Secondary Logo

Journal Logo

Original article

Phosphorylation of PTEN increase in pathological right ventricular hypertrophy in rats with chronic hypoxia induced pulmonary hypertension

Nie, Xin; Shi, Yiwei; Yu, Wenyan; Xu, Jianying; Hu, Xiaoyun; Du, Yongcheng

Author Information
doi: 10.3760/cma.j.issn.0366-6999.20131622
  • Free

Abstract

Pulmonary hypertension (PH), a common complication of cardiopulmonary disease, is characterised by high pulmonary blood pressure, increased pulmonary vascular resistance, pulmonary vascular remodelling, right ventricular hypertrophy and right ventricular failure.1,2 Although the pathogenesis of PH remains unclear, hypoxia has been identified as one of the main factors.3 Right ventricular hypertrophy is a positive response to the early stages of PH, which increases cardiac output. However, chronic stimulation eventually results in decompensation and heart failure. The molecular pathways involved during that pathological progression have not been completely clarified. Several factors are thought to contribute to altered cardiac gene expression, which in turn triggers myocardial cell hypertrophy, apoptosis and fibrosis.4 One of the proteins thought to be involved in this process is phosphatase and tensin homologue on chromosome ten (PTEN).5

The tumour suppressor PTEN is a member of the phosphatase superfamily. It contains tyrosine and a phosphatase that is specific for both phosphorylated tyrosine and serine/threonine substrates and which also acts on dephosphorylated nonprotein substrates including phosphoinositide lipids, mRNA and complex carbohydrates.6,7 The phosphatase activity of PTEN is associated with several cellular processes, including growth, proliferation, survival and migration.8-10

PTEN has been identified as an antioncogene that is inactivated in breast, endometrial, glial, liver and prostate cancers.11-15 It has been recently shown that cardiac enlargement is associated with experimentally induced, cardiomyocyte specific, inactivation of PTEN in mice.5 The present study investigated the role of PTEN in the cardiac response to increased pulmonary vascular resistance in hypoxia induced PH rats.

METHODS

Animals

All procedures undertaken in this study complied with the NIH Guide for the Care and Use of Laboratory Animals (NIH Publications No. 80-23). Healthy adult male Sprague Dawley rats weighing 200 to 250 g were given standard laboratory food and housed in a standard environment.

Experimental groups

Pathogen free, adult male Sprague Dawley rats were randomly divided into an untreated control group and five hypoxic groups (n=12 per group). The rats in the hypoxic groups were exposed to normobaric hypoxia for 1, 3, 7, 14 or 21 days. Hypoxic conditions were obtained by placing rats in a ventilated Plexiglas chamber with the oxygen level maintained at (10.0±0.1)% with a mixture of nitrogen and oxygen gases.16 The chamber environment was monitored using an oxygen analyzer. Soda lime was used to absorb CO2. The chamber was opened every other day for 30 minutes to replenish food and water and cleaning the cages.

Haemodynamic measurement and right ventricle hypertrophy index

The rats were anaesthetized by intraperitoneal injection of pentobarbital sodium (50 mg/kg). For estimation of right ventricular hypertrophy, the right ventricular systolic pressure was measured via catheterization of pulmonary artery and a miniature pressure transducer (Millar Instruments, USA) and results recorded by a polygraph system (AD Instruments, Australia). The hearts were excised, dissected and weighed to determine right ventricular hypertrophy index (RVHI) as the ratio of right ventricle (RV) to left ventricle (LV) plus septum.17

Histomorphometry of right ventricle

The hearts were fixed with 10% buffered formalin (pH 7.4) and embedded in paraffin. Tissues were cut into 5 μm thick sections and stained with hematoxylin and eosin (measurement of cardiomyocyte cross sectional area) and picrosirius red (measurement of collagen volume fraction and quantified using image analysis software as previously described18,19).

Real time PCR analysis

The total RNA from each ventricle was isolated using Trizol reagent (Takara Biotechnology Inc., Japan). The RNA was reverse transcribed using PrimeScript RT reagent Kit (Takara Biotechnology Inc.). The cDNA was amplified by real time fluorescent quantitative PCR and the 2ΔΔCT method using SYBR Premix Ex Taq (Takara Biotechnology Inc.) on an ABI StepOne System (Applied Biosystems, USA).

The following primers were used for PTEN: 5′AGCTTGTCCTCCCGTCGT3′ (forward primer) and 5′CCAGTCAGAGGCGCTAT3′ (reverse primer). The primers for β-actin were: 5′TCATCACTATCGGCAATGA3′(forward primer) and 5′CACTGTGTTGGCATAGAGGT 3′ (reverse primer) used as an endogenous control.

Western blotting analysis

Right and left ventricular homogenates were prepared in radioimmunoprecipitation lysis buffer (Beyotime Institute of Biotechnology, China) containing a mixture of protease inhibitors. Equal amounts of protein (50 μg per lane) were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE) before being transferred to polyvinylidene difluoride membrane for Western blotting analysis. The primary rabbit polyclonal antibodies against PTEN, phosphorylated PTEN (p-PTEN) and β-actin (Santa Cruz Biotechnology Inc., USA) were used to probe the membranes with horseradish peroxidase conjugated goat antirabbit antibodies (Stressgen Biotechnologies Corporation, Canada) before detection with the ECL Plus chemiluminescence kit (Thermo Fisher Scientific Inc., USA). The luminescent signals were quantified using a Quantity One system (Bio-Rad Laboratories Inc., USA). Experiments were done in triplicate.

Statistical analysis

Statistical analysis was performed using SPSS 16.0 (SPSS Inc., USA). The results were expressed as mean±standard deviation (SD). Analysis of variance was used to analyze between group differences. Values of P <0.05 were considered statistically significant.

RESULTS

Pathological hypertrophy and right ventricular remodelling

Right ventricular systolic pressure significantly increased in a time dependent manner in rats exposed to hypoxia compared to that in control rats, reaching a maximum of (50.1±1.3) mmHg on day 21 compared with (23.8±0.8) mmHg in the control group (Figure 1A). There was a significant parallel increase in hypertrophy index from day 3 to day 21 of hypoxic exposure, reaching levels one and a half times higher than in the normoxic group on day 21 (Figure 1B). These findings are indicative of right ventricular hypertrophy.

Figure 1
Figure 1:
Systolic pressure and hypertrophy index of the right ventricle. Right ventricular systolic pressure (A) and right ventricle (RV)/(Left ventricle (LV) + Septum (S)) weight ratio (B) increased in a time dependent manner following hypoxic exposure (n=12 for each group. * P <0.05 compared with that of the control group, hypoxic exposure for day 0). RVSP: right ventricular systolic pressure.

Histologically, an increase in the right ventricular size was observed (Figure 2A) in hearts from hypoxic rats. The hypertrophy appeared as structural changes resulting from myocardial cell hypertrophy and interstitial fibrosis of right ventricle after hypoxic exposure for 14 days (Figure 2B and 2D). The cardiomyocyte cross sectional area and collagen volume fraction increased significantly compared with the control group (Figure 2C and 2E).

Figure 2.
Figure 2.:
Pathological right ventricular hypertrophy of PH rats in response to hypoxic exposure. A: Representative right ventricular dilation following hypoxic exposure for 14 days. B and C: Representative HE stained right ventricular sections (B) showing increased interstitial fibrosis (blue staining, original magnification×100) and cardiomyocyte cross sectional area (MCSA) quantified and shown in C. D and E: Representative picrosirius red stained, right ventricular sections (D) showing interstitial fibrosis (red staining, original magnification×100). Collagen volume fraction (CVF) quantified and shown in E. Bars=100 μm. n=15 for each group. * P <0.05 compared with that of control group, hypoxic exposure for 0 day. LV: left ventricle; RV: right ventricle.

PTEN and phosphorylated PTEN levels in the right and left ventricle

Real time PCR results showed no statistically significant differences in relative PTEN transcript expression between hypoxic and control groups in the right or left ventricle (Figure 3). Likewise, Western blotting analysis showed no evidence of differences in PTEN protein expression (55 000) between the hypoxic and control groups in either ventricle (Figure 4A and 4B).

Figure 3.
Figure 3.:
Determination of PTEN transcript expression levels in the right and left ventricles of hypertensive rats. Total RNA was extracted from the right and left ventricles of PH rats and analyzed by real time fluorescent quantitative PCR comparative CT method. There was no significant difference in mRNA between the hypoxic exposure group and the control group in either the LV or RV (n=3 repeated trials for each group).
Figure 4.
Figure 4.:
Changes of PTEN protein expression and activity in ventricles of hypertensive rats. A: Western blotting analysis for PTEN protein expression and phosphorylation levels in right ventricle or left ventricle lysates of rats after hypoxic exposure for 0, 1, 3, 7, 14, 21 days (n=3 for each group). B and C: Semiquantitative analysis indicated that markedly promoted phosphorylation of PTEN in the RV after hypoxic exposure 3-21 days (B), while the PTEN and p-PTEN levels of left ventricle appeared normal (C) (n=3 for each group; * P <0.05 compared with that of control group, hypoxic exposure for 0 day).

To analyze further the role of PTEN in the hypoxia induced right ventricular hypertrophy, p-PTEN protein expression levels were analyzed. As shown in Figure 4C, there was a time dependent increase in right ventricular p-PTEN expression after exposure to hypoxia. The between-group differences were statistically significant on days 3, 7, 14 and 21. No changes were seen in p-PTEN protein levels in left ventricular tissue.

DISCUSSION

Cardiomyocytic hypertrophy is a characteristic response to pulmonary pressure overload in chronic lung, heart and sleep diseases.5,20,21 Pathological right ventricular remodelling and hypertrophy are associated with the risk of dying. However, the roles of molecular pathways in this process are poorly understood. To clarify further the signal pathway in the basic pathological process, our study provides the documented evidence that PTEN is involved in the development of pathological right ventricular hypertrophy in response to PH. Over the three weeks of normobaric hypoxia, adult rats exhibited significant PH and right ventricular hypertrophy in a time dependent manner. We detected the expression and phosphorylation levels of PTEN in ventricles of the rats simultaneously. The mRNA and protein levels of PTEN in hypoxic rats remained unchanged, but the phosphorylation level of PTEN was increased in RV after hypoxic exposure. This trend was consistent with the findings for systolic pressure and hypertrophy index. Thus, p-PTEN participates in the process of pathological, right ventricular hypertrophy and remodelling in response to increased pulmonary vascular resistance.

Hypertrophy and hyperplasia of cardiomyocytes with increasing accumulation of extracellular matrix were found in RV of the rats further demonstrating that the structural remodelling of ventricle are pathological changes developing (hypoxic) PH. The pathological remodelling and hypertrophy is a result of an imbalance of hyperplasia and apoptosis in cells of the ventricular wall. It has been shown that PTEN is a downregulator of phosphoinositide 3-kinase (PI3K) signalling in myocardial, vascular smooth muscle and endothelial cells.22 This down-regulation is associated with several aspects of cellular function, including survival, growth, metabolism and apoptosis.

It has been reported recently that disruption of PTEN in the heart results in physiological hypertrophy, characterized by increased width and length of myocardial cells,5,18 however, there was no evidence of fibrotic changes or decompensation, even though Akt protein kinase B (PKB) was activated. Therefore, PTEN acts to prevent heart hypertrophy by blocking the growth factor signalling pathway.

However, other studies have proposed that PTEN plays a negative role in myocardial hypertrophy. Consistent with the key role of Akt/PKB in cell survival, increases in PTEN activity have been associated with enhanced apoptosis of cardiovascular cells.22 Apoptosis has been also associated with increased PTEN expression in neonatal cardiomyocytes.5 Another study23 suggested that increased basal phosphorylation of Akt/PKB increases glycogen synthase kinase-3β activity and contributes to decreased apoptosis in PTEN mutant mice.

Loss of PTEN has been also shown to be associated with enhanced expression levels of vascular endothelial growth factor-A (VEGF-A) and angiopoictin-2 (Ang-2) mediated via mammalian target of rapamycin (mTOR) pathway.24,25 Both of these factors are thought to be necessary for coronary angiogenesis as they increase coronary flow and thereby reduce ischaemic injury during the process of cardiomyocytic hypertrophy. This in turn protects against haemodynamic stress overload.23 In addition to regulating the balance between cardiomyocytic hypertrophy, growth, apoptosis and myocardial blood flow, PTEN might be also associated with myocardial energy metabolism in an attempt to protect myocardial cells against pathological hypertrophy.26,27

Several further studies have confirmed that loss of PTEN in heart muscle has a negative effect on the heart rate and basal myocardial contractility,28 both of which are associated with heart failure. However, the oxygen demand also decreases during this process. Perhaps then, negative inotropic effect increases resistance to ischaemic injury by reducing the myocardial oxygen consumption.

The data presented above indicate that multiple mechanisms are involved in the regulation of Akt signalling by PTEN in response to different stimuli. As a complement to findings reported using PTEN knock out models, our results indicate that right ventricular hypertrophy was not significantly correlated with changes in PTEN expression. However, it was related to increased levels of phosphorylated PTEN. Phosphorylation of PTEN changes its conformation thereby suppressing activity of PTEN by controlling the formation of complexes which include PTEN.29 Thus, changes in PTEN activity are involved in right ventricular hypertrophy. However, the pathways responsible for hypertrophy in hypoxia induced, hypertensive rats might be different from those activated therapeutically by medications such as isoprenaline and G protein-coupled receptor (GPCR) agonists, which positively regulate the PTEN mRNA and protein levels.30

A number of studies suggested that regulation of PTEN initiates or prevents cardiac hypertrophy via different downstream pathways in different cardiovascular physiological processes and diseases. As mentioned in the introduction, the primary objective of our study was to confirm the involvement of PTEN in pathological right ventricular hypertrophy in a hypoxic rat model. Our findings indicated that phosphorylation of PTEN was markedly upregulated in the hypertrophic right ventricular tissue of hypoxic rats. Future research should focus on investigating the role of the PTEN/Akt pathway and establishing whether PTEN inhibitors or activators would provide beneficial agents for preventing right ventricular hypertrophy caused by PH.

REFERENCES

1. Beghetti M, Spahr Schopfer I, Mensi N, Morel DR, Rimensberger PC. Effects of inhaled nitric oxide and intravenous magnesium sulphate, alone and in combination, in a porcine model of hypoxic pulmonary hypertension. Med Sci Monit 2003; 9: BR193-198.
2. Shi Y, Wang C, Han S, Pang B, Zhang N, Wang J, et al. Determination of PKC isoform specific protein expression in pulmonary arteries of rats with chronic hypoxia induced pulmonary hypertension. Med Sci Monit 2012; 18: BR69-75.
3. Stenmark KR, Mecham RP. Cellular and molecular mechanisms of pulmonary vascular remodeling. Annu Rev Physiol 1997; 59: 89-144.
4. Jordan JD, Landau EM, Iyengar R. Signaling networks: the origins of cellular multitasking. Cell 2000; 103: 193-200.
5. Schwartzbauer G, Robbins J. The tumor suppressor gene PTEN can regulate cardiac hypertrophy and survival. J Biol Chem 2001; 276: 35786-35793.
6. Alonso A, Sasin J, Bottini N, Friedberg I, Osterman A, Godzik A, et al. Protein tyrosine phosphatases in the human genome. Cell 2004; 117: 699-711.
7. Andersen JN, Jansen PG, Echwald SM, Mortensen OH, Fukada T, Del Vecchio R, et al. A genomic perspective on protein tyrosine phosphatases: gene structure, pseudogenes, and genetic disease linkage. FASEB J 2004; 18: 8-30.
8. Backman S, Stambolic V, Mak T. PTEN function in mammalian cell size regulation. Curr Opin Neurobiol 2002; 12: 516-522.
9. Leslie NR, Downes CP. PTEN: the down side of PI 3 kinase signalling. Cell Signal 2002; 14: 285-295.
10. Salmena L, Carracedo A, Pandolfi PP. Tenets of PTEN tumor suppression. Cell 2008; 133: 403-414.
11. Yuan Q, Cai S, Zhang X, Liu Z, Li Z, Luo X, et al. A new protoapigenone analog RY10 4 induces apoptosis and suppresses invasion through the PI3K/Akt pathway in human breast cancer. Cancer Lett 2012; 324: 210-220.
12. Zhao LJ, Liu N, Li XP, Wang JL, Wei LH. Phosphatase and tensin homolog gene inhibits the effect induced by gonadotropin releasing hormone subtypes in human endometrial carcinoma cells. Chin Med J 2010; 123: 1170-1175.
13. Comincini S, Paolillo M, Barbieri G, Palumbo S, Sbalchiero E, Azzalin A, et al. Gene expression analysis of an EGFR indirectly related pathway identified PTEN and MMP9 as reliable diagnostic markers for human glial tumor specimens. J Biomed Biotechnol 2009; 2009: 924565.
14. Lu D, Han C, Wu T. Microsomal prostaglandin E synthase 1 inhibits PTEN and promotes experimental cholangiocarcinogenesis and tumor progression. Gastroenterology 2011; 140: 2084-2094.
15. Hu Z, Gu Y, Han B, Zhang J, Li Z, Tian K, et al. Knockdown of AGR2 induces cellular senescence in prostate cancer cells. Carcinogenesis 2012; 33: 1178-1186.
16. Christou H, Morita T, Hsieh CM, Koike H, Arkonac B, Perrella MA, et al. Prevention of hypoxia-induced pulmonary hypertension by enhancement of endogenous heme oxygenase-1 in the rat. Circ Res 2000; 86: 1224-1229.
17. Deten A, Millar H, Zimmer HG. Catheterization of pulmonary artery in rats with an ultraminiature catheter pressure transducer. Am J Physiol Heart Circ Physiol 2003; 285: H2212-H2217.
18. Fernandes I, Pacheco TR, Costa A, Santos AC, Fernandes AR, Santos M, et al. Prognostic significance of AKT/mTOR signaling in advanced neuroendocrine tumors treated with somatostatin analogs. Onco Targets Ther 2012; 5: 409-416.
19. Kassiri Z, Oudit GY, Sanchez O, Dawood F, Mohammed FF, Nuttall RK, et al. Combination of tumor necrosis factor alpha ablation and matrix metalloproteinase inhibition prevents heart failure after pressure overload in tissue inhibitor of metalloproteinase 3 knock out mice. Circ Res 2005; 97: 380-390.
20. Mocanu MM, Field DC, Yellon DM. A potential role for PTEN in the diabetic heart. Cardiovasc Drugs Ther 2006; 20: 319-321.
21. Lutucuta S, Tsybouleva N, Ishiyama M, Defreitas G, Wei L, Carabello B, et al. Induction and reversal of cardiac phenotype of human hypertrophic cardiomyopathy mutation cardiac troponin T Q92 in switch on switch off bigenic mice. J Am Coll Cardiol 2004; 44: 2221-2230.
22. Aikawa R, Nawano M, Gu Y, Katagiri H, Asano T, Zhu W, et al. Insulin prevents cardiomyocytes from oxidative stress induced apoptosis through activation of PI3 kinase/Akt. Circulation 2000; 102: 2873-2879.
23. Oudit GY, Kassiri Z, Zhou J, Liu QC, Liu PP, Backx PH, et al. Loss of PTEN attenuates the development of pathological hypertrophy and heart failure in response to biomechanical stress. Cardiovasc Res 2008; 78: 505-514.
24. Shiojima I, Walsh K. Regulation of cardiac growth and coronary angiogenesis by the Akt/PKB signaling pathway. Genes Dev 2006; 20: 3347-3365.
25. Huang J, Kontos CD. PTEN modulates vascular endothelial growth factor mediated signaling and angiogenic effects. J Biol Chem 2002; 277: 10760-10766.
26. Barger PM, Kelly DP. Fatty acid utilization in the hypertrophied and failing heart: molecular regulatory mechanisms. Am J Med Sci 1999; 318: 36-42.
27. Barger PM, Kelly DP. PPAR signaling in the control of cardiac energy metabolism. Trends Cardiovasc Med 2000; 10: 238-245.
28. Zu L, Shen Z, Wesley J, Cai ZP. PTEN inhibitors cause a negative inotropic and chronotropic effect in mice. Eur J Pharmacol 2011; 650: 298-302.
29. Choi JS, Park HJ, Kim HY, Kim SY, Lee JE, Choi YS, et al. Phosphorylation of PTEN and Akt in astrocytes of the rat hippocampus following transient forebrain ischemia. Cell Tissue Res 2005; 319: 359-366.
30. Crackower MA, Oudit GY, Kozieradzki I, Sarao R, Sun H, Sasaki T, et al. Regulation of myocardial contractility and cell size by distinct PI3K PTEN signaling pathways. Cell 2002; 110: 737-749.
Keywords:

PTEN; chronic hypoxia; pulmonary hypertension; hypertrophy

© 2014 Chinese Medical Association