Secondary Logo

Journal Logo

Original Articles

miRNA-296-5p functions as a potential tumor suppressor in human osteosarcoma by targeting SND1

Huang, Ya-Zeng1; Zhang, Jun2,3; Shen, Jian-Jian4; Zhao, Ting-Xiao2,3,5; Xu, You-Jia1,6

Editor(s): Wang, Ning-Ning

Author Information
doi: 10.1097/CM9.0000000000001400

Abstract

Erratum

Following the original article's publication, the authors informed us of the following errors: The Figure 2 is submitted incorrectly, while correct Figure 2 should submit as following:

Figure 2
5+ images

In the method part miRNA qRT-PCR analysis method should be corrected as follows:

For Quantitative Real-time polymerase chain reaction (qRT-PCR) analysis of mature miR-296-5p, total RNA was reverse transcribed using specific RT primers and reagents from the Taqman miRNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA). Then, the expression of miR-296-5p was analyzed using the Taqman miR-296-5p microRNA assay (Assay ID 000527, Applied Biosystems, Foster City, CA) with RNU6B used as an internal control, and measured using a prism 7900HT system (Applied Biosystems, Thermo Fisher, Waltham, MA, USA). For the quantification of SND1 mRNA, qRT-PCR was performed using the rapid quantitative SYBR-Green RT-PCR kit (Takara, Japan). GAPDH was used as an internal control. All reactions were performed in triplicate. The following primer sequences were used: SND1 forward, 5’-GGATGTGGAGTGAGGGGA-3’; SND1 reverse,5’- GTTTCACTGCCATCTGCTTC -3’; GAPDH forward 5’-GGT CTC TGA CTT CAA CA-3’; GAPDH reverse, 5’-GTGAGG GTC TCT CTC TTC CT-3’.

The authors apologize for any inconvenience caused.

Chinese Medical Journal. 134(13):1634, July 5, 2021.

Introduction

Osteosarcoma (OS) is the most common primary malignant bone tumor, predominantly observed in children and adolescents. About 60% of the patients are between 10 and 20 years old.[1] Despite the use of neoadjuvant chemotherapy, the 5-year survival rate of patients with localized OS has increased from 20% in the early 1970s to 60%. However, the 5-year survival rate of OS patients with local invasion or metastasis at first diagnosis is still only 20%, and the average survival is only about 23 months.[2–4] The insensitivity of some patients to chemotherapy, and the recurrence and metastasis of tumors have always been challenging in the clinical setting. Although the incidence of OS is lower than that of other tumors, basic research and clinical treatment strategies have been the focus of ongoing studies owing to the high mortality and disability rate associated with OS.

MicroRNA (miRNA) is a regulatory non-coding RNA of about 18 to 25 nucleotides in length that is commonly detected in eukaryotes.[5,6] miRNAs bind to the 3′-untranslated region (3′-UTR) of a specific target protein, facilitating its post-transcriptional regulation. Since its discovery in nematodes in 1993, bioinformatics and biological studies have identified more than 2000 miRNAs involved in the regulation of more than one-third of gene transcription processes.[7–9] Some researchers believe that each miRNA can regulate the expression of > 100 genes.[10] Studies have shown that > 50% of genes encoding miRNAs are located on the “fragile sites” of chromosomes and are adjacent to deleted or amplified regions caused by human tumor mutations, revealing a direct relationship between miRNAs and tumorigenesis.[11–15]

The miRNA-296-5p, formerly known as miRNA-296, is closely linked to tumorigenesis. In the past 3 years, several studies have reported that miRNA-296-5p can inhibit various tumors. Vaira et al[16] first reported that miRNA-296-5p inhibits lung cancer metastasis by inhibiting the expression of Numb-like (Numbl) mRNA and protein. Xu et al[17] found that miRNA-296-5p can directly target and regulate Polo-like kinase-1 (PLK1) to inhibit cell viability in non-small cell lung cancer. Savi et al[18] also showed that miR-296 can inhibit the proliferation of breast cancer by targeting SCRIB. Lee et al[19] further described the role of miRNA-296-5p in prostate cancer as an inhibitor of tumor growth by targeting Pin1. Rong et al[20] found that overexpression of a miR-296-5p inhibitor could prevent the tumorigenesis of gastric cancer cells both in vivo and in vitro.

In this study, we investigated miRNA-296-5p expression in OS and analyzed the effects of its overexpression on cell proliferation, migration, and invasion. Furthermore, we identified the downstream target of miRNA-296-5p and investigated its role in regulating cell proliferation and invasion.

Methods

Ethical approval

All patients provided their informed consent, and this study was approved by the Ethics Committee of Zhejiang Provincial People's Hospital (No. 2016KY124).

Cell culture

OS cell lines HOS, MG63, U-2OS, Saos-2, and human osteoblasts (HOB) were purchased from American Type Culture Collection (ATCC, Rockville, MD, USA). OS cell lines were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (Cat: 31800-022, Corning, New York, USA) supplemented with 10% fetal bovine serum (Cat: 10099, Gibco, Australia) at 37°C and 5% CO2. HOB cells were cultured in the PromoCell medium at 37°C and 5% CO2.

Human tissues

Human normal and primary OS tissues were obtained from 45 patients in the Zhejiang Provincial People's Hospital from August 2016 to January 2017.

Transfection

The recombinant miR-296-5p lentivirus and plasmid pCAGGS-GFP (Backbone: pCAGGS, insert: Green fluorescent protein [GFP]) were purchased from the Sangon Company (Shanghai, China). The plasmids were transfected into Saos-2 and HOS cells via Lipofectamine™ 3000 (Invitrogen, Shanghai, China) and stably transfected cells were selected using puromycin (2 μg/mL, Beyotime, Shanghai, China). Successful transfection was confirmed through quantitative reverse transcription PCR (qRT-PCR) analysis.

Immunohistochemistry (IHC)

IHC of OS tissues and adjacent normal tissues was performed. Tissues were fixed using formalin, embedded in paraffin, and then serially sectioned at 4 μm. Slides were then incubated with anti-SND1 antibody (ab65078, Abcam, Shanghai, China) overnight in a moist chamber at 4°C, washed in phosphate buffer saline (PBS), and then incubated with corresponding secondary antibodies. Slides were developed with diaminobenzidine and counterstained with hematoxylin.

qRT-PCR

The quantitative real-time polymerase chain reaction (qRT-PCR) analysis was conducted as previously described.[21] For mature miR-296-5p assays, total RNA was reverse transcribed using specific miRNA primers and reagents from the Taqman miRNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA). The cDNA obtained by PCR amplification of the primers was analyzed with Taqman miR-296-5p microRNA assay and measured using a prism 7900HT system (Applied Biosystems, Thermo Fisher, Waltham, MA, USA). U6 small nuclear RNA was used as an internal control. For the quantification of SND1 mRNA, qRT-PCR was performed using the rapid quantitative SYBR-Green RT-PCR kit (Takara, Japan). β-actin was used as an internal control. All reactions were performed in triplicate. The following primer sequences were used: miR-296-5p forward, 5′-TGC CTA ATT CAG AGG GTT GG-3′; miR-296-5p reverse, 5′-CTC CAC TCC TGG CAC ACA G-3′; SND1 forward, 5′-TGC AGC GGG GTA ATC CTG A-3′; SND1 reverse, 5′-CCT CCG ACA CTT CGT CAT CC-3′; U6 forward, 5′-CTC GCT TCG GCA CA-3′; U6 reverse 5′-AAC GCT TCA CGA ATT TGC GT-3′; GAPDH forward 5′-GGT CTC TGA CTT CAA CA-3′; GAPDH reverse, 5′-GTG AGG GTC TCT CTC TTC CT-3′.

Cell migration and invasion analysis

Cell migration and invasion assays were performed using 24-well transwell plates (Corning 8-mm pore size, New York, USA). For the transwell migration assay, 2.5 × 104 cells were incubated in the top chamber of the plate and lined with a non-coating film. For the invasion assay, 200 mg/mL Matrigel (Corning) was used to coat the chamber insert, and then 5 × 104 cells were plated in the top chamber. After 24 h of incubation, the cells were fixed with methanol, stained with crystal violet, and counted under the microscope. The results were calculated as the mean of three independent experiments.

Western blot

Cell lysates were resuspended in radio-immunoprecipitation assay dissolution buffer. The whole-cell lysates (30–60 μg in each well) were separated using 10% dodecylsulfate, sodium salt (SDS)-polyacrylamide gel electrophoresis (SDS-PAGE) and subsequently transferred onto a polyvinylidene fluoride membrane (Millipore, Danvers, MA, USA). The membrane was blocked with 5% skimmed milk and incubated overnight with primary antibodies against SND1 (ab65078) or β-actin (ab8227) at 4°C (Abcam, Cambridge, MA, USA). This was followed by the addition of a secondary antibody conjugated with horseradish peroxidase (Jackson ImmunoResearch Laboratories, West Grove, PA, USA). The bands were observed by using an enhanced chemiluminescence (ECL) system (Yeasen, China).

Luciferase reporter assay

OS cell lines HOB and Saos-2 were seeded in 24-well plates and then co-transfected with either miR-296-5p mimics or the negative control (NC), 50 ng of either pGL3-SND1-3′UTR-wt or pGL3-SND1-3′UTR-mut, and 10 ng of pRL-TK (Promega, Madison, WI, USA). Luciferase and Renilla signals were measured 48 h after transfection using the Luciferase Reporter Assay Kit (Promega). All experiments were performed in triplicate.

Statistical analysis

Statistical analysis was performed using the GraphPad Prism 8 (GraphPad Software Inc., San Diego, CA, USA). Detected by Shapiro-Wilk test, the variables conform to normal distribution. Continuous variables were expressed as mean ± standard deviation (SD). Continuous variables between groups were analyzed using t test. The relationship between miR-296-5p and SND1 expression was analyzed by Spearman correlation analysis. P values of < 0.05 were considered statistically significant.

Results

miR-296-5p is downregulated in OS cell lines and clinical specimens

The expression levels of miR-296-5p in 45 cases of primary OS samples and paired adjacent normal tissues were analyzed by qRT-PCR. It was observed that the average expression level of miR-296-5p was lower in primary tumor samples compared to normal tissues (control vs. OS, 1.802 ± 0.313 vs. 0.618 ± 0.235, t = 6.402, P < 0.01) [Figure 1A]. Using the same technique, miR-296-5p expression in OS cell lines U2-OS, HOS, Saos-2, and MG-63 was analyzed and compared with the expression levels in normal HOB. As shown in Figure 1B, the expression level of miR-296-5p in the OS cell lines was lower than that in normal osteoblasts (all P < 0.01). These results suggest that miR-296-5p is downregulated in OS.

Figure 1
Figure 1:
Levels of mature miR-296-5p expression in osteosarcoma cell lines and tissues. (A) Expression levels of miR-296-5p were measured by qRT-PCR in osteoblasts. (B) Expression levels of miR-296-5p were measured by qRT-PCR in five osteosarcoma cell lines. qRT-PCR: quantitative reverse transcription polymerase chain reaction; OS: osteosarcoma; hFOB 1.19: a normal osteoblast cell line; P < 0.05, compared to hFOB 1.19; P < 0.01, compare to Control.

miR-296-5p suppresses OS cell proliferation, migration, and invasion in vitro

To investigate the function of miR-296-5p, HOS and Saos-2 cell lines were transfected with either miR-296-5p mimics or NC. The cells were then analyzed by qRT-PCR to confirm the overexpression (HOS: NC vs. miR-296-5p, 1.000 ± 0 vs. 7.900 ± 0.369, t = 18.23, P < 0.01; Saos-2: 1.000 ± 0 vs. 6.200 ± 0.322, t = 16.18, P < 0.01) [Figure 2A]. The 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide, thiazolyl blue tetrazolium bromide (MTT) assay demonstrated that overexpression of miR-296-5p attenuated the growth rate of HOS (NC vs. miR-296-5p, 0.897 ± 0.032 vs. 0.587 ± 0.369, t = 9.86, P < 0.01) and SAOS-2 cells (Saos-2: 1.000 ± 0 vs. 6.200 ± 0.023, t = 5.714, P < 0.01) [Figures 2B and C]. Using the scratch test, we detected the effects of miR-296-5p on in vitro migration of HOS and Saos-2 cells transfected with miR-296-5p mimics or the NC. As shown in Figure 2D, miR-296-5p overexpression suppressed the migration of HOS and Saos-2 cells. Similarly, miR-296-5p overexpression suppressed the invasion of HOS and Saos-2 cells [Figure 2E]. These results suggest that miR-296-5p can suppress the migration and invasion ability of OS cells in vitro.

Figure 2
Figure 2:
Effects of miR-296-5p on the proliferation, migration, and invasion of osteosarcoma cells in vitro. (A) HOS and Saos-2 cells were transfected with either miR-296-5p mimics or the negative control (NC). Twenty-four hours later, cells were assessed by qRT-PCR. (B and C) MTT assay. (D and E) Wound healing assay (bright field; original magnification 10×) and transwell migration and invasion assays (crystal violet staining; original magnification 10×) of HOS and Saos-2 cells transfected with miR-296-5p mimics or NC. P < 0.01. qRT-PCR: quantitative reverse transcription polymerase chain reaction.

SND1 is highly expressed in OS

Tissue samples of seven patients with OS and three healthy controls were collected to detect SND1 expression through western blotting [Figure 3A]. The expression of the SND1 protein in OS samples was higher than that in the control. Similarly, immunohistochemistry (IHC) analysis showed that SND1 expression in OS was higher than that in normal bone tissue [Figure 3B]. Subsequently, we detected SND1 relative mRNA expression in four OS cell lines (U2OS, HOS, Saos-2, and MG-63), and a normal osteoblast cell line (hFOB 1.19) using qRT-PCR (P < 0.01) [Figure 3C]. SND1 expression in U2OS, HOS, SAOS-2, and MG-63 was higher than that in hFOB 1.19 cells. The western blot analysis yielded the same result [Figure 3D]. These findings suggest that SND1 is strongly expressed in the OS.

Figure 3
Figure 3:
Levels of SND1 expression in osteosarcoma cell lines and tissues. (A and B) Expression levels of SND1 were measured by western blotting and IHC in normal and osteosarcoma tissues (original magnification, 40×). (C and D) The expression level of miR-296-5p was measured by qRT-PCR in osteoblasts and four osteosarcoma cell lines and humanosteoblasts (HOB) cells. CTRL: control; IHC: immunohistochemistry; OS: osteosarcoma; qRT-PCR: quantitative reverse transcription polymerase chain reaction. P < 0.05, P < 0.01, compared to hFOB 1.19.

Knocking down SND1 inhibits proliferation, migration, and invasion of OS cell lines

To investigate the role of SND1 in OS cell lines, we knocked down SND1 in HOS and SAOS-2 cells using short hairpin RNA (shRNA). First, we used western blotting to detect SND1 knockdown efficiency in HOS and SAOS-2. SND1 expression decreased significantly after the transfection of shRNA in HOS and SAOS-2 cells [Figure 4A]. MTT assay showed that HOS and SAOS-2 transfected with shSND1 resulted in decreased proliferation. Additionally, we detected the effects of SND1 knockdown on migration and invasion of HOS and SAOS-2 cells in vitro (NC vs. SND1 Knockdown, 0.897 ± 0.030 vs. 0.447 ± 0.025, t = 9.86, P < 0.01) [Figure 4B]. As shown in Figure 4C, SND1 knockdown significantly suppressed the migration of HOS and SAOS-2 cells (P < 0.05). Similarly, SND1 knockdown suppressed the invasion of HOS and SAOS-2 cells [Figure 4D]. These results suggest that SND1 facilitates the migration and invasion of OS cells in vitro.

Figure 4
Figure 4:
Effects of Staphylococcal Nuclease Domain-Containing Protein 1 (SND1) on the proliferation, migration, and invasion of osteosarcoma cells in vitro. (A) HOS and Saos-2 cells were transfected with SND1 shRNA or NC. Twenty-four hours later, cells were assessed by qRT-PCR. (B) MTT assay. (C and D) Wound healing assay (bright field; original magnification 10×) and transwell migration and invasion assays (crystal violet staining; original magnification 10×) of HOS and Saos-2 cells transfected with SND1 shRNA or NC. NC, negative control; qRT-PCR, quantitative reverse transcription polymerase chain reaction; shRNA, short hairpin RNA. P < 0.01.

SND1 is a direct downstream target of miR-296-5p

To investigate the molecular mechanism of miR-296-5p-mediated oncogenic effects, we determined the downstream targets using TargetScan and detected SND1 as one of the target genes of miR-296-5p. miRNA alignment analysis revealed that the 3′-UTR of SND1 harbors two putative binding sites for miR-296-5p [Figure 5A]. To further explore this observation in human primary tumors, the correlation between miR-296-5p expression and SND1 was analyzed in 12 OS tissues. We found that there was a negative correlation between the expression of miR-296-5p and SND1 in tumor tissues [Figure 5B and C]. Dual-luciferase assays revealed that miR-296-5p overexpression reduced the SND1 3′-UTR luciferase reporter activity (HOS: NC vs. miR-296-5p, 1.000 ± 0 vs. 0.283 ± 0.044, t = 16.25, P < 0.01; Saos-2: 1.000 ± 0 vs. 0.390 ± 0.028, t = 29.30, P < 0.01) [Figure 5D]. These results suggest that miR-296-5p can directly target SND1 in OS cells by interacting with its 3′-UTR.

Figure 5
Figure 5:
SND1 is a direct target of miR-296-5p. (A) miR-296-5p and its putative binding sequences in the 3′-UTR of SND1. Mutations were generated in the complementary site that binds to the seed region of miR-296-5p. (B) The qRT-PCR analysis of miR-296-5p and SND1 expression in 12 human osteosarcoma tissues. (C) Spearman correlation analyses between relative miR-296-5p expression and relative SND1 mRNA expression in 12 osteosarcoma tissues. (D) Luciferase reporter assay in HOS and Saos-2 cells revealed that miR-296-5p overexpression suppressed the activity of the firefly luciferase carrying the wild-type (wt) 3′-UTR of SND1. P < 0.01. OS: osteosarcoma; qRT-PCR: quantitative reverse transcription polymerase chain reaction.

Antitumor effects of miR-296-5p are mediated through the repression of SND1

Based on the above findings, we hypothesized that miR-296-5p might inhibit OS cell proliferation, migration, and invasion by repressing SND1 expression. To verify the direct targeting effect of miR-296-5p on SND1, we generated SND1-Flag plasmids and transfected them into HOS cell lines. Subsequently, miR-296-5p mimics were transfected into these cells. Western blot and qRT-PCR analyses revealed that miR-296-5p overexpression did not affect the mutated SND1-Flag expression (SND1 vs. miRNA-296-5p + SND1, 2.701 ± 0.402 vs. 2.300 ± 0.277, t = 1.45, P = 0.22) [Figures 6A and B]. Overexpression of SND1 abrogated the effects induced by miR-296-5p upregulation (miRNA-296-5p vs. miRNA-296-5p + SND1, 0.294 ± 0.159 vs. 2.300 ± 0.277, t = 12.68, P = 0.003). MTT assay showed that mutated SND1 facilitated HOS cell proliferation, despite the presence of miR-296-5p (miR-296-5p vs. SND1+miR-296-5p, mean = −0.593, 95%CI: −0.422 to −0.258, P < 0.01) [Figure 6C]. Similarly, in scratch and transwell assays, we observed that mutated SND1 facilitated HOS cell migration and invasion, even in the presence of miR-296-5p overexpression [Figures 6D and E].

Figure 6
Figure 6:
SND1 overexpression rescues the phenotype of osteosarcoma cells with miR-296-5p overexpression. (A and B) Western blot and qRT-PCR analyses of SND1-flag expression in HOS cells transfected with miR-296-5p mimics, SND-flag, or NC. (C) MTT assay. (D and E) Wound healing assay (bright field; original magnification, 10×) and transwell assay (crystal violet staining; original magnification 10×) of HOS and Saos-2 cells transfected with the SND1-flag, miR-296-5p mimics, or NC. NC, negative control; qRT-PCR, quantitative reverse transcription polymerase chain reaction. P < 0.05, P < 0.01. ns: no significance.

Discussion

Mounting evidence has shown that miRNAs participate in the development of human cancers. Among these miRNAs, studies have found that miRNA-296-5p has a tumor-promoting effect. Maia et al[22] showed that the expression of miRNA-296-5p is also associated with radiotherapy resistance in early laryngeal carcinoma. Patients with early stage laryngeal carcinoma and high expression of miRNA-296-5p have higher radiotherapy resistance and shorter tumor-free survival.[22] Li et al[23] also revealed that miR-296-5p can promote the proliferation of gastric cancer by inhibiting Caudal-related homeobox 1 (CDX1). Although several studies have suggested that miR-296-5p plays an important regulatory role in the development of tumors, the exact role of miR-296-5p in OS has not yet been reported. According to our preliminary study results, the expression level of miR-296-5p in OS tissues was significantly lower than that in normal bone tissues, suggesting that it may affect OS inhibition.

In this study, we found that miR-296-5p was downregulated in all four OS cell lines compared to normal HOB, and the overall average expression levels were lower in primary samples compared to normal tissues. Overexpression of miR-296-5p in OS cells suppressed cell proliferation and inhibited cell migration and invasion. These findings support the view that miR-142-3p mainly functions as a tumor suppressor in OS.

Tudor staphylococcal nuclease (SND1) is an important component of the RNA-induced silencing complex (RISC) and is a core component of the RNA interference (RNAi) mechanism.[24,25] Recent studies have shown that SND1 is a highly conserved component of the programmed cell death degradation group,[26,27] revealing its important role in the process of programmed cell death. Because SND1 plays an important role as a major component of RISC, its role in the tumor has become a topic of interest in recent years. Several studies have shown that SND1 plays an important regulatory role in the occurrence, development, and metastasis of breast cancer, liver cancer, prostate cancer, lung cancer, malignant glioma, gastric cancer, cervical cancer, and other malignant tumors.[28–38] As SND1 is a core component of RISC, most of the previous studies have focused on its role in miRNA regulation and related diseases, while studies on the regulation of its own expression and related mechanisms are relatively rare. In 2015, relevant research began to explore the regulation of miRNA on SND1 and its related mechanisms.[36–38] Emdad et al[36] found that inhibition of miRNA-184 in malignant glioma cells can upregulate the expression of SND1 and promote tumor invasion. Other studies have also found that miRNA-184 can inhibit the proliferation and invasion of human glioma and breast cancer cells by inhibiting the expression of genes, including SND1 and MMP-2/9.[37] Ma et al[38] found that miRNA-361-5p can inhibit the growth and metastasis of colorectal and gastric cancers by targeting SND1. However, the role of SND1 in OS was unclear. A recent study analyzed 72 single-nucleotide polymorphisms in 21 miRNA processing genes, in 99 patients with OS and 387 healthy controls. Single-nucleotide polymorphisms were found to be associated with the susceptibility of OS and were located in the genes involved in the major components of RISC (CNOT1, CNOT4, and SND1), revealing that SND1 may play an important role in the occurrence, development, and metastasis of OS.[39]

In OS cell lines (HOS, U2OS, Saos-2, and MG-63), we found that the expression of miR-296-5p was significantly lower than that of HOB (hFOB 1.19), but the expression of SND1 in OS cell lines and tissues was significantly higher than that in hFOB 1.19 and normal bone tissues, which were consistent with those in OS tissue specimens. We predicted that SND1 is one of the potential targets of miR-296-5p. Based on the identification of conserved binding sites, we found that the expression of SND1 was negatively correlated with the expression of miR-296-5p in OS tissues and cell lines. Subsequently, we found that luciferase activity was significantly reduced after the co-transfection of miR-296-5p mimics and SND1 3′-UTR vector harboring the miR-296-5p target sequence, in a dual-luciferase assay. Next, we overexpressed SND1 in miR-296-5p mimic-overexpressed HOS cell lines and found that SND1 can subvert the repression of proliferation, migration, and invasion by miR-296-5p mimics, which further suggests that miR-296-5p might regulate the proliferation and metastasis of OS by targeting SND1. Indubitably, this study had a few limitations such as the limited number of clinical samples. Moreover, the relevant mechanisms need to be explored further.

Our results indicate that miR-296-5p is downregulated in OS and exerts tumor-suppressive effects in OS cells by targeting SND1. Supplementation of miR-296-5p may serve as an effective strategy for the treatment of OS.

Funding

This study was granted by the National Natural Science Foundation of China (No. 81572179 and No. 81874018), the Clinical Special Program of Jiangsu Province (No. BL2014044), the Mingsheng Science and Technology Project of Suzhou City (No. SS201634 and No. SS201814), the Clinical Medical Center Project of Suzhou City (No. SZZX201504), Advantage Discipline Groups of the Second Affiliated Hospital of Soochow University (No. XKQ2015001), the Zhejiang Provincial Natural Science Foundation of China (Nos. LY15H060006 and LY16H060007), and the Zhejiang Provincial Health Bureau Science Foundation of China (No. 2018KY017).

Conflicts of interest

None.

References

1. Vander Griend RA. Osteosarcoma and its variants. Orthop Clin North Am 1996; 27 (3):575–581.
2. Allison DC, Carney SC, Ahlmann ER, Hendifar A, Chawla S, Fedenko A, et al. A meta-analysis of osteosarcoma outcomes in the modern medical era. Sarcoma 2012; 2012:704872doi: 10.1155/2012/704872.
3. Fagioli F, Aglietta M, Tienghi A, Ferrari S, Brach del Prever A, Vassallo E, et al. High-dose chemotherapy in the treatment of relapsed osteosarcoma: an Italian sarcoma group study. J Clin Oncol 2002; 20 (8):2150–2156. doi: 10.1200/JCO.2002.08.081.
4. Harrison DJ, Geller DS, Gill JD, Lewis VO, Gorlick R. Current and future therapeutic approaches for osteosarcoma. Expert Rev Anticancer Ther 2018; 18:39–50. doi: 10.1080/14737140.2018.1413939.
5. Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 1998; 391:806–811. doi: 10.1038/35888.
6. Biswas S. MicroRNAs as therapeutic agents: the future of the battle against cancer. Curr Top Med Chem 2018; 18:2544–2554. doi: 10.2174/1568026619666181120121830.
7. Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 1993; 75:843–854. doi: 10.1016/0092-8674(93)90529-y.
8. Wightman B, Ha I, Ruvkun G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell 1993; 75:855–862. doi: 10.1016/0092-8674(93)90530-4.
9. Hsu SD, Lin FM, Wu WY, Liang C, Huang WC, Chan WL, et al. miRTarBase: A database curates experimentally validated microRNA-target interactions. Nucleic Acids Res 2011; 39:D163–D169. doi: 10.1093/nar/gkq1107.
10. Hammond SM. An overview of microRNAs. Adv Drug Deliv Rev 2015; 87:3–14. doi: 10.1016/j.addr.2015.05.001.
11. Calin GA, Sevignani C, Dumitru CD, Hyslop T, Noch E, Yendamuri S, et al. Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers. Proc Natl Acad Sci U S A 2004; 101:2999–3004. doi: 10.1073/pnas.0307323101.
12. Zhang X, Liu Y, Huang WC, Zheng LC. MiR-125b-1-3p exerts antitumor functions in lung carcinoma cells by targeting S1PR1. Chin Med J 2018; 131:1909–1916. doi: 10.4103/0366-6999.238135.
13. Zhang X, Xing ND, Lai CJ, Liu R, Jiao W, Wang J, et al. MicroRNA-375 suppresses the tumor aggressive phenotypes of clear cell renal cell carcinomas through regulating YWHAZ. Chin Med J 2018; 131:1944–1950. doi: 10.4103/0366-6999.238153.
14. Li CY, Zhang WW, Xiang JL, Wang XH, Li J, Wang JL. Identification of microRNAs as novel biomarkers for esophageal squamous cell carcinoma: A study based on The Cancer Genome Atlas (TCGA) and bioinformatics. Chin Med J 2019; 132:2213–2222. doi: 10.1097/CM9.0000000000000427.
15. Chi Q, Wang ZY, Li HY, Song DB, Xu H, Ma G, et al. Tumor-suppressor microRNA-139-5p restrains bladder cancer cell line ECV-304 properties via targeting Connexin 43. Chin Med J 2019; 132:2354–2361. doi: 10.1097/CM9.0000000000000455.
16. Vaira V, Faversani A, Martin NM, Garlick DS, Ferrero S, Nosotti M, et al. Regulation of lung cancer metastasis by Klf4-Numb-like signaling. Cancer Res 2013; 73:2695–2705. doi: 10.1158/0008-5472.CAN-12-4232.
17. Xu C, Li S, Chen T, Hu H, Ding C, Xu Z, et al. miR-296-5p suppresses cell viability by directly targeting PLK1 in non-small cell lung cancer. Oncol Rep 2016; 35:497–503. doi: 10.3892/or.2015.4392.
18. Savi F, Forno I, Faversani A, Luciani A, Caldiera S, Gatti S, et al. miR-296/Scribble axis is deregulated in human breast cancer and miR-296 restoration reduces tumour growth in vivo. Clin Sci (Lond) 2014; 127:233–242. doi: 10.1042/CS20130580.
19. Lee KH, Lin FC, Hsu TI, Lin JT, Guo JH, Tsai CH, et al. MicroRNA-296-5p (miR-296-5p) functions as a tumor suppressor in prostate cancer by directly targeting Pin1. Biochim Biophys Acta 2014; 1843:2055–2066. doi: 10.1016/j.bbamcr.2014.06.001.
20. Rong D, Lu C, Zhang B, Fu K, Zhao S, Tang W, et al. CircPSMC3 suppresses the proliferation and metastasis of gastric cancer by acting as a competitive endogenous RNA through sponging miR-296-5p. Mol Cancer 2019; 18:25doi: 10.1186/s12943-019-0958-6.
21. Duan Z, Choy E, Harmon D, Liu X, Susa M, Mankin H, et al. MicroRNA-199a-3p is downregulated in human osteosarcoma and regulates cell proliferation and migration. Mol Cancer Ther 2011; 10:1337–1345. doi: 10.1158/1535-7163.MCT-11-0096.
22. Maia D, de Carvalho AC, Horst MA, Carvalho AL, Scapulatempo-Neto C, Vettore AL. Expression of miR-296-5p as predictive marker for radiotherapy resistance in early-stage laryngeal carcinoma. J Transl Med 2015; 13:262doi: 10.1186/s12967-015-0621-y.
23. Li T, Lu YY, Zhao XD, Guo HQ, Liu CH, Li H, et al. MicroRNA-296-5p increases proliferation in gastric cancer through repression of Caudal-related homeobox 1. Oncogene 2014; 33:783–793. doi: 10.1038/onc.2012.637.
24. Scadden AD. The RISC subunit Tudor-SN binds to hyper-edited double-stranded RNA and promotes its cleavage. Nat Struct Mol Biol 2005; 12:489–496. doi: 10.1038/nsmb936.
25. Li CL, Yang WZ, Chen YP, Yuan HS. Structural and functional insights into human Tudor-SN, a key component linking RNA interference and editing. Nucleic Acids Res 2008; 36:3579–3589. doi: 10.1093/nar/gkn236.
26. Sundstrom JF, Vaculova A, Smertenko AP, Savenkov EI, Golovko A, Minina E, et al. Tudor staphylococcal nuclease is an evolutionarily conserved component of the programmed cell death degradome. Nat Cell Biol 2009; 11:1347–1354. doi: 10.1038/ncb1979.
27. Cui X, Zhao C, Yao X, Qian B, Su C, Ren Y, et al. SND1 acts as an anti-apoptotic factor via regulating the expression of lncRNA UCA1 in hepatocellular carcinoma. RNA Biol 2018; 15:1364–1375. doi: 10.1080/15476286.2018.1534525.
28. Zhao X, Duan Z, Liu X, Wang B, Wang X, He J, et al. MicroRNA-127 is downregulated by Tudor-SN protein and contributes to metastasis and proliferation in breast cancer cell line MDA-MB-231. Anat Rec (Hoboken) 2013; 296:1842–1849. doi: 10.1002/ar.22823.
29. Blanco MA, Aleckovic M, Hua Y, Li T, Wei Y, Xu Z, et al. Identification of staphylococcal nuclease domain-containing 1 (SND1) as a Metadherin-interacting protein with metastasis-promoting functions. J Biol Chem 2011; 286:19982–19992. doi: 10.1074/jbc.M111.240077.
30. Yu L, Liu X, Cui K, Di Y, Xin L, Sun X, et al. SND1 acts downstream of TGFbeta1 and upstream of Smurf1 to promote breast cancer metastasis. Cancer Res 2015; 75:1275–1286. doi: 10.1158/0008-5472.CAN-14-2387.
31. Yin J, Ding J, Huang L, Tian X, Shi X, Zhi L, et al. SND1 affects proliferation of hepatocellular carcinoma cell line SMMC-7721 by regulating IGFBP3 expression. Anat Rec (Hoboken) 2013; 296:1568–1575. doi: 10.1002/ar.22737.
32. Santhekadur PK, Das SK, Gredler R, Chen D, Srivastava J, Robertson C, et al. Multifunction protein staphylococcal nuclease domain containing 1 (SND1) promotes tumor angiogenesis in human hepatocellular carcinoma through novel pathway that involves nuclear factor kappaB and miR-221. J Biol Chem 2012; 287:13952–13958. doi: 10.1074/jbc.M111.321646.
33. Kuruma H, Kamata Y, Takahashi H, Igarashi K, Kimura T, Miki K, et al. Staphylococcal nuclease domain-containing protein 1 as a potential tissue marker for prostate cancer. Am J Pathol 2009; 174:2044–2050. doi: 10.2353/ajpath.2009.080776.
34. Cappellari M, Bielli P, Paronetto MP, Ciccosanti F, Fimia GM, Saarikettu J, et al. The transcriptional co-activator SND1 is a novel regulator of alternative splicing in prostate cancer cells. Oncogene 2014; 33:3794–3802. doi: 10.1038/onc.2013.360.
35. Zagryazhskaya A, Surova O, Akbar NS, Allavena G, Gyuraszova K, Zborovskaya IB, et al. Tudor staphylococcal nuclease drives chemoresistance of non-small cell lung carcinoma cells by regulating S100A11. Oncotarget 2015; 6:12156–12173. doi: 10.18632/oncotarget.3495.
36. Emdad L, Janjic A, Alzubi MA, Hu B, Santhekadur PK, Menezes ME, et al. Suppression of miR-184 in malignant gliomas upregulates SND1 and promotes tumor aggressiveness. Neuro Oncol 2015; 17:419–429. doi: 10.1093/neuonc/nou220.
37. Feng R, Dong L. Inhibitory effect of miR-184 on the potential of proliferation and invasion in human glioma and breast cancer cells in vitro. Int J Clin Exp Pathol 2015; 8:9376–9382.
38. Ma F, Song H, Guo B, Zhang Y, Zheng Y, Lin C, et al. MiR-361-5p inhibits colorectal and gastric cancer growth and metastasis by targeting staphylococcal nuclease domain containing-1. Oncotarget 2015; 6:17404–17416. doi: 10.18632/oncotarget.3744.
39. Bilbao-Aldaiturriaga N, Gutierrez-Camino A, Martin-Guerrero I, Pombar-Gomez M, Zalacain-Diez M, Patino-Garcia A, et al. Polymorphisms in miRNA processing genes and their role in osteosarcoma risk. Pediatr Blood Cancer 2015; 62:766–769. doi: 10.1002/pbc.25416.
Keywords:

miR-296-5p; Osteosarcoma; SND1; Tumor suppressor; miRNA

Copyright © 2021 The Chinese Medical Association, produced by Wolters Kluwer, Inc. under the CC-BY-NC-ND license.