Secondary Logo

Journal Logo

Corrigendum

Corrigendum: miRNA-296-5p functions as a potential tumor suppressor in human osteosarcoma by targeting SND1

Author Information
doi: 10.1097/CM9.0000000000001629
  • Open

Following the original article's publication,[1] the authors informed us of the following errors: [1] The Figure 2 is submitted incorrectly, while correct Figure 2 should submit as following:

Figure 2
Figure 2

In the method part miRNA qRT-PCR analysis method should be corrected as follows:

For Quantitative Real-time polymerase chain reaction (qRT-PCR) analysis of mature miR-296-5p, total RNA was reverse transcribed using specific RT primers and reagents from the Taqman miRNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA). Then, the expression of miR-296-5p was analyzed using the Taqman miR-296-5p microRNA assay (Assay ID 000527, Applied Biosystems, Foster City, CA) with RNU6B used as an internal control, and measured using a prism 7900HT system (Applied Biosystems, Thermo Fisher, Waltham, MA, USA). For the quantification of SND1 mRNA, qRT-PCR was performed using the rapid quantitative SYBR-Green RT-PCR kit (Takara, Japan). GAPDH was used as an internal control. All reactions were performed in triplicate. The following primer sequences were used: SND1 forward, 5’-GGATGTGGAGTGAGGGGA-3’; SND1 reverse,5’- GTTTCACTGCCATCTGCTTC -3’; GAPDH forward 5’-GGT CTC TGA CTT CAA CA-3’; GAPDH reverse, 5’-GTGAGG GTC TCT CTC TTC CT-3’.

The authors apologize for any inconvenience caused.

Reference

1. Huang YZ, Zhang J, Shen JJ, Zhao TX, Xu YJ, et al. miRNA-296-5p functions as a potential tumor suppressor in human osteosarcoma by targeting SND1. Chin Med J 2021; 134 (5):564–572. doi: 10.1097/CM9.0000000000001400.
Copyright © 2021 The Chinese Medical Association, produced by Wolters Kluwer, Inc. under the CC-BY-NC-ND license.