Introduction
Cataracts are a leading cause of blindness, accounting for approximately half of all cases of blindness worldwide.[1,2]
Studies have shown that long non-coding RNAs (lncRNAs), a new type of non-coding RNA, play crucial roles in epigenetic, transcriptional, and post-transcriptional regulations and have become the focus of research in various fields.[3,4] TUG1 ) was shown to be upregulated in taurine-treated retinas.[5] TUG1 has specific biological functions in different life processes, and its abnormal expression may lead to the occurrence of human diseases.[6] TUG1 in osteosarcoma, colorectal cancer, esophageal squamous cell cancer, bladder cancer, and many other tumors has been increasingly reported and is expected to become a therapeutic target for a variety of diseases and an indicator of prognosis.[7] et al [8] TUG1 directly interacts with miR-29c and suppresses the expression of miR-29c in bladder cancer cells. However, current studies on lncRNA TUG1 mostly focus on the tumor field, and our understanding of its role in the pathogenesis of cataracts is still limited.
MicroRNAs (miRNAs) are small non-coding RNAs with a length of 17 to 25 nucleotides that are involved in various biological cellular activities.[9] [10-12] [13] [11,14,15] [16] [17,18] apoptosis and DNA methylation.[19,20] et al [21] [22]
Currently, apoptosis of HLEC is widely believed to be the cytological basis for ARC formation.[23,24] apoptosis include mitochondrial damage, endoplasmic reticulum stress, and apoptosis induced by the death receptor pathway. Smac /DIABLO (second mitochondria-derived activator of caspases/direct inhibitor of apoptosis protein (IAP)-binding protein with a low pI, designated here as Smac ), which is located on chromosome 12q24.31 in the human genome, is a signature protein involved in the mitochondrial apoptosis pathway.[25] Smac plays an important role in apoptosis induction and regulation. Under normal conditions, Smac is differentially expressed in tissues and cells, and mature Smac proteins are stably stored in the mitochondrial membrane and do not induce cell apoptosis . When cells are damaged by oxidative stress, radiation, or other stimuli, Smac is released into the cytoplasm. It then directly binds to members of the IAPs family, blocking IAP's inhibitory effect on the caspase family and apoptosis , thus promoting apoptosis ,[26] Smac -mediated apoptosis . According to our previous research, Smac is highly expressed in the ARC and is involved in the endoplasmic reticulum stress pathway to regulate apoptosis of lens epithelial cells.[27] Smac plays a role in multiple apoptotic pathways. A previous study on apoptosis in cataracts has mainly focused on caspase, P53, Bax, and other factors.[16] apoptosis through Smac has not been reported worldwide.
Using bioinformatics software, we predicted that miR-29b had specific binding sites for lncRNA TUG1 and Smac . Therefore, we hypothesized that lncRNA TUG1 may act as a ceRNA (that participates in the pathogenesis of ARC) by competitively inhibiting miR29b, regulating the expression of Smac in HLEC, and influencing the signaling pathway of apoptosis .
Methods
Clinical samples
Anterior lens capsule samples of the experimental group were obtained from patients with ARC. Using the lens opacity classification system III (LOCS III), 30 cases, between 50 and 70 years of age, were categorized into ARCC, ARNC, and ARPC groups according to LOCS III, with ten cases in each group, and the degree of lens opacity was ≥4. Anterior lens capsule samples of the control group were obtained from patients undergoing vitrectomy of the epiretinal membranes. In a total of ten patients aged 50 to 70 years, the degree of lens opacity was ≤2. Exclusion criteria included high myopia, uveitis, eye trauma, or other complicated cataracts of known etiology, glaucoma, myopia, diabetic retinopathy, uveitis, other major eye diseases, and systemic diseases, such as hypertension and diabetes. All procedures were approved by the Ethics Committee of the First Affiliated Hospital of Zhengzhou University (No. 2021-KY-0712-004) and followed the tenets of the Declaration of Helsinki . Written informed consent was obtained from all patients.
Cell culture and H2 O2 treatment
The human lens epithelial cell line (HLE-B3) was purchased from the Chinese Academy of Sciences Cell Bank (Shanghai, China). Cells were cultured in Dulbecco's modified eagle medium (HyClone, Logan, UT, USA) containing 10% fetal bovine serum (HyClone) and 1% penicillin/streptomycin (Gibco, Invitrogen, Grand Island, NY, USA) in a 37°C incubator with 5% CO2 . Cell counting kit-8 (CCK-8) assay was used to detect cell viability under different concentrations of H2 O2 , and the concentration of H2 O2 at a 50% inhibition rate (IC50) was determined. In the subsequent experiments, the HLE-B3 cells were then treated with this concentration of H2 O2 for 24 h as the experimental condition, to establish a lens epithelial cell apoptosis model.
Cell transfection
Total RNA was extracted from HLE-B3 cells using TRIzol reagent (Invitrogen), and TUG1 complementary DNA (cDNA) was amplified and cloned into the plasmid cDNA (pcDNA) vector, which was named pcDNA-TUG1. TUG1 short hairpin RNA was annealed and cloned into the lentivirus vector pm7.1 at the EcoR1 and AgeI sites to construct the knockdown plasmid. MiR-29b mimic, mimic control, inhibitor, and inhibitor control were purchased from GenePharma (Shanghai, China). The cells were transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.
Quantitative real-time polymerase chain reaction (RT-qPCR)
According to the manufacturer's instructions, total RNA was extracted from frozen anterior lens capsule tissues or cultured cells using TRIzol (Invitrogen). RNA purity and concentration were determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, USA). Reverse transcription was performed using the HiScript II qRT SuperMix II cDNA Synthesis Kit (Vazyme, Nanjing, China). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a reference for TUG1 and Smac , and U6 was used as the reference for miRNA-29b. Quantitative PCR was performed in a reaction volume of 20 μL containing 10 μL of SYBR Green Master Mix, 1 μL of cDNA templates, 0.4 μL each of forward and reverse primers, and 8.2 μL of PCR-grade sterile water. The relative expression level of each RNA was calculated using the 2–ΔΔ Ct method. The primer sequences for the target genes are listed in Table 1 .
Table 1 -
The primers used for RT-qPCR.
Names
Sequences (5′- 3′)
Length (bp)
TUG1
F
GGACCTGGAACCCGAAAGAG
20
R
TGGTGGTAGTGCTTGCTCAG
20
Smac F
CGCGCAGCGTAACTTCATTC
20
R
CCAAAGCCAATCGTCACAGTTTT
23
GAPDH
F
TGTGGGCATCAATGGATTTGG
21
R
ACACCATGTATTCCGGGTCAAT
22
miR-29b
RT
CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAG TAACCGAT
44
F
ACACTCCAGCTGGGTAGCACCATCTGAAAT
30
R
TGGTGTCGTGGAGTCG
16
U6
F
CTCGCTTCGGCAGCACA
17
R
AACGCTTCACGAATTTGCGT
20
GAPDH: Glyceraldehyde 3-phosphate dehydrogenase; RT-qPCR: Real-time polymerase chain reaction; TUG1 : Taurine upregulation gene 1.
Western blotting
After various treatments, the cells were collected and lysed in protein lysis buffer at 4°C for 30 min. Protein extracts were separated on 10% sodium dodecyl-sulfate polyacrylamide gel electrophoresis gels and then transferred to polyvinylidene difluoride membranes (Thermo Fisher Scientific, Pittsburgh, PA, USA). After blocking with TBST containing 5% non-fat milk at room temperature for 2 h, anti-rabbit Smac polyclonal antibody (1:1000 dilution, Cell Signaling Technology, Danvers, USA) and mouse anti-β-actin monoclonal antibody (1:800 dilution) were incubated with the membrane overnight at 4°C. Horseradish peroxidase (HRP)-labeled secondary antibodies were used to identify the appropriate primary antibody. After exposure, the gray values of each protein band were measured and analyzed using ImageJ software (https://imagej.net/software/imagej/
Immunofluorescence staining
After specific treatments, the HLE-B3 cells were fixed with 4% paraformaldehyde for 20 min at room temperature. After three rinses with phosphate-buffered saline (PBS), non-specific binding sites were blocked with goat serum for 30 min. The cells were incubated with the primary antibody (D5S3R 1:200; Cell Signaling Technology) overnight at 4°C and then incubated with fluorophore-conjugated secondary antibodies (1:250; Abways, Shanghai, China) in a humid chamber at room temperature for 1 h. Nuclei were stained with 4’,6-diamidino-2-phenyl indole (DAPI) in the dark for 5 min, and the cells were observed under a fluorescence microscope after sealing.
Subcellular distribution
RNA was extracted from the cytoplasm and nucleus using a Cytoplasmic Separation Kit (BestBio, 36021-1, Shanghai, China). RT-qPCR was performed to quantify the total RNA in each fraction. GAPDH and U6 served as the internal references for the cytoplasm and nucleus, respectively.
Luciferase reporter assay
The binding sites for miR-29b-3p in the 3′-UTRs of Smac and TUG1 were predicted using bioinformatics databases (TargetScan Human 7.2 and Starbase V2.0). Wild-type and mutant sequences of TUG1 and Smac were amplified by polymerized chain reaction and inserted into the pmiR-GLO vector. pmiR-TUG1-WT, pmiR-TUG1-MUT, pmiR-Smac -WT, or pmiR-Smac -MUT luciferase reporter plasmids were constructed. The reporter plasmid was co-transfected with miR-29b-3p or miRNA negtive control (NC) into HLE-B3 cells. After 48 h, relative luciferase activity was measured using a luciferase reporter assay system (E1910, Promega, Madison, WI, USA) according to the manufacturer's instructions.
RNA-binding protein immunoprecipitation assay
An EZ-Magna RNA immunoprecipitation (RIP) RNA-binding protein immunopre-cipitation kit (Millipore, Burlington, USA) was used for RIP, according to the manufacturer's instructions. Cells were harvested and lysed in complete RIP lysis buffer, and 100 μL of cell lysate was incubated with RIP immunoprecipitation buffer containing magnetic beads conjugated to human anti-Ago2 antibodies (Millipore). Normal mouse IgG (Millipore) was used as the negative control. The samples were incubated with pro-teinase K buffer to digest the protein, and immunoprecipitated RNA was isolated. The purified RNA was used for qRT-PCR analysis.
Flow cytometry analysis
The Annexin V-PE/7-AAD Flow Assay Kit (SolarBio CA1030, SolarBio, Beijing, China) was used to detect apoptosis . After treatment, cells were collected by incubation with EDTA-free trypsin and washed with PBS. A binding buffer was added to prepare a single-cell suspension. According to the manufacturer's instructions, the cells were incubated with 5 μL of Annexin V-PE and 5 μL of 7-AAD staining solution. The mixture was incubated at room temperature in the dark for 15 min. The stained cells were rinsed with binding buffer, identified, and analyzed using a FACScan flow cytometer (Beckman Coulter, Fullerton, CA, USA). The percentage of apoptotic cells was analyzed using the FlowJo software (https://www.flowjo.com/
CCK-8 assay
The cell proliferation assay was performed using a CCK-8 (Dojindo, Kumamoto, Japan) according to the manufacturer's protocol. HLE-B3 cells were seeded in 96-well plates at a density of 1 × 104 cells/well and incubated for 24 h after adhering to the wells. CCK-8 solution (10 μL/well) was added to the culture medium, and 96-well plates were placed in a humidified incubator at 37°C for 2 h. Absorbance (A) was measured at 450 nm using a microplate reader (BioTek, Vermont, USA). Cell inhibition rate = 1–cell viability.
Statistical analysis
The resulting data were statistically analyzed using Student's t -test or one-way analysis of variance (ANOVA) using SPSS software (version 20.0; IBM Corp, Armonk, NY, USA) and are presented as the mean ± standard deviation. Differences in age and sex between the groups were assessed using Student's t -test and chi-squared test. P < 0.05 was considered statistically significant.
Results
Expression of TUG1, miR-29b, and Smac in the anterior lens capsules of ARC tissue
To investigate the role of TUG1 , miR-29b, and Smac in ARC, we detected their mRNA expression in different anterior capsular tissues using RT-qPCR. The results showed that the expression levels of TUG1 and Smac in the ARC tissue were significantly higher than those in the control group (all P < 0.001) [Figure 1 A,B]. MiR-29b expression in ARC tissue was lower than that in the control group (all P < 0.0001) [Figure 1 C]. Using bioinformatics software, we predicted that miR-29b contains binding sites for lncRNA TUG1 and the Smac 3′-UTR [Figure 1 D]. This suggests that the abnormal expression of TUG1 , miR-29b, and Smac is related to the occurrence of ARC, and there may be a certain relationship between them.
Figure 1: The expression of TUG1 , miR-29b, and Smac in the anterior lens capsule of ARC tissue. (A) The mRNA expression of lncRNA TUG1 . (B) The mRNA expression of Smac . (C) The mRNA expression of miR-29b. Data are presented as means ± SD. n = 10. ∗ P < 0.001 and † P < 0.0001 compared with the control group. (D) The binding sites of lncRNA TUG1 , miR-29b, and Smac are predicted by TargetScan 7.2 and Starbase V2.0. ARC: Age-related cataracts; ARCC: Age-related cortical cataract ; ARNC: Age-related nuclear cataract ; ARPC: Age-related posterior subcapsular cataract ; lncRNA: Long noncoding RNA; SD: Standard deviation; TUG1 : Taurine upregulation gene 1.
Expression of TUG1, miR-29b, and Smac in H2 O2 -induced HLE-B3 cell apoptosis
H2 O2 stimulation is often used to construct an in vitro oxidative stress model in HLEC to simulate the occurrence of cataracts. To detect the effect of H2 O2 on HLEC, we first exposed HLE-B3 cells to different concentrations of H2 O2 (0, 100, 200, 300, 400, and 500 μmol/L) for 24 h, and calculated that the H2 O2 concentration was approximately 200 μmol/L when the cells reached the IC50 . Following this, we selected 200 μmol/L H2 O2 for 24 h as the treatment conditions for subsequent experiments to establish an in vitro model of HLEC apoptosis [Figure 2 A]. Flow cytometry results showed that in the apoptosis model, the apoptosis rate of HLE-B3 cells was higher than that of the control group (t = 33.940, P < 0.001) [Figure 2 B]. RT-qPCR results showed that the mRNA expression of TUG1 in the H2 O2 treated group was significantly higher than that in the control group (t = 5.230, P = 0.0005), whereas the level of miR-29b expression decreased (t = 6.348, P < 0.0001) [Figure 2 C]. Western blotting was used to detect the expression of Smac protein, and the results showed that the expression of Smac protein in HLE-B3 cells treated with H2 O2 was 1.5 times higher than that in the control group (t = 3.524, P = 0.0244) [Figure 2 D]. Immunofluorescence staining indicated that the expression of the Smac protein in HLE-B3 cells increased after H2 O2 treatment [Figure 2 E]. The results suggested that H2 O2 could induce the apoptosis of lens epithelial cells, and the expression trends of lncRNA TUG1 , Smac , and miR-29b in the 200 μmol/L H2 O2 -induced HLEC apoptosis model were consistent with the experimental results in vivo , indicating that our apoptosis model was successfully constructed and provided a basis for subsequent functional experiments.
Figure 2: The expression of TUG1, miR-29b, and Smac in H2 O2 -induced HLE-B3 cell apoptosis . (A) The viability of HLE-B3 cells under different concentrations of H2 O2 is detected by CCK-8. The cell inhibition rate = 1–cell viability. The action time of H2 O2 is 24 h. (B) Apoptosis rate of cells in apoptosis model. (C) mRNA expression of TUG1 and miR-29b in the apoptosis model is detected by RT-qPCR. (D) Western blotting is used to analyze the expression of Smac protein in the apoptosis model. (E) Immunofluorescence is used to detect the localization and expression of Smac protein in the apoptosis model. Blue: nuclear staining (DAPI). Red: Smac staining. Scale bar, 50 μm. Data are presented as means ± SD. n = 3. ∗ P < 0.05, † P < 0.001, and ‡ P < 0.0001 compared with the control. HLE-B3 cells in the control group are not treated with H2 O2 . CCK-8: Cell Counting Kit-8; DAPI: 4’,6-diamidino-2-phenyl indole; RT-qPCR: Real-time polymerase chain reaction; SD: Standard deviation; TUG1 : Taurine upregulation gene 1.
Interference with TUG1 can inhibit the apoptosis of HLE-B3 cells
In the above experiments, we found that TUG1 expression was up-regulated in the H2 O2 -induced apoptosis model and ARC, suggesting that TUG1 is involved in apoptosis in lens epithelial cells. To further study the role of lncRNA TUG1 in HLEC cells, the lentiviral vectors sh-TUG1 and sh-NC were infected into HLE-B3 cells (cells in each group were treated with 200 μmol/L H2 O2 for 24 h) and the associated functional changes were evaluated. We observed that sh-TUG1 effectively interfered with the expression of TUG1 (t = 14.940, P = 0.0001) [Figure 3 A]. RT-qPCR results showed that the expression of miR-29b in HLE-B3 cells was up-regulated after TUG1 knockdown (t = 5.227, P = 0.0004) [Figure 3 B]. The expression of Smac protein was detected by Western blotting, and the results showed that compared with the control group, the expression of Smac protein in HLE-B3 cells transfected with sh-TUG1 was significantly decreased (t = 4.228, P = 0.0134) [Figure 3 C]. Flow cytometry results showed that the apoptosis rate of HLE-B3 decreased after interference with TUG1 (t = 3.008, P = 0.0396) [Figure 3 D]. The localized expression of the Smac protein in each group was detected using immunofluorescence [Figure 3 E], showing that the down-regulation of TUG1 can inhibit the expression of Smac , which is consistent with the Western blot results. In conclusion, the expression of TUG1 and miR29b was negatively correlated. After the interference of TUG1 in HLE-B3 cells, the expression of miR29b increased, which was contrary to the changes in the Smac protein and apoptosis rate. These results suggest that interfering with the expression of TUG1 can inhibit apoptosis in HLEC. The lncRNA TUG1 , miR29b, and Smac can affect the apoptosis of HLEC through mutual regulation.
Figure 3: Interference with TUG1 can inhibit the apoptosis of HLE-B3 cells. HLE-B3 cells in each group are treated with 200 μmol/L H2 O2 for 24 h. (A) The interference effect of sh-TUG1 is detected by RT-qPCR. (B) The mRNA expression of miR-29b in each group. (C) Western blot shows the expression of Smac protein. (D) Cell apoptosis is analyzed by flow cytometry. (E) Immunofluorescence is used to detect the localization and expression of Smac protein in the apoptosis model. Blue: nuclear staining (DAPI). Red: Smac staining. Scale bar, 50 μm. Data are presented as means ± SD. n = 3. ∗ P < 0.05, † P < 0.001. ns: Not significant; RT-qPCR: Real-time polymerase chain reaction; SD: Standard deviation; TUG1 : Taurine upregulation gene 1.
TUG1 acted as a ceRNA to regulate miR-29b expression in HLE-B3 cells
Accumulating evidence indicates that lncRNAs can regulate target gene expression by interacting with RNA-binding proteins, or by functioning as ceRNAs for miRNAs.[28-30] apoptosis in lens epithelial cells, we performed nucleocytoplasmic isolation experiments. RT-qPCR results showed that 66.8% of TUG1 was localized to the cytoplasm of HLE-B3 cells [Figure 4 A], indicating that TUG1 may regulate target gene expression at the post-transcriptional level. In the above experiments, we found that the expression of miR-29b was negatively correlated with TUG1 in ARC, and H2 O2 -treated HLEC. Bioinformatic analysis showed that miR-29b is a potential miRNA that interacts with TUG1. Next, a luciferase reporter assay was performed to confirm the regulatory relationships. As shown in Figure 4 B, the miR-29b mimic significantly reduced the luciferase activity of TUG1-WT (t = 4.504, P = 0.0108), but did not affect the luciferase activity of TUG1-Mut (P = 0.6646), confirming that TUG1 contains a binding site for miR-29b, and TUG1 could negatively regulate miR-29b expression in HLE-B3 cells. In addition, a RIP experiment was conducted to identify their regulatory relationships. As shown in Figure 4 C, endogenous TUG1 pull-down was specifically enriched in HLE-B3, which transiently overexpressed miR-29b (t = 8.696, P < 0.01). Furthermore, endogenous TUG1 pull-down was decreased in HLE-B3 cells transiently transfected with anti-miR-29b (t = 7.663, P < 0.01). Based on these results, we identified that TUG1 regulates the expression of miR-29b by “sponging” miR-29b.
Figure 4: TUG1 acts as a ceRNA to regulate miR-29b expression in HLE-B3. (A) RT-qPCR detecting the subcellular distribution of TUG1 in HLE-B3 cells. (B) Luciferase reporter assay shows that miR-29b binds to TUG1. The luciferase reporter plasmid containing wildtype (Wt) or mutant (Mut) TUG1 is co-transfected into cells with miR-29b-3p mimics or miR-NC mimics. (C) In RIP experiments, the levels of TUG1 are detected by RT-qPCR. ∗ P < 0.05, † P < 0.01, compared with miR-29b control group. ceRNA: Competing endogenous RNA; ns: Not significant; RIP: RNA immunoprecipitation; RT-qPCR: Real-time polymerase chain reaction; TUG1: Taurine upregulation gene 1.
MiR-29b negatively regulated Smac expression in HLE-B3 cells
We found that Smac was significantly upregulated in ARC tissues and H2 O2 -treated HLEC, in contrast to miR-29b expression. Bioinformatics tools predicted that miR-29b contains the 3′-UTR binding site of Smac , and we performed a double luciferase assay to verify the specific binding between them. The results showed that the miR-29b mimic significantly reduced the luciferase activity of Smac -WT (t = 17.15, P < 0.001), but not the luciferase activity of Smac -Mut (P = 0.597) [Figure 5 C], indicating that miR-29b can specifically bind to Smac . To further determine whether Smac is regulated by miR-29b in HLE-B3 cells, we measured Smac protein expression in HLE-B3 cells using interference and overexpression vectors of miR-29b. We found that the expression level of the Smac protein was significantly downregulated in HLEC, when miR-29b was overexpressed (t = 9.942, P = 0.0006) [Figure 5 A]. Flow cytometry was used to detect the effect of miR29b changes on HLE-B3 cell apoptosis in each group, and the results showed that miR29b overexpression inhibited HLE-B3 cell apoptosis (t = 25.340, P < 0.01). In contrast, apoptosis of HLE-B3 cells increased after miR29b expression decreased (t = 15.990, P < 0.01) [Figure 5 B]. Taken together, these data suggest that by directly binding to the 3′-UTR of Smac , miR-29b inhibits its expression in HLE-B3 cells.
Figure 5: MiR-29b negatively regulates Smac expression in HLE-B3 cells. MiR-29b mimic and miR-29 mimic NC or miR-29b inhibitor and miR-29b inhibitor NC are transfected into HLE-B3 cells. Except for the control group, HLE-B3 cells in other groups are treated with 200 μmol/L H2 O2 for 24 h. (A) Western blotting is used to detect the expression of Smac protein in each group. (B) Flow cytometry detecting the apoptosis of cells. (C) The specific binding of miR29b and Smac is verified by dual luciferase assay. Partial sequences of 3′UTR binding sites are shown in red. Mutant vectors were constructed by knockout binding sequences. n = 3. ∗ P < 0.05, † P < 0.01, ‡ P < 0.001. ns: Not significant.
Effect of TUG1 overexpression on the apoptosis of HLE-B3 cells was partially reversed by miR-29b
We found that sh-TUG1 up-regulated miR-29b expression and inhibited apoptosis in HLE-B3 cells [Figure 3 ]. To investigate the role of miR-29b in TUG1 and Smac , we transfected pcDNA-TUG1, miR-29b mimic, and their respective controls into HLE-B3 cells. The results showed that the mRNA expression level of miR29b in the pcDNA-TUG1 + miRNA mimic NC group was lower than that in the pcDNA-NC + miRNA mimic NC group (t = 4.928, P < 0.001) [Figure 6 A], but the expression of Smac protein (t = 3.740, P = 0.0201) and the apoptosis rate (t = 17.400, P < 0.0001) increased [Figure 6 B,C], suggesting that TUG1 overexpression can down-regulate miR29b, thereby promoting the expression of the Smac protein and apoptosis of HLE-B3 cells. Furthermore, we transfected cells with the miR-29b mimic to perform rescue experiments. The results showed that the expression level of Smac protein (t = 5.208, P = 0.0065) and the apoptosis rate in cells (t = 6.839, P = 0.0024) transfected with miR-29 mimic + pcDNA-TUG1 were lower than those in the miRNA mimic NC + pcDNA-TUG1 group [Figure 6 B,C]. These results suggest that up-regulation of miR-29b expression by the miR-29 mimic could partially reverse the action of HLE-B3 cell apoptosis by pcDNA-TUG1, which further indicated that TUG1 could regulate HLE-B3 cell apoptosis by miR-29b.
Figure 6: The effect of TUG1 overexpression on the apoptosis of HLE-B3 cells is partially reversed by miR-29b. pcDNA-TUG1 and miR-29b promoted the expression of TUG1 and miR29b, respectively. pcDNA-NC and miRNA mimic NC are their respective controls. (A) RT-qPCR detects the mRNA level of miR-29b in each group after co-transfection. (B) Western blotting is used to analyze the expression of Smac protein in each group. (C) Apoptosis is detected by flow cytometry. Data are presented as means ± SD. n = 3. ∗ P < 0.05, † P < 0.01, ‡ P < 0.001. RT-qPCR: Real-time polymerase chain reaction; SD: Standard deviation; TUG1 : Taurine upregulation gene 1.
Discussion
Cataracts develop due to a change in lens transparency and are associated with age, genetic and environmental changes, and other factors.[31] et al [16] lncRNA TUG1 and Smac increased in the anterior capsular tissue of ARC patients, whereas the expression trend of miR-29b was reversed. These results indicate that the abnormal expression of TUG1, miR29b, and Smac is related to the occurrence of ARC. Bioinformatics software predicted that miR29b contains 3′-UTR binding sites for TUG1 and Smac . We then conducted molecular functional experiments in an in vitro cell model to verify the possible regulatory mechanisms between TUG1, miR-29b, and Smac in HLEC.
Apoptosis of lens epithelial cells is widely believed to be the cytological basis for all types of cataracts except congenital cataracts, and oxidative stress injury is an important inducing factor of lens epithelial cell apoptosis .[23,32] 2 O2 is an important oxidizing substance in aqueous humor and lenses.[33] 2 O2 content in the aqueous humor and lens of cataract patients is significantly higher than that in transparent lenses, and the antioxidant enzyme activity in the aqueous humor of ARC patients is also lower than that in normal people.[34,35] [35] 2 O2 -related oxidative damage to lens epithelial cells is involved in the pathogenesis of cataracts. Therefore, hydrogen peroxide stimulation is often used to construct an in vitro oxidative stress model of HLEC to simulate the occurrence of cataracts.[36] 2 O2 to construct an in vitro model of HLEC apoptosis and found that the expression of TUG1 and Smac increased in this model, while miR29b decreased, which was similar to the expression trend in the anterior capsule of ARC, suggesting that our cataract cell model in vitro was successfully constructed. This provides an experimental basis for further study on the function of TUG1 in this model.
As a novel lncRNA, TUG1 is involved in various biological processes. TUG1 has been widely studied in the field of oncology, and its differential expression in tumors can affect the proliferation and apoptosis of tumor cells and regulate tumor development.[37] apoptosis . However, it is expressed at low levels in non-small cell lung cancer, triple-negative breast cancer, and glioma, and plays a role in tumor suppressor genes.[38] [39] apoptosis models. To further verify the biological function of TUG1 in HLEC, we examined the expression of TUG1 in an apoptosis model. As a result of the downregulation of TUG1, the expression level of miR-29b in HLEC increased, while Smac protein expression and the apoptosis rate decreased significantly. It was suggested that lncRNA TUG1 was negatively correlated with miR-29b expression, and that interference with TUG1 could inhibit Smac expression and lens epithelial cell apoptosis .
Numerous studies have highlighted that lncRNAs bind to miRNAs by acting as ceRNAs, thereby influencing the expression of mRNAs and their downstream target genes.[40,41] [42-44] lncRNA TUG1 is involved in the occurrence of ARC, and lncRNA TUG1 is negatively correlated with the expression of miR-29b. Studies have shown that the cellular localization of lncRNAs can indicate their modes of action.[45] [46] lncRNA TUG1 and miR-29b have similar ceRNA mechanisms in the ARC, we performed nucleocytoplasmic separation experiments and confirmed that TUG1 was mainly localized to the cytoplasm of HLE-B3 cells. The RIP assay has confirmed that miR-29b could bind to TUG1 conserved binding sites, and the luciferase reporter assay showed that TUG1 negatively regulated miR-29b expression. Through a series of molecular function experiments, we confirmed that miR29b inhibits the expression of Smac . In HLE-B3 cells, miR29b affects apoptosis by regulating Smac expression.
As TUG1 can sponge miR-29b, we next determined whether TUG1 could affect the expression of Smac through competitive binding with miR-29b. We conducted co-transfection experiments and found that TUG1 overexpression in HLEC can sponge more miR-29b, thus leading to less miRNA-mediated mRNA decay of Smac by miR-29b. To further investigate the role of miR-29b in TUG1 and Smac , we transfected miR29b for rescue experiments. As expected, Smac expression was partially restored in co-transfected cells. These results indicate that miR29b can partially reverse the effect of lncRNA TUG1 on HLE-B3 cells to a certain extent, and that miR29b plays a regulatory role in the lncRNA TUG1 /Smac pathway. After H2 O2 was applied to HLE-B3 cells, the expression of lncRNA TUG1 increased under oxidative stress stimulation, and the competitive inhibitory effect of miR-29b was enhanced, leading to the release of more Smac in cells and promotion of apoptosis of lens epithelial cells [Figure 7 ].
Figure 7: Schematic demonstration of the regulatory relationships between TUG1, miR-29b, and Smac in HLE-B3 cells. TUG1: Taurine upregulation gene 1.
In summary, our study provides a new perspective for studying the pathogenesis of cataracts. In ARC, lncRNA TUG1 functions as a ceRNA by sponging miR-29b to regulate Smac expression and modulate apoptosis in HLEC. These results may provide a target and basis for the discovery of new non-surgical treatment strategies for cataracts.
Funding
This work was supported by the National Natural Science Foundation of China (Nos. 81970786, 81670836, and 82000875) and the Natural Science Foundation of Henan Province, China (No. 202300410397).
Conflicts of interest
None.
References
1. Liu YC, Wilkins M, Kim T, Malyugin B, Mehta JS. Cataracts. Lancet 2017;390:600–612. doi: 10.1016/s0140-6736(17)30544-5.
2. Kaul H, Hussain S, Mustafa G, Naz S. Fine mapping of chromosome 9 locus associated with congenital
cataract . Int Ophthalmol 2018;38:1187–1192. doi: 10.1007/s10792-017-0581-8.
3. Bian EB, Xiong ZG, Li J. New advances of lncRNAs in liver fibrosis, with specific focus on lncRNA-miRNA interactions. J Cell Physiol 2019;234:2194–2203. doi: 10.1002/jcp.27069.
4. Schmitz SU, Grote P, Herrmann BG. Mechanisms of long noncoding RNA function in development and disease. Cell Mol Life Sci 2016;73:2491–2509. doi: 10.1007/s00018-016-2174-5.
5. Khalil AM, Guttman M, Huarte M, Garber M, Raj A, Rivea Morales D, et al. Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. Proc Natl Acad Sci U S A 2009;106:11667–11672. doi: 10.1073/pnas.0904715106.
6. Yang Y, Sun DM, Yu JF, Zhang M, Yi C, Yang R, et al. Long noncoding RNA TUG1 promotes renal cell carcinoma cell proliferation, migration and invasion by downregulating microRNA196a. Mol Med Rep 2018;18:5791–5798. doi: 10.3892/mmr.2018.9608.
7. Han Y, Liu Y, Gui Y, Cai Z. Long intergenic noncoding RNA TUG1 is overexpressed in urothelial carcinoma of the bladder. J Surg Oncol 2013;107:555–559. doi: 10.1002/jso.23264.
8. Guo P, Zhang G, Meng J, He Q, Li Z, Guan Y. Upregulation of long noncoding RNA TUG1 promotes bladder cancer cell proliferation, migration, and invasion by inhibiting miR-29c. Oncol Res 2018;26:1083–1091. doi: 10.3727/096504018X15152085755247.
9. Brümmer A, Hausser J. MicroRNA binding sites in the coding region of mRNAs: extending the repertoire of post-transcriptional gene regulation. Bioessays 2014;36:617–626. doi: 10.1002/bies.201300104.
10. Correia de Sousa M, Gjorgjieva M, Dolicka D, Sobolewski C, Foti M. Deciphering miRNAs’ action through miRNA editing. Int J Mol Sci 2019;20:6249. doi: 10.3390/ijms20246249.
11. Zhou QY, Gui SY, Zhang P, Wang M. Upregulation of miR-345-5p suppresses cell growth of lung adenocarcinoma by regulating ras homolog family member A (RhoA) and Rho/Rho associated protein kinase (Rho/ROCK) pathway. Chin Med J 2021;134:2619–2628. doi: 10.1097/CM9.0000000000001804.
12. Huang YZ, Zhang J, Shen JJ, Zhao TX, Xu YJ. miRNA-296-5p functions as a potential tumor suppressor in human osteosarcoma by targeting SND1. Chin Med J (Engl) 2021;134:564–572. doi: 10.1097/CM9.0000000000001400.
13. Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell 2009;136:215–233. doi: 10.1016/j.cell.2009.01.002.
14. Salmena L, Poliseno L, Tay Y, Kats L, Pandolfi PP. A ceRNA hypothesis: the rosetta stone of a hidden RNA language? Cell 2011;146:353–358. doi: 10.1016/j.cell.2011.07.014.
15. Zhou JX, Chen KF, Hu S, Dong JR, Wang HX, Su X, et al. Up-regulation of circular RNA hsa_circ_01844 induces
apoptosis and suppresses proliferation and migration of glioblastoma cells. Chin Med J 2020;134:81–87. doi: 10.1097/CM9.0000000000000979.
16. Li G, Song H, Chen L, Yang W, Nan K, Lu P. TUG1 promotes lens epithelial cell
apoptosis by regulating miR-421/caspase-3 axis in age-related
cataract . Exp Cell Res 2017;356:20–27. doi: 10.1016/j.yexcr.2017.04.002.
17. Cheng DL, Xiang YY, Ji LJ, Lu XJ. Competing endogenous RNA interplay in cancer: mechanism, methodology, and perspectives. Tumour Biol 2015;36:479–488. doi: 10.1007/s13277-015-3093-z.
18. Song JK, Yin SY, Li W, Li XD, Luo Y, Luo Y, et al. An update on the role of long noncoding RNAs in psoriasis. Chin Med J 2020;134:379–389. doi: 10.1097/CM9.0000000000001243.
19. Rostas JW 3rd, Pruitt HC, Metge BJ, Mitra A, Bailey SK, Bae S.
microRNA-29 negatively regulates EMT regulator N-myc interactor in breast cancer. Mol Cancer 2014;13:200. doi: 10.1186/1476-4598-13-200.
20. Mazzoccoli L, Robaina MC, Apa AG, Bonamino M, Pinto LW, Queiroga E, et al. MiR-29 silencing modulates the expression of target genes related to proliferation,
apoptosis and methylation in Burkitt lymphoma cells. J Cancer Res Clin Oncol 2018;144:483–497. doi: 10.1007/s00432-017-2575-3.
21. Cheng T, Xu M, Qin B, Wu J, Tu Y, Kang L, et al. lncRNA H19 contributes to oxidative damage repair in the early age-related
cataract by regulating miR-29a/TDG axis. J Cell Mol Med 2019;23:6131–6139. doi: 10.1111/jcmm.14489.
22. Sun Y, Lu CM, Song Z, Xu KK, Wu SB, Li ZJ. Expression and regulation of microRNA-29a and microRNA-29c in early diabetic rat
cataract formation. Int J Ophthalmol 2016;9:1719–1724. doi: 10.18240/ijo.2016.12.03.
23. Yan Q, Liu JP, Li DW.
Apoptosis in lens development and pathology. Differentiation 2006;74:195–211. doi: 10.1111/j.1432-0436.2006.00068.x.
24. Li WC, Kuszak JR, Dunn K, Wang RR, Ma W, Wang GM, et al. Lens epithelial cell
apoptosis appears to be a common cellular basis for noncongenital
cataract development in humans and animals. J Cell Biol 1995;130:169–181. doi: 10.1083/jcb.130.1.169.
25. Ng H, Smith DJ, Nagley P. Application of flow cytometry to determine differential redistribution of cytochrome c and
Smac /DIABLO from mitochondria during cell death signaling. PLoS One 2012;7:e42298. doi: 10.1371/journal.pone.0042298.
26. Du C, Fang M, Li Y, Li L, Wang X.
Smac , a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition. Cell 2000;102:33–42. doi: 10.1016/S0092-8674(00)00008-8.
27. De-Qian K, Yue L, Li L, Guangying Z. Downregulation of
Smac attenuates H2O2-induced
apoptosis via endoplasmic reticulum stress in human lens epithelial cells. Medicine (Baltimore) 2017;96:e7419. doi: 10.1097/MD.0000000000007419.
28. Yang F, Shen Y, Zhang W, Jin J, Huang D, Fang H, et al. An androgen receptor negatively induced long noncoding RNA ARNILA binding to miR-204 promotes the invasion and metastasis of triple-negative breast cancer. Cell Death Differ 2018;25:2209–2220. doi: 10.1038/s41418-018-0123-6.
29. Ma MZ, Zhang Y, Weng MZ, Wang SH, Hu Y, Hou ZY, et al. Long noncoding RNA GCASPC, a target of miR-17-3p, negatively regulates pyruvate carboxylase-dependent cell proliferation in gallbladder cancer. Cancer Res 2016;76:5361–5371. doi: 10.1158/0008-5472.CAN-15-3047.
30. Hirata H, Hinoda Y, Shahryari V, Deng G, Nakajima K, Tabatabai ZL, et al. Long noncoding RNA MALAT1 promotes aggressive renal cell carcinoma through Ezh2 and interacts with miR-205. Cancer Res 2015;75:1322–1331. doi: 10.1158/0008-5472.CAN-14-2931.
31. Shen Y, Dong LF, Zhou RM, Yao J, Song YC, Yang H, et al. Role of long noncoding RNA MIAT in proliferation,
apoptosis and migration of lens epithelial cells: a clinical and in vitro study. J Cell Mol Med 2016;20:537–548. doi: 10.1111/jcmm.12755.
32. Du S, Shao J, Qi Y, Liu X, Liu J, Zhang F. Long noncoding RNA ANRIL alleviates HO-induced injury by up-regulating microRNA-21 in human lens epithelial cells. Aging(Albany NY) 2020;12:6543–6557. doi: 10.18632/aging.102800.
33. Spector A, Ma W, Wang RR. The aqueous humor is capable of generating and degrading H2O2. Invest Ophthalmol Vis Sci 1998;39:1188–1197.
34. Simonelli F, Pensa M, Teramo P, Amicone A, Russo P, Perillo F, et al. Hydrogen peroxide in the aqueous humor and
cataract formation in human diabetes. Boll Soc Ital Biol Sper 1990;66:879–885.
35. Spector A. Oxidative stress-induced
cataract : mechanism of action. FASEB J 1995;9:1173–1182. doi: 10.1096/fasebj.9.12.7672510.
36. Wang Z, Zhou S, Hu X, Chai J. Ginsenosides induce extensive changes in gene expression and inhibit oxidative stress-induced
apoptosis in human lens epithelial cells. BMC Complement Med Ther 2020;20:44. doi: 10.1186/s12906-020-2826-8.
37. Li Y, Dai C, Yuan Y, You L, Yuan Q. The mechanisms of
lncRNA Tug1 in islet dysfunction in a mouse model of intrauterine growth retardation. Cell Biochem Funct 2020;38:1129–1138. doi: 10.1002/cbf.3575.
38. Zhou H, Sun L, Wan F. Molecular mechanisms of TUG1 in the proliferation,
apoptosis , migration and invasion of cancer cells. Oncol Lett 2019;18:4393–4402. doi: 10.3892/ol.2019.10848.
39. Ghaforui-Fard S, Vafaee R, Taheri M. Taurine-upregulated gene 1: a functional long noncoding RNA in tumorigenesis. J Cell Physiol 2019;234:17100–17112. doi: 10.1002/jcp.28464.
40. Zhou RS, Zhang EX, Sun QF, Ye ZJ, Liu JW, Zhou DH, et al. Integrated analysis of lncRNA-miRNA-mRNA ceRNA network in squamous cell carcinoma of tongue. BMC Cancer 2019;19:779. doi: 10.1186/s12885-019-5983-8.
41. Wang DZ, Chen GY, Li YF, Zhang NW. Comprehensive analysis of long noncoding RNA and mRNA expression profile in rectal cancer. Chin Med J 2020;133:1312–1321. doi: 10.1097/CM9.0000000000000753.
42. Huang Y. The novel regulatory role of lncRNA-miRNA-mRNA axis in cardiovascular diseases. J Cell Mol Med 2018;22:5768–5775. doi: 10.1111/jcmm.13866.
43. Tang XJ, Wang W, Hann SS. Interactions among lncRNAs, miRNAs and mRNA in colorectal cancer. Biochimie 2019;163:58–72. doi: 10.1016/j.biochi.2019.05.010.
44. Wang JY, Yang Y, Ma Y, Wang F, Xue A, Zhu J, et al. Potential regulatory role of lncRNA-miRNA-mRNA axis in osteosarcoma. Biomed Pharmacother 2020;121:109627. doi: 10.1016/j.biopha.2019.109627.
45. Liu S, Liu LH, Hu WW, Wang M. Long noncoding RNA TUG1 regulates the development of oral squamous cell carcinoma through sponging miR-524-5p to mediate DLX1 expression as a competitive endogenous RNA. J Cell Physiol 2019;234:20206–20216. doi: 10.1002/jcp.28620.
46. Long Y, Wang X, Youmans DT, Cech TR. How do lncRNAs regulate transcription? Sci Adv 2017;3:eaao2110. doi: 10.1126/sciadv.aao2110.
