evolution. Evolution 2001; 55: 653-660.
57. Teotónio H, Chelo IM, Bradić M, Rose MR, Long AD. Experimental evolution reveals natural selection on standing genetic variation. Nat Genet 2009; 41: 251-257.
58. Cook LM, Grant BS. Frequency of insularia during the decline in melanics in the peppered moth Biston betularia in Britain. Heredity (Edinb) 2000; 85 (Pt 6): 580-585.
59. Saenko SV, Jerónimo MA, Beldade P. Genetic basis of stagespecific melanism: a putative role for a cysteine sulfinic acid decarboxylase in insect pigmentation. Heredity (Edinb) 2012; 108: 594-601.
60. Herbeck JT, Rolland M, Liu Y, McLaughlin S, McNevin J, Zhao H, et al. Demographic processes affect HIV-1 evolution in primary infection before the onset of selective processes. J Virol 2011; 85: 7523-7534.
61. Herbeck JT, Nickle DC, Learn GH, Gottlieb GS, Curlin ME, Heath L, et al. Human immunodeficiency virus type 1 env evolves toward ancestral states upon transmission to a new host. J Virol 2006; 80: 1637-1644.
62. Abecasis AB, Vandamme AM, Lemey P. Quantifying differences in the tempo of human immunodeficiency virus type 1 subtype evolution. J Virol 2009; 83: 12917-12924.
63. Li W, Zhang C, Sui J, Kuhn JH, Moore MJ, Luo S, et al. Receptor and viral determinants of SARS-coronavirus adaptation to human ACE2. EMBO J 2005; 24: 1634-1643.
64. Oostra M, de Haan CA, Rottier PJ. The 29-nucleotide deletion present in human but not in animal severe acute respiratory syndrome coronaviruses disrupts the functional expression of open reading frame 8. J Virol 2007; 81: 13876-13888.
65. Vega VB, Ruan Y, Liu J, Lee WH, Wei CL, Se-Thoe SY, et al. Mutational dynamics of the SARS coronavirus in cell culture and human populations isolated in 2003. BMC Infect Dis 2004; 6: 32.
66. Chen CY, Ping YH, Lee HC, Chen KH, Lee YM, Chan YJ, et al. Open reading frame 8a of the human severe acute respiratory syndrome coronavirus not only promotes viral replication but also induces apoptosis. J Infect Dis 2007; 196: 405-415.
67. Keng CT, Choi YW, Welkers MR, Chan DZ, Shen S, Gee Lim S, et al. The human severe acute respiratory syndrome coronavirus (SARS-CoV) 8b protein is distinct from its counterpart in animal SARS-CoV and down-regulates the expression of the envelope protein in infected cells. Virology 2006; 354: 132-142.
68. Johnson MA, Chatterjee A, Neuman BW, Wüthrich K. SARS coronavirus unique domain: three-domain molecular architecture in solution and RNA binding. J Mol Biol 2010; 400: 724-742.
69. Adedeji AO1, Marchand B, Te Velthuis AJ, Snijder EJ, Weiss S, Eoff RL, et al. Mechanism of nucleic acid unwinding by SARS-CoV helicase. PLoS One 2012; 7: e36521.
Keywords:

SARS coronavirus; reverse evolution; epidemiology; infectious disease

© 2014 Chinese Medical Association